CN113604478A - Lotus corniculatus LcMYB5 gene and application thereof - Google Patents
Lotus corniculatus LcMYB5 gene and application thereof Download PDFInfo
- Publication number
- CN113604478A CN113604478A CN202111009708.XA CN202111009708A CN113604478A CN 113604478 A CN113604478 A CN 113604478A CN 202111009708 A CN202111009708 A CN 202111009708A CN 113604478 A CN113604478 A CN 113604478A
- Authority
- CN
- China
- Prior art keywords
- seq
- leu
- asn
- pro
- ser
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8201—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation
- C12N15/8202—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation by biological means, e.g. cell mediated or natural vector
- C12N15/8205—Agrobacterium mediated transformation
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8242—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
- C12N15/8243—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Biomedical Technology (AREA)
- Organic Chemistry (AREA)
- Biotechnology (AREA)
- Molecular Biology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Zoology (AREA)
- General Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- General Health & Medical Sciences (AREA)
- Microbiology (AREA)
- Plant Pathology (AREA)
- Physics & Mathematics (AREA)
- Cell Biology (AREA)
- Nutrition Science (AREA)
- Botany (AREA)
- Gastroenterology & Hepatology (AREA)
- Medicinal Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides a Lotus corniculatus LcMYB5 gene, wherein the nucleotide sequence of the Lotus corniculatus LcMYB5 gene is selected from SEQ ID No: 3-8; also provides application of the Lotus corniculatus LcMYB5 gene in improving tannin content of plant leaves. The invention identifies a novel key regulatory gene LcMYB5 for regulating tannin biosynthesis in crowtoe for the first time. The Lotus corniculatus LcMYB5 gene provides a new candidate gene for cultivating a pasture variety with leaves having high tannin content, and provides a new way for cultivating a new pasture variety with anti-tympanites quality; can be used for further genetic improvement to increase the content of monophylline in the crowtoe; the method can also be used for carrying out genetic improvement on pasture with low tannin content or without tannin accumulation on leaves to increase the tannin content so as to prevent or slow down the occurrence of the tympanites, thereby reducing the economic loss.
Description
Technical Field
The invention relates to a Lotus corniculatus LcMYB5 gene and application thereof, in particular to application of the Lotus corniculatus LcMYB5 gene in tannin content regulation and control, and belongs to the technical field of genetic engineering application.
Background
Tannins (Proanthocyanidins) are flavonoid secondary metabolites with important activities in plants. Not only plays an important role in the regulation of seed dormancy, longevity and germination, but also participates in the regulation of biotic and abiotic stress of plants. In the animal husbandry, tannin in the pasture can also inhibit the growth of rumen alkane-producing bacteria of ruminants, reduce the release of methane, inhibit the growth of gastrointestinal parasites, improve the reproductive capacity of animals, promote the development of fetuses, the yield and lactation of wool, and a proper amount of tannin can also effectively prevent the lethal tympanites frequently occurring in the ruminants such as cattle, sheep and the like. When the content of tannin in the alfalfa is higher than 2 percent of dry weight, the occurrence of tympanites of ruminants such as cattle, sheep and the like can be effectively prevented; besides, the health-care food also has the effects of resisting oxidation, inflammation and cancer and the like, and is beneficial to human health. Therefore, the research on the biosynthesis and regulation of tannin becomes an important research direction in the field of plant secondary metabolism.
Lotus corniculatus L is a herbaceous plant of the genus Lotus of the family Leguminosae, is a perennial high-quality pasture widely planted in the world, and is distributed in various parts of China. The lotus roots have the ability of growing under the severe conditions of low fertilizer, acidity, high salt and the like, have high nutritive value and good palatability, are safe for feeding livestock, and are excellent pasture for animal husbandry production. In recent years, there have been increasing researches on the evaluation of agronomic traits and resistance of Lotus corniculatus, tissue culture, gene cloning, genetic engineering improvement, and the like. However, the synthesis of leaf tannin in Lotus corniculatus has been studied less, and only in 1983, Ross et al performed a group analysis of leaf tannin in nearly 200 different Lotus corniculatus varieties, and found that leaf tannin content has polymorphism and is genetically controlled by monogenic dominance, but no intensive study on genes has been performed. Therefore, the molecular mechanism of biosynthesis of leaf tannin of Lotus corniculatus remains unclear, and breeding work for further increasing leaf tannin content through genetic improvement is hindered.
Disclosure of Invention
The invention aims to provide a new key regulation gene LcMYB5 and LcMYB5 genes for regulating tannin biosynthesis in crowtoe, and provides a new candidate gene for cultivating a pasture variety with leaves containing high content of tannin, and a new way for cultivating a new pasture variety with anti-tympanites quality.
According to one aspect of the application, a Lotus japonicus LcMYB5 gene is provided, and the nucleotide sequence of the Lotus japonicus LcMYB5 gene is selected from SEQ ID No: 3. SEQ ID No: 4. SEQ ID No: 5. SEQ ID No: 6. SEQ ID No: 7 and SEQ ID No: 8.
In some embodiments, the sequence of the transcript of the lotus japonicus LcMYB5 gene is selected from SEQ ID No: 9. SEQ ID No: 10. SEQ ID No: 11. SEQ ID No: 12. SEQ ID No: 13 and SEQ ID No: 14, or a pharmaceutically acceptable salt thereof.
Specifically, the amino acid sequence of the transcript is selected from SEQ ID No: 15. SEQ ID No: 16. SEQ ID No: 17. SEQ ID No: 18. SEQ ID No: 19 and SEQ ID No: 20, or a pharmaceutically acceptable salt thereof.
According to another aspect of the application, the application of the Lotus corniculatus LcMYB5 gene in improving the tannin content of plant leaves is further provided.
According to another aspect of the application, the application of the Lotus corniculatus LcMYB5 gene in genetic improvement and breeding of plants is further provided.
According to another aspect of the application, the application of the Lotus corniculatus LcMYB5 gene in regulation of tannin synthesis related genes is also provided.
In some embodiments, the tannin synthesis-associated gene is selected from at least one of the genes LjCHS-1, LjCHS-2, LjF3H-1, LjLAR, LjANR, LjTT15, LjTT9, LjTT8, LjTT8L1, LjTTG2, LjTTG1L1, and LjTTG1L 2.
In some embodiments, the Lotus corniculatus LcMYB5 gene can increase the expression level of a tannin synthesis related gene.
Specifically, the nucleotide sequence of the Lotus corniculatus LcMYB5 gene is selected from SEQ ID No: 3. SEQ ID No: 4. SEQ ID No: 5. SEQ ID No: 6. SEQ ID No: 7 and SEQ ID No: 8.
Specifically, the sequence of the transcript of the Lotus corniculatus LcMYB5 gene is selected from SEQ ID No: 9. SEQ ID No: 10. SEQ ID No: 11. SEQ ID No: 12. SEQ ID No: 13 and SEQ ID No: 14, or a pharmaceutically acceptable salt thereof.
The invention has the beneficial effects that:
1. the invention identifies a novel key regulatory gene LcMYB5 for regulating tannin biosynthesis in crowtoe for the first time. The Lotus corniculatus LcMYB5 gene provides a new candidate gene for cultivating a pasture variety with leaves having high tannin content, and provides a new way for cultivating a new pasture variety with anti-tympanites quality.
2. The lotus japonicus LcMYB5 gene disclosed by the invention is applied to the improvement of the tannin content of plant leaves, and the lotus japonicus LcMYB5 gene can activate the expression of a tannin synthesis related gene, so that the accumulation of tannin is increased, and the lotus japonicus LcMYB5 gene can be used for further genetic improvement to increase the tannin content of leaves in lotus japonicus; the method can also be used for carrying out genetic improvement on pasture with low tannin content or without tannin accumulation on leaves to increase the tannin content so as to prevent or slow down the occurrence of the tympanites, thereby reducing the economic loss.
3. The application system analyzes and controls a molecular mechanism of leaf tannin biosynthesis, and further has important theoretical and application values for improving the quality of pasture tannin by a genetic engineering method.
Drawings
FIG. 1 shows the tannin content in the leaves of different Lotus corniculatus;
FIG. 2 shows tannin content in different tissues of Lotus japonicus;
FIG. 3 shows the gene expression level of Lotus japonicus LjANR;
FIG. 4 shows the expression levels of various genes in Lotus japonicus;
FIG. 5 is a phylogenetic tree of Lotus corniculatus LcMYB5 gene;
FIG. 6 shows the result of subcellular localization analysis of LcMYB5 gene;
FIG. 7 shows the transcription activity results of the Lotus corniculatus LcMYB5a and LcMYB5b genes;
FIG. 8 is the content of soluble tannins, insoluble tannins and total flavonoids in LcMYB5a and LcMYB5b over-expressed material; a diagram shows that the soluble tannin content is determined by a DMACA method, B diagram shows that the soluble tannin content is determined by an n-butanol-hydrochloric acid method, C diagram shows that the insoluble tannin content is determined by the n-butanol-hydrochloric acid method, and D diagram shows that the total flavone content is determined;
FIG. 9 shows the flavonol content of LcMYB5a and LcMYB5b over-expressed material;
FIG. 10 shows the anthocyanin content of LcMYB5a and LcMYB5b over-expressed material;
FIG. 11 shows the expression levels of genes involved in tannin synthesis in LcMYB5a and LcMYB5b over-expressed material.
Detailed Description
The experimental procedures used in the following examples are all conventional procedures unless otherwise specified.
Materials, reagents and the like used in the following examples are commercially available unless otherwise specified.
Example 1
Through collecting 38 Lotus corniculatus (L.) germplasm resources, the tannin content in the leaves of the Lotus corniculatus is quantitatively determined. The tannin content was found to range from a minimum of 0mg to a maximum of 88.4mg per gram of dry weight of leaf as shown in figure 1. The diversity of the tannin content in the germplasm resource leaves lays a foundation for identifying key regulation genes for synthesizing tannin in the lotus japonicus leaves.
Meanwhile, since Lotus corniculatus is diploid, the genome is also revealed and has been widely used as a model plant for research. Japanese Lotus japonicus (Lotus japonicus L.) has a close relationship with Lotus japonicus (Lotus corniculatus L.). Therefore, this study also analyzed the tannin distribution pattern of jatrorrhiza japonica, and found that almost no accumulation of tannin was detected in the leaves, stems, and roots of jatrorrhiza japonica; a small amount of tannins was also found in the flowers, which were mainly concentrated in the seed coat of the seeds, as shown in figure 2. LjANR is the first key enzyme for tannin synthesis, the gene expression level of the LjANR is very similar to the distribution pattern of tannin, and as shown in FIG. 3, the correlation coefficient reaches 0.89.
Further adopts a reverse genetics method, which comprises the following steps: using the CDS sequences of key MYB transcription factors regulating tannin biosynthesis in Arabidopsis and Medicago truncatula model species (AtTT2, AtMYB5, MtPAR, MtMYB14 and MtMYB5), a total of four Probesets (TM1624.33_ at, TM1624.28_ at, TM1040.12_ at and TM1040.12_ at) were first obtained by Blast on the https:// ljgea. noble.org/v2/Blast _ search _ form. php website. They correspond to 4 genes respectively likely to regulate tannin synthesis (TM1040.12_ at is LjMYB5, TM1040.12_ at is LjTT2a, TM1624.28_ at is LjTT2b, TM1624.33_ at is LjTT2c), where LjTT2a, LjTT2b and LjTT2c have been reported by other studies: only LjTT2a regulates the synthesis of tannins in the seed coat. Correlation coefficients between the gene expression levels of LjTT2a, LjTT2b and LjTT2c and the distribution pattern of tannin were all analyzed to be lower than 0; and their gene expression levels were low in all tissues and lower than that of LjMYB5, as shown in fig. 4; the correlation coefficient between the gene expression level of LjMYB5 and tannin is also higher. Therefore, LjMYB5 may be a key regulatory gene in japaneseou, japan, that regulates tannin biosynthesis. The nucleotide sequence of the LjMYB5 gene is shown as SEQ ID No: 1, and the amino acid sequence is shown as SEQ ID No: 2, respectively.
Example 2
The LcMYB5 gene was cloned from leaves of the plant material (B91) with the highest tannin content. 6 genome sequences of the LcMYB5 gene are cloned and are LcMYB5A, LcMYB5B, LcMYB5C, LcMYB5D, LcMYB5E and LcMYB5F respectively (intron sequences are drawn on horizontal lines, and coding region sequences are drawn on the other parts).
LcMYB5A：
ATGAGGAACCCGATAGCATCATCATCAACGAACAAGAAGAAGAGCAGTACTACAACTGGTAATGAAAATGGCACGACTGTTACTACTACTCCGTGCTGCAGCAAAGTTGGGTTGAAGAGAGGGCCATGGACACCGGAGGAAGACGAGGTGTTGGCCAGTTTCATAAGGAAAGAAGGCGAAGGTCGCTGGAGAACGCTTCCAAAAAGAGCCGGCCTCCTCCGCTGCGGTAAGAGCTGCCGCCTCCGCTGGATGAACTACCTCCGCCCCTCCGTCAAACGCGGCCAGATCGCCCCCGACGAGGAAGATCTCATCCTCCGCCTTCACCGCCTCCTCGGCAACCGGTACCTCTTCTCCTCGATCGATCTTCCTTTT ATCTAGCTTAGGGTTTGCTACGAACTTTGCTTAACTAATTAATTAATTTTAAATAAACATATATATATAGCTAGGG CTTGATTTAATTACACTTTATTTAATTACCATTTCATCAATCATGTTTAGGATATAGTACAACAATTCATTTTGAA ACTAACATTAATTCTAGCAAGAAGCTTTCTTAAATAGCTTCTGGGTGTTAAAATTGATTCTGATGTTACATTTACA GGTGGTCTTTGATAGCGGGAAGAATTCCGGGAAGAACTGATAATGAGATAAAGAACTTCTGGAACACCCATCTCAGCAAGAAGCTTATCAGCCAAGGGATTGATCCAAGAACCCACAAGCCTCTCAACCCAGAACTATCTATTCCCTCTTCTTCCACTACTCCACCACCACCACCACCTTCCAAGCCTCTTCCTGTGATCACAAATCACCAAACACTTCATGAAACTACTACTCATCATCATCTCAATATTGCTAGTGTCAACCAAGAATGTGATGAGGGTCAATATCAATATCAACAACCTCAAGCAGTAGCTGCTGCTGCATATATGGTAGCTAATGATATTCCTGATGATGTTCCTTCCATGGATCATCTACTTGCCAACAACAACAACAACCAGGACTACAATGATATCAATTATTGTTCTGATGATATCTTTTCTTCCTTCCTCAATTCTCTGATCAATGAGGATGCGTTCTCTGCCCAGCGCCACCTGCAATCGGAGCATCATGATGACCTTGCACAGGATCCTGTTACTTCATCAACACCACAAGGTTATAATGGCATTGGTGTTGCATGGGAATTGCCCCTCATGCCTGCTAATTTCAGCCAAAATGAACACAGCCATGAGGTTGATGATCATCACAAATAG(SEQ ID No：3)。
LcMYB5B：
ATGAGGAACCCGATAGCATCATCATCAACGAACAAGAAGAAGAACAGTACAACTACTGGCAATGAAAATGGCACGACTGCTACTACTACTCCGTGCTGCAGCAAAGTTGGGTTGAAGAGAGGGCCATGGACACCGGAGGAAGACGAGGTGTTGGCCAGTTTCATAAGGAAAGAAGGCGAAGGTCGCTGGAGAACGCTTCCAAAAAGAGCCGGCCTCCTCCGCTGCGGTAAGAGCTGCCGCCTCCGCTGGATGAACTACCTCCGCCCCTCCGTCAAACGCGGCCAGATCGCCCCCGACGAGGAAGATCTCATCCTCCGCCTTCACCGCCTCCTCGGCAACCGGTACCTCCTCTCCTCGATCGATCTCCCTTTT ATCTAGCTTAGGGTTTGCTACGAACTTTGCTTAACTAATTAATTAATTTTAAATAAACATATATATATATATAGCT AGGGCTTGATTTAATTACCATTTCATCAATCATGTTTAGGATATAGTACAACAATTCATTTTGAAACTAACATTAA TTCTAGCAAGAAGCTTTCTTAAATAGCTTCTGGGTGTTAAAATTGATTCTGATGATTCTGATGTTACAGGTGGTCTTTGATAGCGGGAAGAATTCCGGGAAGAACTGATAATGAGATAAAGAACTTCTGGAACACCCATCTCAGCAAGAAGCTTATCAGCCAAGGGATTGATCCAAGAACCCACAAGCCTCTCAACCCAGAACTATCTATTCCCTCTTCTTCCACTACTCCACCACCACCACCTTCCAAGCCTCTTCCTGTGATCACAAATCACCAAACACTTCATGAAACTACTACTCATCATCATCTCAATATTGCTAGTGTCAACCAAGAATGTGATGAGGGTCAATATCAATATCAACAACCTCAAGCAGTAGCTGCTGCTGCATATATGGTAGCTAATGATATTCCTGATGATGATATTCCTTCCATGGATCATCTACTTGCCAACAACAACAACAACAACCAGGACTACAATGATATCAATTATTGTTCTGATGATATCTTTTCTTCCTTCCTCAATTCTCTGATCAATGAGGATGCGTTCTCTGCCCAGCGCCACCTGCAATCGGAGCATCATGATGACCTTGCACAGGATCCTGTTACTTCATCAACACCACAAGGTTATAATGGCATTGGTGTTGCATGGGAATTGCCCCTCATGCCTGCTAATTTCAGCCAAAATGAACACAGCCATGAGGTTGATGATCATCACAAATAG(SEQ ID No：4)。
LcMYB5C：
ATGAGGAACCCGATAGCATCATCATCAACGAACAAGAAGAAGAACAGTACAACTACTGGCAATGAAAATGACACGACTGCTACTACTACTCCGTGCTGCAGCAAAGTTGGGTTGAAGAGAGGGCCATGGACACCGGAGGAAGACGAGGTGTTGGCCAGTTTCATAAGGAAAGAAGGCGAAGGTCGCTGGAGAACGCTTCCAAAAAGAGCCGGCCTCCTCCGCTGCGGTAAGAGCTGCCGCCTCCGCTGGATGAACTACCTCCGCCCCTCCGTCAAACGCGGCCAGATCGCCCCCGACGAGGAAGATCTCATCCTCCGCCTTCACCGCCTCCTCGGCAACCGGTACCTCTTCTCCTCGATCGATCTTCCTTTT ATCTAGCTTAGGGTTTGCTACGAACTTTGCTTAACTAATTAAATAATTTTAAATAAACATATATATATATAGCTAG GGCTTGATTTAATTACACTTTATTTAATTACCATTTCATCAATCATGTTTAGGATATAGTACAACAATTCATTTTG AAACTAACATTAATTCTAGCAAGAAGCTTTCTTAAATAGCTTCTGGGTGTTAAAATTGATTCTGATGTTACATTTA CAGGTGGTCTTTGATAGCGGGAAGAATTCCGGGAAGAACTGATAATGAGATAAAGAACTTCTGGAACACCCATCTCAGCAAGAAGCTTATCAGCCAAGGGATTGATCCAAGAACCCACAAGCCTCTCAACCCAGAACTATCTATTCCCTCTTCTTCCACTACTCCACCACCACCACCACCTTCCAAGCCTCTTCCTGTGATCACAAATCACCAAACACTTCATGAAACTACTACTCATCATCATCTCAATATTGCTAGTGTCAACCAAGAATGTGATGAGGGTCAATATCAATATCAACAACCTCAAGCAGTAGCTGCTGCTGCATATATGGTAGCTAATGATATTCCTGATGATGTTCCTTCCATGGATCATCTACTTGCCAACAACAACAACAACCAGGACTACAATGATATCAATTATTGTTCTGATGATATCTTTTCTTCCTTCCTCAATTCTCTGATCAATGAGGATGCGTTCTCTGCCCAGCGCCACCTGCAATCGGAGCATCATGATGACCTTGCACAGGATCCTGTTACTTCATCAACACCACAAGGTTATAATGGCATTGGTGTTGCATGGGAATTGCCCCTCATGCCTGCTAATTTCAGCCAAAATGAACACAGCCATGAGGTTGATGATCATCACAAATAG(SEQ ID No：5)。
LcMYB5D：
ATGAGGAACCCGATAGCATCATCATCAACGAACAAGAAGAAGAACAGTACAACTACTGGCAATGAAAATGACACGACTGCTACTACTACTCCGTGCTGCAGCAAAGTTGGGTTGAAGAGAGGGCCATGGACACCGGAGGAAGACGAGGTGTTGGCCAGTTTCATAAGGAAAGAAGGCGAAGGTCGCTGGAGAACGCTTCCAAAAAGAGCCGGCCTCCTCCGCTGCGGTAAGAGCTGCCGCCTCCGCTGGATGAACTACCTCCGCCCCTCCGTCAAACGCGGCCAGATCGCCCCCGACGAGGAAGATCTCATCCTCCGACTTCACCGCCTCCTCGGCAACCGGTACCTCTTCTCCTCGATCGATCTTCCTTTT ATCTAGCTTAGGGTTTGCTACGAACTTTGCTTAACTAATTAAATAATTTTAAATAAACATATATATATATAGCTAG GGCTTGATTTAATTACACTTTATTTAATTACCATTTCATCAATCATGTTTAGGATATAGTACAACAATTCATTTTG AAACTAACATTAATTCTAGCAAGAAGCTTTCTTAAATAGCTTCTGGGTGTTAAAATTGATTCTGATGTTACATTTA CAGGTGGTCTTTGATAGCGGGAAGAATTCCGGGAAGAACTGATAATGAGATAAAGAACTTCTGGAACACCCATCTCAGCAAGAAGCTTATCAGCCAAGGGATTGATCCAAGAACCCACAAGCCTCTCAACCCAGAACTATCTATTCCCTCTTCTTCCACTACTCCACCACCACCACCACCTTCCAAGCCTCTTCCTGTGATCACAAATCACCAAACACTTCATGAAACTACTACTCATCATCATCTCAATATTGCTAGTGTCAACCAAGAATGTGATGAGGGTCAATATCAATATCAACAACCTCAAGCAGTAGCTGCTGCTGCATATATGGTAGCTAATGATATTCCTGATGATGTTCCTTCCATGGATCATCTACTTGCCAACAACAACAACAACCAGGACTACAATGATATCAATTATTGTTCTGATGATATCTTTTCTTCCTTCCTCAATTCTCTGATCAATGAGGATGCGTTCTCTGCCCAGCGCCACCTGCAATCGGAGCATCATGATGACCTTGCACAGGATCCTGTTACTTCATCAACACCACAAGGTTATAATGGCATTGGTGTTGCATGGGAATTGCCCCTCATGCCTGCTAATTTCAGCCAAAATGAACACAGCCATGAGGTTGATGATCATCACAAATAG(SEQ ID No：6)。
LcMYB5E：
ATGAGGAACCCGATAGCATCATCATCAACGAACAAGAAGAAGAACAGTACAACTACTGGCAATGAAAATGGCACGACTGCTACTACTACTCCGTGCTGCAGCAAAGTTGGGTTGAAGAGAGGGCCATGGACACCGGAGGAAGACGAGGTGTTGGCCAGTTTCATAAGGAAAGAAGGCGAAGGTCGCTGGAGAACGCTTCCAAAAAGAGCCGGCCTCCTCCGCTGCGGTAAGAGCTGCCGCCTCCGCTGGATGAACTACCTCCGCCCCTCCGTCAAACGCGGCCAGATCGCCCCCGACGAGGAAGATCTCATCCTCCGCCTTCACCGCCTCCTCGGCAACCGGTACCTCCTCTCCTCGATCGATCTTCCTTTT ATCTAGCTTAGGGTTTTCTACGAACTTTGCTTAACTAATTAATTAATTTTAAATAAACATATATATATAGCTAGGG CTTGATTTAATTACACTTTATTTAATTACACTTTCATCAATCATGTTTAGGATACAGTACAACAATTCATTTTGAA ACTAACATTAATTCTAGCAAGAAGCTTTCTTAAATAGCTTCTGGGTGTTAAAATTGATTTTGATGTTACAGGTGGTCTTTGATAGCGGGAAGAATTCCGGGAAGAACTGATAATGAGATAAAGAACTTCTGGAACACCCATCTCAGCAAGAAGCTTATCAGCCAAGGGATTGATCCAAGAACCCACAAGCCTCTCAACCCAGAACTATCTATTCCCTCTTCTTCCACTACTCCACCACCACCACCACCTTCCAAGCCTCTTCCTGTGATCACAAATCACCAAACACTTCATGAAACTACTACTCATCATCATCTCAATATTGCTAGTGTCAACCAAGAATGTGATGAGGGTCAATATCAATATCAACAACCTCAAGCAGTAGCTGCTGCTGCATATATGGTAGCTAATGATATTCCTGATGATGATATTCCTTCCATGGATCATCTACTTGCCAACAACAACAACAACAACCAGGACTACAATGATATCAATTATTGTTCTGATGATATCTTTTCTTCCTTCCTCAATTCTCTGATCAATGAGGATGCGTTCTCTGCCCAGCGCCACCTGCAATCGGAGCATCATGATGACCTTGCACAGGATCCTGTTACTTCATCAACACCACAAGGTTATAATGGCATTGGTGTTGCATGGGAATTGCCCCTCATGCCTGCTAATTTCAGCCAAAATGAACACAGCCATGAGGTTGATGATCATCACAAATAG(SEQ IDNo：7)。
LcMYB5F：
ATGAGGAACCCGATAGCATCATCATCAACGAACAAGAAGAAGAACAGTACAACTACTGGCAATGAAAATGGCACGACTGCTACTACTACTCCGTGCTGCAGCAAAGTTGGGTTGAAGAGAGGGCCATGGACACCGGAGGAAGACGAGGTGTTGGCCAGTTTCATAAGGAAAGAAGGCGAAGGTCGCTGGAGAACGCTTCCAAAAAGAGCCGGCCTCCTCCGCTGCGGTAAGAGCTGCCGCCTCCGCTGGATGAACTACCTCCGCCCCTCCGTCAAACGCGGCCAGATCGCCCCCGACGAGGAAGATCTCATCCTCCGACTTCACCGCCTCCTCGGCAACCGGTACCTCTTCTCCTCGATCGATCTTCCTTTT ATCTAGCTTAGGGTTTGCTACGAACTTTGCTTAACTAATTAATTAATTTTAAATAAACATATATATATAGCTAGGG CTTGATTTAATTACACTTTATTTAATTACCATTTCATCAATCATGTTTAGGATATAGTACAACAATTCATTTTGAA ACTAACATTAATTCTAGCAAGAAGCTTTCTTAAATAGCTTCTGGGTGTTAAAATTGATTCTGATGTTACATTTACA GGTGGTCTTTGATAGCGGGAAGAATTCCGGGAAGAACTGATAATGAGATAAAGAACTTCTGGAACACCCATCTCAGCAAGAAGCTTATCAGCCAAGGGATTGATCCAAGAACCCACAAGCCTCTCAACCCAGAACTATCTATTCCCTCTTCTTCCACTACTCCACCACCACCACCACCTTCCAAGCCTGTTCCTGTGATCACAAATCACCAAACACTTCATGAAACTACTACTCATCATCATCTCAATATTGCTAGTGTCAACCAAGAATGTGATGAGGGTCAATATCAATATCAACAACCTCAAGCAGTAGCTGCTGCTGCATATATGGTAGCTAATGATATTCCTGATGATGTTCCTTCCATGGATCATCTACTTGCCAACAACAACAACAACCAGGACTACAATGATATCAATTATTGTTCTGATGATATCTTTTCTTCCTTCCTCAATTCTCTGATCAATGAGGATGCGTTCTCTGCCCATCGCCACCTGCAATCGGAGCATCATGATGACCTTGCACAGGATCCTGTTACTTCATCAACACCACAAGGTTATAATGGCATTGGTGTTGCATGGGAATTGCCCCTCATGCCTGCTAATTTCAGCCAAAATGAACACAGCCATGAGGTTGATGATCATCACAAATAG(SEQ ID No：8)。
Further, the transcripts of LcMYB5A-LcMYB5F were found to be named LcMYB5a, LcMYB5b, LcMYB5c, LcMYB5d, LcMYB5e and LcMYB5f, respectively. The protein sequences encoded by these 6 transcripts were also highly similar and highly homologous to the protein sequence of LjMYB5, differing in total by only 10 amino acids. Of these, LcMYB5a is most similar to LjMYB5, differing only by 2 bits; whereas LcMYB5b is least similar to LjMYB5, with 6 bit points being different. The most similar and least similar representatives were selected, and thus LcMYB5a and LcMYB5b were selected as study subjects. The protein sequences encoded by the proteins are highly similar, so that LcMYB5a and LcMYB5b are selected for further research.
Wherein, the nucleotide sequence of LcMYB5a is shown in SEQ ID No: 9, and the amino acid sequence is shown as SEQ ID No: 15 is shown in the figure; the nucleotide sequence of LcMYB5b is shown in SEQ ID No: 10, and the amino acid sequence is shown as SEQ ID No: 16 is shown in the figure; the nucleotide sequence of LcMYB5c is shown in SEQ ID No: 11, and the amino acid sequence is shown as SEQ ID No: 17 is shown; the nucleotide sequence of LcMYB5d is shown in SEQ ID No: 12, the amino acid sequence is shown as SEQ ID No: 18 is shown in the figure; the nucleotide sequence of LcMYB5e is shown in SEQ ID No: 13, and the amino acid sequence is shown as SEQ ID No: 19 is shown in the figure; the nucleotide sequence of LcMYB5f is shown in SEQ ID No: 14, the amino acid sequence is shown as SEQ ID No: shown at 20.
The LcMYB5a and LcMYB5b genes are further subjected to stop codon removal, and the genes are respectively cloned between enzyme cutting sites Nco1 and Spe1 of pCAMBIA 1302 vector by a seamless cloning method. The obtained positive clone is transferred into the agrobacterium GV3101 strain after being verified by gene sequencing. Tobacco leaves growing for 4 weeks were injected with the bacterial liquid of GV3101 of LcMYB5a or GV3101 of LcMYB5b, and after 36-48 hours of greenhouse culture, the distribution position of GFP fluorescence was observed with a laser confocal microscope, as shown in fig. 6, confirming that the proteins of LcMYB5a and LcMYB5b are located in the nucleus.
The specific steps of the transcriptional activity assay include: constructing the corresponding effector vector. Obtaining positive clones, and extracting endotoxin-free plasmids after gene sequencing verification; protoplasts were isolated from Arabidopsis leaves grown for 4 weeks, and reporters plasmids were transferred to protoplasts with plasmids GAL4DB, GAL4DB-LcMYB5a, and GAL4DB-LcMYB5b, respectively, by PEG-mediated method, and cultured overnight in 25 ℃ incubator in the absence of light. The enzyme activity of each sample was quantitatively analyzed by using the dual-luciferase reporter system of promega company, as shown in fig. 7, and the results of fig. 7 indicate that LcMYB5a and LcMYB5b both have a transcription activation effect, and through activating the expression of related genes in the tannin synthesis pathway, the biosynthesis of tannin is positively regulated.
In order to further analyze the biological functions of LcMYB5a and LcMYB5b, the LcMYB5a and LcMYB5b genes are respectively cloned into an entry vector pENTR, and the obtained positive clones are subjected to LR reaction after being verified by gene sequencing and then enter a pB2GW7 vector. Subsequently transferred into Agrobacterium ARqual1 strain. The Lotus corniculatus seedlings were infected with the bacterial liquid of ARqual1 of LcMYB5a or the bacterial liquid of ARqual1 of LcMYB5b, respectively, to obtain their overexpression transgenic materials. The tannin content was quantitatively analyzed, and it was found that the contents of both soluble tannin and insoluble tannin in the over-expressed material were greatly increased, 2 times higher than the control, as shown in fig. 8. While other flavonoids, such as flavonols and anthocyanidins, did not change significantly, as shown in figures 9 and 10. These results indicate that LcMYB5a and LcMYB5b specifically are regulating tannin biosynthesis.
Total RNA was extracted using a Promega RNA extraction kit, and then cDNA was synthesized using a One-Step gDNA removal and cDNA Synthesis kit from Takara Shuzo. Gene expression level analysis was performed on an ABI 7500real-time Detection System (Applied Biosystems, USA) instrument using 2 × RealStar Green Fast mix (GeneStar, Shanghai, China) reagent. By transcriptome sequencing analysis and real-time quantitative PCR analysis, the specific PCR program was as follows: pre-denaturation 95 ℃ for 2min, 40 cycles (denaturation 95 ℃ for 15s, annealing 60 ℃ for 30s, extension 72 ℃ for 30 s). The results are shown in fig. 11, which reveals that LcMYB5a and LcMYB5b are regulating the molecular mechanism of tannins. In the LcMYB5a and LcMYB5b over-expressed plant materials, the expression levels of 12 genes (LjCHS-1, LjCHS-2, LjF3H-1, LjLAR, LjANR, LjTT15, LjTT9, LjTT8, LjTT8L1, LjTTG2, LjTTG1L1 and LjTTG1L2) closely related to tannin synthesis were 3.2 times higher than the control; these results indicate that LcMYB5 activates the expression of these 12 genes by transcription, thereby greatly increasing tannin biosynthesis.
The Lotus corniculatus LcMYB5 gene and the application thereof provided by the invention are described in detail above. The principles and embodiments of the present invention are explained herein using specific examples, which are presented only to assist in understanding the method and its core concepts. It should be noted that, for those skilled in the art, it is possible to make various improvements and modifications to the present invention without departing from the principle of the present invention, and those improvements and modifications also fall within the scope of the claims of the present invention.
Sequence listing
<110> Beijing animal husbandry and veterinary institute of Chinese academy of agricultural sciences
<120> Lotus corniculatus LcMYB5 gene and application thereof
<130> CNP210012
<160> 20
<170> SIPOSequenceListing 1.0
<210> 1
<211> 993
<212> DNA
<213> Lotus corniculatus
<400> 1
atgaggaacc cgatagcatc atcatcaacg aacaagaaga agagcagtac tacaactggt 60
aatgaaaatg gcacgactgt tactactact ccgtgctgca gcaaagttgg gttgaagaga 120
gggccatgga caccggagga agacgaggtg ttggccagtt tcataaggaa agaaggcgaa 180
ggtcgctgga gaacgcttcc aaaaagagcc ggcctcctcc gctgcggtaa gagctgccgc 240
ctccgctgga tgaactacct ccgcccctct gtcaaacgcg gccagatcgc ccccgacgaa 300
gaagatctca tcctccgcct tcaccgcctc ctcggcaacc ggtggtcttt gatagcggga 360
agaattccgg gaagaactga taatgagata aagaacttct ggaacaccca tctcagcaag 420
aagcttatca gccaagggat tgatccaaga acccacaagc ctctcaaccc agaactatct 480
attccctctt cttccactac tccaccacca ccaccacctt ccaagcctct tcctgtgatc 540
acaaatcacc aaacacttca tgaaactact actcatcatc atctcaatat tgctagtgtc 600
aaccaagaat gtgatgaggg tcaatatcaa tatcaacaac ctcaagcagt agctgctgct 660
gcatatatgg tagctaatga tattcctgat gatgatgttc cttccatggg tcatctactt 720
gccaacaaca acaacaacca ggactacaat gatatcaatt attgttctga tgatatcttt 780
tcttccttcc tcaattctct gatcaatgag gatgctttct ctgcccagcg ccacctgcaa 840
tcggagcatc atgatgacct tgcacaggat cctgtaactt catcaacacc acaaggttat 900
aatggcattg gtgttgcatg ggaattgccc ctcatgcctg ctaatttcag ccaaaatgaa 960
cacagccatg aggttgatga tcatcacaaa tag 993
<210> 2
<211> 330
<212> PRT
<213> Lotus corniculatus
<400> 2
Met Arg Asn Pro Ile Ala Ser Ser Ser Thr Asn Lys Lys Lys Ser Ser
1 5 10 15
Thr Thr Thr Gly Asn Glu Asn Gly Thr Thr Val Thr Thr Thr Pro Cys
20 25 30
Cys Ser Lys Val Gly Leu Lys Arg Gly Pro Trp Thr Pro Glu Glu Asp
35 40 45
Glu Val Leu Ala Ser Phe Ile Arg Lys Glu Gly Glu Gly Arg Trp Arg
50 55 60
Thr Leu Pro Lys Arg Ala Gly Leu Leu Arg Cys Gly Lys Ser Cys Arg
65 70 75 80
Leu Arg Trp Met Asn Tyr Leu Arg Pro Ser Val Lys Arg Gly Gln Ile
85 90 95
Ala Pro Asp Glu Glu Asp Leu Ile Leu Arg Leu His Arg Leu Leu Gly
100 105 110
Asn Arg Trp Ser Leu Ile Ala Gly Arg Ile Pro Gly Arg Thr Asp Asn
115 120 125
Glu Ile Lys Asn Phe Trp Asn Thr His Leu Ser Lys Lys Leu Ile Ser
130 135 140
Gln Gly Ile Asp Pro Arg Thr His Lys Pro Leu Asn Pro Glu Leu Ser
145 150 155 160
Ile Pro Ser Ser Ser Thr Thr Pro Pro Pro Pro Pro Pro Ser Lys Pro
165 170 175
Leu Pro Val Ile Thr Asn His Gln Thr Leu His Glu Thr Thr Thr His
180 185 190
His His Leu Asn Ile Ala Ser Val Asn Gln Glu Cys Asp Glu Gly Gln
195 200 205
Tyr Gln Tyr Gln Gln Pro Gln Ala Val Ala Ala Ala Ala Tyr Met Val
210 215 220
Ala Asn Asp Ile Pro Asp Asp Asp Val Pro Ser Met Gly His Leu Leu
225 230 235 240
Ala Asn Asn Asn Asn Asn Gln Asp Tyr Asn Asp Ile Asn Tyr Cys Ser
245 250 255
Asp Asp Ile Phe Ser Ser Phe Leu Asn Ser Leu Ile Asn Glu Asp Ala
260 265 270
Phe Ser Ala Gln Arg His Leu Gln Ser Glu His His Asp Asp Leu Ala
275 280 285
Gln Asp Pro Val Thr Ser Ser Thr Pro Gln Gly Tyr Asn Gly Ile Gly
290 295 300
Val Ala Trp Glu Leu Pro Leu Met Pro Ala Asn Phe Ser Gln Asn Glu
305 310 315 320
His Ser His Glu Val Asp Asp His His Lys
325 330
<210> 3
<211> 1250
<212> DNA
<213> Lotus corniculatus
<400> 3
atgaggaacc cgatagcatc atcatcaacg aacaagaaga agagcagtac tacaactggt 60
aatgaaaatg gcacgactgt tactactact ccgtgctgca gcaaagttgg gttgaagaga 120
gggccatgga caccggagga agacgaggtg ttggccagtt tcataaggaa agaaggcgaa 180
ggtcgctgga gaacgcttcc aaaaagagcc ggcctcctcc gctgcggtaa gagctgccgc 240
ctccgctgga tgaactacct ccgcccctcc gtcaaacgcg gccagatcgc ccccgacgag 300
gaagatctca tcctccgcct tcaccgcctc ctcggcaacc ggtacctctt ctcctcgatc 360
gatcttcctt ttatctagct tagggtttgc tacgaacttt gcttaactaa ttaattaatt 420
ttaaataaac atatatatat agctagggct tgatttaatt acactttatt taattaccat 480
ttcatcaatc atgtttagga tatagtacaa caattcattt tgaaactaac attaattcta 540
gcaagaagct ttcttaaata gcttctgggt gttaaaattg attctgatgt tacatttaca 600
ggtggtcttt gatagcggga agaattccgg gaagaactga taatgagata aagaacttct 660
ggaacaccca tctcagcaag aagcttatca gccaagggat tgatccaaga acccacaagc 720
ctctcaaccc agaactatct attccctctt cttccactac tccaccacca ccaccacctt 780
ccaagcctct tcctgtgatc acaaatcacc aaacacttca tgaaactact actcatcatc 840
atctcaatat tgctagtgtc aaccaagaat gtgatgaggg tcaatatcaa tatcaacaac 900
ctcaagcagt agctgctgct gcatatatgg tagctaatga tattcctgat gatgttcctt 960
ccatggatca tctacttgcc aacaacaaca acaaccagga ctacaatgat atcaattatt 1020
gttctgatga tatcttttct tccttcctca attctctgat caatgaggat gcgttctctg 1080
cccagcgcca cctgcaatcg gagcatcatg atgaccttgc acaggatcct gttacttcat 1140
caacaccaca aggttataat ggcattggtg ttgcatggga attgcccctc atgcctgcta 1200
atttcagcca aaatgaacac agccatgagg ttgatgatca tcacaaatag 1250
<210> 4
<211> 1245
<212> DNA
<213> Lotus corniculatus
<400> 4
atgaggaacc cgatagcatc atcatcaacg aacaagaaga agaacagtac aactactggc 60
aatgaaaatg gcacgactgc tactactact ccgtgctgca gcaaagttgg gttgaagaga 120
gggccatgga caccggagga agacgaggtg ttggccagtt tcataaggaa agaaggcgaa 180
ggtcgctgga gaacgcttcc aaaaagagcc ggcctcctcc gctgcggtaa gagctgccgc 240
ctccgctgga tgaactacct ccgcccctcc gtcaaacgcg gccagatcgc ccccgacgag 300
gaagatctca tcctccgcct tcaccgcctc ctcggcaacc ggtacctcct ctcctcgatc 360
gatctccctt ttatctagct tagggtttgc tacgaacttt gcttaactaa ttaattaatt 420
ttaaataaac atatatatat atatagctag ggcttgattt aattaccatt tcatcaatca 480
tgtttaggat atagtacaac aattcatttt gaaactaaca ttaattctag caagaagctt 540
tcttaaatag cttctgggtg ttaaaattga ttctgatgat tctgatgtta caggtggtct 600
ttgatagcgg gaagaattcc gggaagaact gataatgaga taaagaactt ctggaacacc 660
catctcagca agaagcttat cagccaaggg attgatccaa gaacccacaa gcctctcaac 720
ccagaactat ctattccctc ttcttccact actccaccac caccaccttc caagcctctt 780
cctgtgatca caaatcacca aacacttcat gaaactacta ctcatcatca tctcaatatt 840
gctagtgtca accaagaatg tgatgagggt caatatcaat atcaacaacc tcaagcagta 900
gctgctgctg catatatggt agctaatgat attcctgatg atgatattcc ttccatggat 960
catctacttg ccaacaacaa caacaacaac caggactaca atgatatcaa ttattgttct 1020
gatgatatct tttcttcctt cctcaattct ctgatcaatg aggatgcgtt ctctgcccag 1080
cgccacctgc aatcggagca tcatgatgac cttgcacagg atcctgttac ttcatcaaca 1140
ccacaaggtt ataatggcat tggtgttgca tgggaattgc ccctcatgcc tgctaatttc 1200
agccaaaatg aacacagcca tgaggttgat gatcatcaca aatag 1245
<210> 5
<211> 1252
<212> DNA
<213> Lotus corniculatus
<400> 5
atgaggaacc cgatagcatc atcatcaacg aacaagaaga agaacagtac aactactggc 60
aatgaaaatg acacgactgc tactactact ccgtgctgca gcaaagttgg gttgaagaga 120
gggccatgga caccggagga agacgaggtg ttggccagtt tcataaggaa agaaggcgaa 180
ggtcgctgga gaacgcttcc aaaaagagcc ggcctcctcc gctgcggtaa gagctgccgc 240
ctccgctgga tgaactacct ccgcccctcc gtcaaacgcg gccagatcgc ccccgacgag 300
gaagatctca tcctccgcct tcaccgcctc ctcggcaacc ggtacctctt ctcctcgatc 360
gatcttcctt ttatctagct tagggtttgc tacgaacttt gcttaactaa ttaaataatt 420
ttaaataaac atatatatat atagctaggg cttgatttaa ttacacttta tttaattacc 480
atttcatcaa tcatgtttag gatatagtac aacaattcat tttgaaacta acattaattc 540
tagcaagaag ctttcttaaa tagcttctgg gtgttaaaat tgattctgat gttacattta 600
caggtggtct ttgatagcgg gaagaattcc gggaagaact gataatgaga taaagaactt 660
ctggaacacc catctcagca agaagcttat cagccaaggg attgatccaa gaacccacaa 720
gcctctcaac ccagaactat ctattccctc ttcttccact actccaccac caccaccacc 780
ttccaagcct cttcctgtga tcacaaatca ccaaacactt catgaaacta ctactcatca 840
tcatctcaat attgctagtg tcaaccaaga atgtgatgag ggtcaatatc acctcaagca 900
gtagctgctg ctgcatatat ggtagctaat gatattcctg atgatgttcc ttccatggat 960
catctacttg ccaacaacaa caacaaccag gactacaatg atatcaatta ttgttctgat 1020
gatatctttt cttccttcct caattctctg atcaatgagg atgcgttctc tgcccagcgc 1080
cacctgcaat cggagcatca tgatgacctt gcacaggatc ctgaatatca acattacttc 1140
atcaacacca caaggttata atggcattgg tgttgcatgg gaattgcccc tcatgcctgc 1200
taatttcagc caaaatgaac acagccatga ggttgatgat catcacaaat ag 1252
<210> 6
<211> 1252
<212> DNA
<213> Lotus corniculatus
<400> 6
atgaggaacc cgatagcatc atcatcaacg aacaagaaga agaacagtac aactactggc 60
aatgaaaatg acacgactgc tactactact ccgtgctgca gcaaagttgg gttgaagaga 120
gggccatgga caccggagga agacgaggtg ttggccagtt tcataaggaa agaaggcgaa 180
ggtcgctgga gaacgcttcc aaaaagagcc ggcctcctcc gctgcggtaa gagctgccgc 240
ctccgctgga tgaactacct ccgcccctcc gtcaaacgcg gccagatcgc ccccgacgag 300
gaagatctca tcctccgact tcaccgcctc ctcggcaacc ggtacctctt ctcctcgatc 360
gatcttcctt ttatctagct tagggtttgc tacgaacttt gcttaactaa ttaaataatt 420
ttaaataaac atatatatat atagctaggg cttgatttaa ttacacttta tttaattacc 480
atttcatcaa tcatgtttag gatatagtac aacaattcat tttgaaacta acattaattc 540
tagcaagaag ctttcttaaa tagcttctgg gtgttaaaat tgattctgat gttacattta 600
caggtggtct ttgatagcgg gaagaattcc gggaagaact gataatgaga taaagaactt 660
ctggaacacc catctcagca agaagcttat cagccaaggg attgatccaa gaacccacaa 720
gcctctcaac ccagaactat ctattccctc ttcttccact actccaccac caccaccacc 780
ttccaagcct cttcctgtga tcacaaatca ccaaacactt catgaaacta ctactcatca 840
tcatctcaat attgctagtg tcaaccaaga atgtgatgag ggtcaatatc aatatcaaca 900
acctcaagca gtagctgctg ctgcatatat ggtagctaat gatattcctg atgatgttcc 960
ttccatggat catctacttg ccaacaacaa caacaaccag gactacaatg atatcaatta 1020
ttgttctgat gatatctttt cttccttcct caattctctg atcaatgagg atgcgttctc 1080
tgcccagcgc cacctgcaat cggagcatca tgatgacctt gcacaggatc ctgttacttc 1140
atcaacacca caaggttata atggcattgg tgttgcatgg gaattgcccc tcatgcctgc 1200
taatttcagc caaaatgaac acagccatga ggttgatgat catcacaaat ag 1252
<210> 7
<211> 1250
<212> DNA
<213> Lotus corniculatus
<400> 7
atgaggaacc cgatagcatc atcatcaacg aacaagaaga agaacagtac aactactggc 60
aatgaaaatg gcacgactgc tactactact ccgtgctgca gcaaagttgg gttgaagaga 120
gggccatgga caccggagga agacgaggtg ttggccagtt tcataaggaa agaaggcgaa 180
ggtcgctgga gaacgcttcc aaaaagagcc ggcctcctcc gctgcggtaa gagctgccgc 240
ctccgctgga tgaactacct ccgcccctcc gtcaaacgcg gccagatcgc ccccgacgag 300
gaagatctca tcctccgcct tcaccgcctc ctcggcaacc ggtacctcct ctcctcgatc 360
gatcttcctt ttatctagct tagggttttc tacgaacttt gcttaactaa ttaattaatt 420
ttaaataaac atatatatat agctagggct tgatttaatt acactttatt taattacact 480
ttcatcaatc atgtttagga tacagtacaa caattcattt tgaaactaac attaattcta 540
gcaagaagct ttcttaaata gcttctgggt gttaaaattg attttgatgt tacaggtggt 600
ctttgatagc gggaagaatt ccgggaagaa ctgataatga gataaagaac ttctggaaca 660
cccatctcag caagaagctt atcagccaag ggattgatcc aagaacccac aagcctctca 720
acccagaact atctattccc tcttcttcca ctactccacc accaccacca ccttccaagc 780
ctcttcctgt gatcacaaat caccaaacac ttcatgaaac tactactcat catcatctca 840
atattgctag tgtcaaccaa gaatgtgatg agggtcaata tcaatatcaa caacctcaag 900
cagtagctgc tgctgcatat atggtagcta atgatattcc tgatgatgat attccttcca 960
tggatcatct acttgccaac aacaacaaca acaaccagga ctacaatgat atcaattatt 1020
gttctgatga tatcttttct tccttcctca attctctgat caatgaggat gcgttctctg 1080
cccagcgcca cctgcaatcg gagcatcatg atgaccttgc acaggatcct gttacttcat 1140
caacaccaca aggttataat ggcattggtg ttgcatggga attgcccctc atgcctgcta 1200
atttcagcca aaatgaacac agccatgagg ttgatgatca tcacaaatag 1250
<210> 8
<211> 1250
<212> DNA
<213> Lotus corniculatus
<400> 8
atgaggaacc cgatagcatc atcatcaacg aacaagaaga agaacagtac aactactggc 60
aatgaaaatg gcacgactgc tactactact ccgtgctgca gcaaagttgg gttgaagaga 120
gggccatgga caccggagga agacgaggtg ttggccagtt tcataaggaa agaaggcgaa 180
ggtcgctgga gaacgcttcc aaaaagagcc ggcctcctcc gctgcggtaa gagctgccgc 240
ctccgctgga tgaactacct ccgcccctcc gtcaaacgcg gccagatcgc ccccgacgag 300
gaagatctca tcctccgact tcaccgcctc ctcggcaacc ggtacctctt ctcctcgatc 360
gatcttcctt ttatctagct tagggtttgc tacgaacttt gcttaactaa ttaattaatt 420
ttaaataaac atatatatat agctagggct tgatttaatt acactttatt taattaccat 480
ttcatcaatc atgtttagga tatagtacaa caattcattt tgaaactaac attaattcta 540
gcaagaagct ttcttaaata gcttctgggt gttaaaattg attctgatgt tacatttaca 600
ggtggtcttt gatagcggga agaattccgg gaagaactga taatgagata aagaacttct 660
ggaacaccca tctcagcaag aagcttatca gccaagggat tgatccaaga acccacaagc 720
ctctcaaccc agaactatct attccctctt cttccactac tccaccacca ccaccacctt 780
ccaagcctgt tcctgtgatc acaaatcacc aaacacttca tgaaactact actcatcatc 840
atctcaatat tgctagtgtc aaccaagaat gtgatgaggg tcaatatcaa tatcaacaac 900
ctcaagcagt agctgctgct gcatatatgg tagctaatga tattcctgat gatgttcctt 960
ccatggatca tctacttgcc aacaacaaca acaaccagga ctacaatgat atcaattatt 1020
gttctgatga tatcttttct tccttcctca attctctgat caatgaggat gcgttctctg 1080
cccatcgcca cctgcaatcg gagcatcatg atgaccttgc acaggatcct gttacttcat 1140
caacaccaca aggttataat ggcattggtg ttgcatggga attgcccctc atgcctgcta 1200
atttcagcca aaatgaacac agccatgagg ttgatgatca tcacaaatag 1250
<210> 9
<211> 990
<212> DNA
<213> Lotus corniculatus
<400> 9
atgaggaacc cgatagcatc atcatcaacg aacaagaaga agagcagtac tacaactggt 60
aatgaaaatg gcacgactgt tactactact ccgtgctgca gcaaagttgg gttgaagaga 120
gggccatgga caccggagga agacgaggtg ttggccagtt tcataaggaa agaaggcgaa 180
ggtcgctgga gaacgcttcc aaaaagagcc ggcctcctcc gctgcggtaa gagctgccgc 240
ctccgctgga tgaactacct ccgcccctcc gtcaaacgcg gccagatcgc ccccgacgag 300
gaagatctca tcctccgcct tcaccgcctc ctcggcaacc ggtggtcttt gatagcggga 360
agaattccgg gaagaactga taatgagata aagaacttct ggaacaccca tctcagcaag 420
aagcttatca gccaagggat tgatccaaga acccacaagc ctctcaaccc agaactatct 480
attccctctt cttccactac tccaccacca ccaccacctt ccaagcctct tcctgtgatc 540
acaaatcacc aaacacttca tgaaactact actcatcatc atctcaatat tgctagtgtc 600
aaccaagaat gtgatgaggg tcaatatcaa tatcaacaac ctcaagcagt agctgctgct 660
gcatatatgg tagctaatga tattcctgat gatgttcctt ccatggatca tctacttgcc 720
aacaacaaca acaaccagga ctacaatgat atcaattatt gttctgatga tatcttttct 780
tccttcctca attctctgat caatgaggat gcgttctctg cccagcgcca cctgcaatcg 840
gagcatcatg atgaccttgc acaggatcct gttacttcat caacaccaca aggttataat 900
ggcattggtg ttgcatggga attgcccctc atgcctgcta atttcagcca aaatgaacac 960
agccatgagg ttgatgatca tcacaaatag 990
<210> 10
<211> 993
<212> DNA
<213> Lotus corniculatus
<400> 10
atgaggaacc cgatagcatc atcatcaacg aacaagaaga agaacagtac aactactggc 60
aatgaaaatg gcacgactgc tactactact ccgtgctgca gcaaagttgg gttgaagaga 120
gggccatgga caccggagga agacgaggtg ttggccagtt tcataaggaa agaaggcgaa 180
ggtcgctgga gaacgcttcc aaaaagagcc ggcctcctcc gctgcggtaa gagctgccgc 240
ctccgctgga tgaactacct ccgcccctcc gtcaaacgcg gccagatcgc ccccgacgag 300
gaagatctca tcctccgcct tcaccgcctc ctcggcaacc ggtggtcttt gatagcggga 360
agaattccgg gaagaactga taatgagata aagaacttct ggaacaccca tctcagcaag 420
aagcttatca gccaagggat tgatccaaga acccacaagc ctctcaaccc agaactatct 480
attccctctt cttccactac tccaccacca ccaccttcca agcctcttcc tgtgatcaca 540
aatcaccaaa cacttcatga aactactact catcatcatc tcaatattgc tagtgtcaac 600
caagaatgtg atgagggtca atatcaatat caacaacctc aagcagtagc tgctgctgca 660
tatatggtag ctaatgatat tcctgatgat gatattcctt ccatggatca tctacttgcc 720
aacaacaaca acaacaacca ggactacaat gatatcaatt attgttctga tgatatcttt 780
tcttccttcc tcaattctct gatcaatgag gatgcgttct ctgcccagcg ccacctgcaa 840
tcggagcatc atgatgacct tgcacaggat cctgttactt catcaacacc acaaggttat 900
aatggcattg gtgttgcatg ggaattgccc ctcatgcctg ctaatttcag ccaaaatgaa 960
cacagccatg aggttgatga tcatcacaaa tag 993
<210> 11
<211> 960
<212> DNA
<213> Lotus corniculatus
<400> 11
atgaggaacc cgatagcatc atcatcaacg aacaagaaga agaacagtac aactactggc 60
aatgaaaatg acacgactgc tactactact ccgtgctgca gcaaagttgg gttgaagaga 120
gggccatgga caccggagga agacgaggtg ttggccagtt tcataaggaa agaaggcgaa 180
ggtcgctgga gaacgcttcc aaaaagagcc ggcctcctcc gctgcggtaa gagctgccgc 240
ctccgctgga tgaactacct ccgcccctcc gtcaaacgcg gccagatcgc ccccgacgag 300
gaagatctca tcctccgcct tcaccgcctc ctcggcaacc ggtggtcttt gatagcggga 360
agaattccgg gaagaactga taatgagata aagaacttct ggaacaccca tctcagcaag 420
aagcttatca gccaagggat tgatccaaga acccacaagc ctctcaaccc agaactatct 480
attccctctt cttccactac tccaccacca ccaccacctt ccaagcctct tcctgtgatc 540
acaaatcacc aaacacttca tgaaactact actcatcatc atctcaatat tgctagtgtc 600
aaccaagaat gtgatgaggg tcaatatcaa tatcaacaac ctcaagcagt agctgctgct 660
gcatatatgg tagctaatga tattcctgat gatgttcctt ccatggatca tctacttgcc 720
aacaacaaca acaaccagga ctacaatgat atcaattatt gttctgatga tatcttttct 780
tccttcctca attctctgat caatgaggat gcgttctctg cccagcgcca cctgcaatcg 840
gagcatcatg atgaccttgc acaggatcct gttacttcat caacaccaca aggttataat 900
ggcattggtg ttgcatggga attgcccctc atgcctgcta atttcagcca aaatgaacac 960
agccatgagg ttgatgatca tcacaaatag 990
<210> 12
<211> 960
<212> DNA
<213> Lotus corniculatus
<400> 12
atgaggaacc cgatagcatc atcatcaacg aacaagaaga agaacagtac aactactggc 60
aatgaaaatg acacgactgc tactactact ccgtgctgca gcaaagttgg gttgaagaga 120
gggccatgga caccggagga agacgaggtg ttggccagtt tcataaggaa agaaggcgaa 180
ggtcgctgga gaacgcttcc aaaaagagcc ggcctcctcc gctgcggtaa gagctgccgc 240
ctccgctgga tgaactacct ccgcccctcc gtcaaacgcg gccagatcgc ccccgacgag 300
gaagatctca tcctccgact tcaccgcctc ctcggcaacc ggtggtcttt gatagcggga 360
agaattccgg gaagaactga taatgagata aagaacttct ggaacaccca tctcagcaag 420
aagcttatca gccaagggat tgatccaaga acccacaagc ctctcaaccc agaactatct 480
attccctctt cttccactac tccaccacca ccaccacctt ccaagcctct tcctgtgatc 540
acaaatcacc aaacacttca tgaaactact actcatcatc atctcaatat tgctagtgtc 600
aaccaagaat gtgatgaggg tcaatatcaa tatcaacaac ctcaagcagt agctgctgct 660
gcatatatgg tagctaatga tattcctgat gatgttcctt ccatggatca tctacttgcc 720
aacaacaaca acaaccagga ctacaatgat atcaattatt gttctgatga tatcttttct 780
tccttcctca attctctgat caatgaggat gcgttctctg cccagcgcca cctgcaatcg 840
gagcatcatg atgaccttgc acaggatcct gttacttcat caacaccaca aggttataat 900
ggcattggtg ttgcatggga attgcccctc atgcctgcta atttcagcca aaatgaacac 960
agccatgagg ttgatgatca tcacaaatag 990
<210> 13
<211> 996
<212> DNA
<213> Lotus corniculatus
<400> 13
atgaggaacc cgatagcatc atcatcaacg aacaagaaga agaacagtac aactactggc 60
aatgaaaatg gcacgactgc tactactact ccgtgctgca gcaaagttgg gttgaagaga 120
gggccatgga caccggagga agacgaggtg ttggccagtt tcataaggaa agaaggcgaa 180
ggtcgctgga gaacgcttcc aaaaagagcc ggcctcctcc gctgcggtaa gagctgccgc 240
ctccgctgga tgaactacct ccgcccctcc gtcaaacgcg gccagatcgc ccccgacgag 300
gaagatctca tcctccgcct tcaccgcctc ctcggcaacc ggtggtcttt gatagcggga 360
agaattccgg gaagaactga taatgagata aagaacttct ggaacaccca tctcagcaag 420
aagcttatca gccaagggat tgatccaaga acccacaagc ctctcaaccc agaactatct 480
attccctctt cttccactac tccaccacca ccaccacctt ccaagcctct tcctgtgatc 540
acaaatcacc aaacacttca tgaaactact actcatcatc atctcaatat tgctagtgtc 600
aaccaagaat gtgatgaggg tcaatatcaa tatcaacaac ctcaagcagt agctgctgct 660
gcatatatgg tagctaatga tattcctgat gatgatattc cttccatgga tcatctactt 720
gccaacaaca acaacaacaa ccaggactac aatgatatca attattgttc tgatgatatc 780
ttttcttcct tcctcaattc tctgatcaat gaggatgcgt tctctgccca gcgccacctg 840
caatcggagc atcatgatga ccttgcacag gatcctgtta cttcatcaac accacaaggt 900
tataatggca ttggtgttgc atgggaattg cccctcatgc ctgctaattt cagccaaaat 960
gaacacagcc atgaggttga tgatcatcac aaatag 996
<210> 14
<211> 990
<212> DNA
<213> Lotus corniculatus
<400> 14
atgaggaacc cgatagcatc atcatcaacg aacaagaaga agaacagtac aactactggc 60
aatgaaaatg gcacgactgc tactactact ccgtgctgca gcaaagttgg gttgaagaga 120
gggccatgga caccggagga agacgaggtg ttggccagtt tcataaggaa agaaggcgaa 180
ggtcgctgga gaacgcttcc aaaaagagcc ggcctcctcc gctgcggtaa gagctgccgc 240
ctccgctgga tgaactacct ccgcccctcc gtcaaacgcg gccagatcgc ccccgacgag 300
gaagatctca tcctccgact tcaccgcctc ctcggcaacc ggtggtcttt gatagcggga 360
agaattccgg gaagaactga taatgagata aagaacttct ggaacaccca tctcagcaag 420
aagcttatca gccaagggat tgatccaaga acccacaagc ctctcaaccc agaactatct 480
attccctctt cttccactac tccaccacca ccaccacctt ccaagcctgt tcctgtgatc 540
acaaatcacc aaacacttca tgaaactact actcatcatc atctcaatat tgctagtgtc 600
aaccaagaat gtgatgaggg tcaatatcaa tatcaacaac ctcaagcagt agctgctgct 660
gcatatatgg tagctaatga tattcctgat gatgttcctt ccatggatca tctacttgcc 720
aacaacaaca acaaccagga ctacaatgat atcaattatt gttctgatga tatcttttct 780
tccttcctca attctctgat caatgaggat gcgttctctg cccatcgcca cctgcaatcg 840
gagcatcatg atgaccttgc acaggatcct gttacttcat caacaccaca aggttataat 900
ggcattggtg ttgcatggga attgcccctc atgcctgcta atttcagcca aaatgaacac 960
agccatgagg ttgatgatca tcacaaatag 990
<210> 15
<211> 329
<212> PRT
<213> Lotus corniculatus
<400> 15
Met Arg Asn Pro Ile Ala Ser Ser Ser Thr Asn Lys Lys Lys Ser Ser
1 5 10 15
Thr Thr Thr Gly Asn Glu Asn Gly Thr Thr Val Thr Thr Thr Pro Cys
20 25 30
Cys Ser Lys Val Gly Leu Lys Arg Gly Pro Trp Thr Pro Glu Glu Asp
35 40 45
Glu Val Leu Ala Ser Phe Ile Arg Lys Glu Gly Glu Gly Arg Trp Arg
50 55 60
Thr Leu Pro Lys Arg Ala Gly Leu Leu Arg Cys Gly Lys Ser Cys Arg
65 70 75 80
Leu Arg Trp Met Asn Tyr Leu Arg Pro Ser Val Lys Arg Gly Gln Ile
85 90 95
Ala Pro Asp Glu Glu Asp Leu Ile Leu Arg Leu His Arg Leu Leu Gly
100 105 110
Asn Arg Trp Ser Leu Ile Ala Gly Arg Ile Pro Gly Arg Thr Asp Asn
115 120 125
Glu Ile Lys Asn Phe Trp Asn Thr His Leu Ser Lys Lys Leu Ile Ser
130 135 140
Gln Gly Ile Asp Pro Arg Thr His Lys Pro Leu Asn Pro Glu Leu Ser
145 150 155 160
Ile Pro Ser Ser Ser Thr Thr Pro Pro Pro Pro Pro Pro Ser Lys Pro
165 170 175
Leu Pro Val Ile Thr Asn His Gln Thr Leu His Glu Thr Thr Thr His
180 185 190
His His Leu Asn Ile Ala Ser Val Asn Gln Glu Cys Asp Glu Gly Gln
195 200 205
Tyr Gln Tyr Gln Gln Pro Gln Ala Val Ala Ala Ala Ala Tyr Met Val
210 215 220
Ala Asn Asp Ile Pro Asp Asp Val Pro Ser Met Asp His Leu Leu Ala
225 230 235 240
Asn Asn Asn Asn Asn Gln Asp Tyr Asn Asp Ile Asn Tyr Cys Ser Asp
245 250 255
Asp Ile Phe Ser Ser Phe Leu Asn Ser Leu Ile Asn Glu Asp Ala Phe
260 265 270
Ser Ala Gln Arg His Leu Gln Ser Glu His His Asp Asp Leu Ala Gln
275 280 285
Asp Pro Val Thr Ser Ser Thr Pro Gln Gly Tyr Asn Gly Ile Gly Val
290 295 300
Ala Trp Glu Leu Pro Leu Met Pro Ala Asn Phe Ser Gln Asn Glu His
305 310 315 320
Ser His Glu Val Asp Asp His His Lys
325
<210> 16
<211> 330
<212> PRT
<213> Lotus corniculatus
<400> 16
Met Arg Asn Pro Ile Ala Ser Ser Ser Thr Asn Lys Lys Lys Asn Ser
1 5 10 15
Thr Thr Thr Gly Asn Glu Asn Gly Thr Thr Ala Thr Thr Thr Pro Cys
20 25 30
Cys Ser Lys Val Gly Leu Lys Arg Gly Pro Trp Thr Pro Glu Glu Asp
35 40 45
Glu Val Leu Ala Ser Phe Ile Arg Lys Glu Gly Glu Gly Arg Trp Arg
50 55 60
Thr Leu Pro Lys Arg Ala Gly Leu Leu Arg Cys Gly Lys Ser Cys Arg
65 70 75 80
Leu Arg Trp Met Asn Tyr Leu Arg Pro Ser Val Lys Arg Gly Gln Ile
85 90 95
Ala Pro Asp Glu Glu Asp Leu Ile Leu Arg Leu His Arg Leu Leu Gly
100 105 110
Asn Arg Trp Ser Leu Ile Ala Gly Arg Ile Pro Gly Arg Thr Asp Asn
115 120 125
Glu Ile Lys Asn Phe Trp Asn Thr His Leu Ser Lys Lys Leu Ile Ser
130 135 140
Gln Gly Ile Asp Pro Arg Thr His Lys Pro Leu Asn Pro Glu Leu Ser
145 150 155 160
Ile Pro Ser Ser Ser Thr Thr Pro Pro Pro Pro Pro Ser Lys Pro Leu
165 170 175
Pro Val Ile Thr Asn His Gln Thr Leu His Glu Thr Thr Thr His His
180 185 190
His Leu Asn Ile Ala Ser Val Asn Gln Glu Cys Asp Glu Gly Gln Tyr
195 200 205
Gln Tyr Gln Gln Pro Gln Ala Val Ala Ala Ala Ala Tyr Met Val Ala
210 215 220
Asn Asp Ile Pro Asp Asp Asp Ile Pro Ser Met Asp His Leu Leu Ala
225 230 235 240
Asn Asn Asn Asn Asn Asn Gln Asp Tyr Asn Asp Ile Asn Tyr Cys Ser
245 250 255
Asp Asp Ile Phe Ser Ser Phe Leu Asn Ser Leu Ile Asn Glu Asp Ala
260 265 270
Phe Ser Ala Gln Arg His Leu Gln Ser Glu His His Asp Asp Leu Ala
275 280 285
Gln Asp Pro Val Thr Ser Ser Thr Pro Gln Gly Tyr Asn Gly Ile Gly
290 295 300
Val Ala Trp Glu Leu Pro Leu Met Pro Ala Asn Phe Ser Gln Asn Glu
305 310 315 320
His Ser His Glu Val Asp Asp His His Lys
325 330
<210> 17
<211> 329
<212> PRT
<213> Lotus corniculatus
<400> 17
Met Arg Asn Pro Ile Ala Ser Ser Ser Thr Asn Lys Lys Lys Asn Ser
1 5 10 15
Thr Thr Thr Gly Asn Glu Asn Asp Thr Thr Ala Thr Thr Thr Pro Cys
20 25 30
Cys Ser Lys Val Gly Leu Lys Arg Gly Pro Trp Thr Pro Glu Glu Asp
35 40 45
Glu Val Leu Ala Ser Phe Ile Arg Lys Glu Gly Glu Gly Arg Trp Arg
50 55 60
Thr Leu Pro Lys Arg Ala Gly Leu Leu Arg Cys Gly Lys Ser Cys Arg
65 70 75 80
Leu Arg Trp Met Asn Tyr Leu Arg Pro Ser Val Lys Arg Gly Gln Ile
85 90 95
Ala Pro Asp Glu Glu Asp Leu Ile Leu Arg Leu His Arg Leu Leu Gly
100 105 110
Asn Arg Trp Ser Leu Ile Ala Gly Arg Ile Pro Gly Arg Thr Asp Asn
115 120 125
Glu Ile Lys Asn Phe Trp Asn Thr His Leu Ser Lys Lys Leu Ile Ser
130 135 140
Gln Gly Ile Asp Pro Arg Thr His Lys Pro Leu Asn Pro Glu Leu Ser
145 150 155 160
Ile Pro Ser Ser Ser Thr Thr Pro Pro Pro Pro Pro Pro Ser Lys Pro
165 170 175
Leu Pro Val Ile Thr Asn His Gln Thr Leu His Glu Thr Thr Thr His
180 185 190
His His Leu Asn Ile Ala Ser Val Asn Gln Glu Cys Asp Glu Gly Gln
195 200 205
Tyr Gln Tyr Gln Gln Pro Gln Ala Val Ala Ala Ala Ala Tyr Met Val
210 215 220
Ala Asn Asp Ile Pro Asp Asp Val Pro Ser Met Asp His Leu Leu Ala
225 230 235 240
Asn Asn Asn Asn Asn Gln Asp Tyr Asn Asp Ile Asn Tyr Cys Ser Asp
245 250 255
Asp Ile Phe Ser Ser Phe Leu Asn Ser Leu Ile Asn Glu Asp Ala Phe
260 265 270
Ser Ala Gln Arg His Leu Gln Ser Glu His His Asp Asp Leu Ala Gln
275 280 285
Asp Pro Val Thr Ser Ser Thr Pro Gln Gly Tyr Asn Gly Ile Gly Val
290 295 300
Ala Trp Glu Leu Pro Leu Met Pro Ala Asn Phe Ser Gln Asn Glu His
305 310 315 320
Ser His Glu Val Asp Asp His His Lys
325
<210> 18
<211> 329
<212> PRT
<213> Lotus corniculatus
<400> 18
Met Arg Asn Pro Ile Ala Ser Ser Ser Thr Asn Lys Lys Lys Asn Ser
1 5 10 15
Thr Thr Thr Gly Asn Glu Asn Asp Thr Thr Ala Thr Thr Thr Pro Cys
20 25 30
Cys Ser Lys Val Gly Leu Lys Arg Gly Pro Trp Thr Pro Glu Glu Asp
35 40 45
Glu Val Leu Ala Ser Phe Ile Arg Lys Glu Gly Glu Gly Arg Trp Arg
50 55 60
Thr Leu Pro Lys Arg Ala Gly Leu Leu Arg Cys Gly Lys Ser Cys Arg
65 70 75 80
Leu Arg Trp Met Asn Tyr Leu Arg Pro Ser Val Lys Arg Gly Gln Ile
85 90 95
Ala Pro Asp Glu Glu Asp Leu Ile Leu Arg Leu His Arg Leu Leu Gly
100 105 110
Asn Arg Trp Ser Leu Ile Ala Gly Arg Ile Pro Gly Arg Thr Asp Asn
115 120 125
Glu Ile Lys Asn Phe Trp Asn Thr His Leu Ser Lys Lys Leu Ile Ser
130 135 140
Gln Gly Ile Asp Pro Arg Thr His Lys Pro Leu Asn Pro Glu Leu Ser
145 150 155 160
Ile Pro Ser Ser Ser Thr Thr Pro Pro Pro Pro Pro Pro Ser Lys Pro
165 170 175
Leu Pro Val Ile Thr Asn His Gln Thr Leu His Glu Thr Thr Thr His
180 185 190
His His Leu Asn Ile Ala Ser Val Asn Gln Glu Cys Asp Glu Gly Gln
195 200 205
Tyr Gln Tyr Gln Gln Pro Gln Ala Val Ala Ala Ala Ala Tyr Met Val
210 215 220
Ala Asn Asp Ile Pro Asp Asp Val Pro Ser Met Asp His Leu Leu Ala
225 230 235 240
Asn Asn Asn Asn Asn Gln Asp Tyr Asn Asp Ile Asn Tyr Cys Ser Asp
245 250 255
Asp Ile Phe Ser Ser Phe Leu Asn Ser Leu Ile Asn Glu Asp Ala Phe
260 265 270
Ser Ala Gln Arg His Leu Gln Ser Glu His His Asp Asp Leu Ala Gln
275 280 285
Asp Pro Val Thr Ser Ser Thr Pro Gln Gly Tyr Asn Gly Ile Gly Val
290 295 300
Ala Trp Glu Leu Pro Leu Met Pro Ala Asn Phe Ser Gln Asn Glu His
305 310 315 320
Ser His Glu Val Asp Asp His His Lys
325
<210> 19
<211> 331
<212> PRT
<213> Lotus corniculatus
<400> 19
Met Arg Asn Pro Ile Ala Ser Ser Ser Thr Asn Lys Lys Lys Asn Ser
1 5 10 15
Thr Thr Thr Gly Asn Glu Asn Gly Thr Thr Ala Thr Thr Thr Pro Cys
20 25 30
Cys Ser Lys Val Gly Leu Lys Arg Gly Pro Trp Thr Pro Glu Glu Asp
35 40 45
Glu Val Leu Ala Ser Phe Ile Arg Lys Glu Gly Glu Gly Arg Trp Arg
50 55 60
Thr Leu Pro Lys Arg Ala Gly Leu Leu Arg Cys Gly Lys Ser Cys Arg
65 70 75 80
Leu Arg Trp Met Asn Tyr Leu Arg Pro Ser Val Lys Arg Gly Gln Ile
85 90 95
Ala Pro Asp Glu Glu Asp Leu Ile Leu Arg Leu His Arg Leu Leu Gly
100 105 110
Asn Arg Trp Ser Leu Ile Ala Gly Arg Ile Pro Gly Arg Thr Asp Asn
115 120 125
Glu Ile Lys Asn Phe Trp Asn Thr His Leu Ser Lys Lys Leu Ile Ser
130 135 140
Gln Gly Ile Asp Pro Arg Thr His Lys Pro Leu Asn Pro Glu Leu Ser
145 150 155 160
Ile Pro Ser Ser Ser Thr Thr Pro Pro Pro Pro Pro Pro Ser Lys Pro
165 170 175
Leu Pro Val Ile Thr Asn His Gln Thr Leu His Glu Thr Thr Thr His
180 185 190
His His Leu Asn Ile Ala Ser Val Asn Gln Glu Cys Asp Glu Gly Gln
195 200 205
Tyr Gln Tyr Gln Gln Pro Gln Ala Val Ala Ala Ala Ala Tyr Met Val
210 215 220
Ala Asn Asp Ile Pro Asp Asp Asp Ile Pro Ser Met Asp His Leu Leu
225 230 235 240
Ala Asn Asn Asn Asn Asn Asn Gln Asp Tyr Asn Asp Ile Asn Tyr Cys
245 250 255
Ser Asp Asp Ile Phe Ser Ser Phe Leu Asn Ser Leu Ile Asn Glu Asp
260 265 270
Ala Phe Ser Ala Gln Arg His Leu Gln Ser Glu His His Asp Asp Leu
275 280 285
Ala Gln Asp Pro Val Thr Ser Ser Thr Pro Gln Gly Tyr Asn Gly Ile
290 295 300
Gly Val Ala Trp Glu Leu Pro Leu Met Pro Ala Asn Phe Ser Gln Asn
305 310 315 320
Glu His Ser His Glu Val Asp Asp His His Lys
325 330
<210> 20
<211> 329
<212> PRT
<213> Lotus corniculatus
<400> 20
Met Arg Asn Pro Ile Ala Ser Ser Ser Thr Asn Lys Lys Lys Asn Ser
1 5 10 15
Thr Thr Thr Gly Asn Glu Asn Gly Thr Thr Ala Thr Thr Thr Pro Cys
20 25 30
Cys Ser Lys Val Gly Leu Lys Arg Gly Pro Trp Thr Pro Glu Glu Asp
35 40 45
Glu Val Leu Ala Ser Phe Ile Arg Lys Glu Gly Glu Gly Arg Trp Arg
50 55 60
Thr Leu Pro Lys Arg Ala Gly Leu Leu Arg Cys Gly Lys Ser Cys Arg
65 70 75 80
Leu Arg Trp Met Asn Tyr Leu Arg Pro Ser Val Lys Arg Gly Gln Ile
85 90 95
Ala Pro Asp Glu Glu Asp Leu Ile Leu Arg Leu His Arg Leu Leu Gly
100 105 110
Asn Arg Trp Ser Leu Ile Ala Gly Arg Ile Pro Gly Arg Thr Asp Asn
115 120 125
Glu Ile Lys Asn Phe Trp Asn Thr His Leu Ser Lys Lys Leu Ile Ser
130 135 140
Gln Gly Ile Asp Pro Arg Thr His Lys Pro Leu Asn Pro Glu Leu Ser
145 150 155 160
Ile Pro Ser Ser Ser Thr Thr Pro Pro Pro Pro Pro Pro Ser Lys Pro
165 170 175
Val Pro Val Ile Thr Asn His Gln Thr Leu His Glu Thr Thr Thr His
180 185 190
His His Leu Asn Ile Ala Ser Val Asn Gln Glu Cys Asp Glu Gly Gln
195 200 205
Tyr Gln Tyr Gln Gln Pro Gln Ala Val Ala Ala Ala Ala Tyr Met Val
210 215 220
Ala Asn Asp Ile Pro Asp Asp Val Pro Ser Met Asp His Leu Leu Ala
225 230 235 240
Asn Asn Asn Asn Asn Gln Asp Tyr Asn Asp Ile Asn Tyr Cys Ser Asp
245 250 255
Asp Ile Phe Ser Ser Phe Leu Asn Ser Leu Ile Asn Glu Asp Ala Phe
260 265 270
Ser Ala His Arg His Leu Gln Ser Glu His His Asp Asp Leu Ala Gln
275 280 285
Asp Pro Val Thr Ser Ser Thr Pro Gln Gly Tyr Asn Gly Ile Gly Val
290 295 300
Ala Trp Glu Leu Pro Leu Met Pro Ala Asn Phe Ser Gln Asn Glu His
305 310 315 320
Ser His Glu Val Asp Asp His His Lys
325
Claims (10)
1. The Lotus corniculatus LcMYB5 gene is characterized in that the nucleotide sequence of the Lotus corniculatus LcMYB5 gene is selected from SEQ ID No: 3. SEQ ID No: 4. SEQ ID No: 5. SEQ ID No: 6. SEQ ID No: 7 and SEQ ID No: 8.
2. The Lotus corniculatus LcMYB5 gene of claim 1, wherein the sequence of the transcript of the Lotus corniculatus LcMYB5 gene is selected from SEQ ID No: 9. SEQ ID No: 10. SEQ ID No: 11. SEQ ID No: 12. SEQ ID No: 13 and SEQ ID No: 14, or a pharmaceutically acceptable salt thereof.
3. The Lotus corniculatus LcMYB5 gene of claim 2, wherein the amino acid sequence of the transcript is selected from SEQ ID No: 15. SEQ ID No: 16. SEQ ID No: 17. SEQ ID No: 18. SEQ ID No: 19 and SEQ ID No: 20, or a pharmaceutically acceptable salt thereof.
4. Use of the Lotus corniculatus LcMYB5 gene of any one of claims 1-3 to increase tannin content in plant leaves.
5. Use of the Lotus corniculatus LcMYB5 gene of any one of claims 1-3 in genetic improvement and breeding of plants.
6. Use of the Lotus corniculatus LcMYB5 gene of any one of claims 1-3 in regulating tannin synthesis related genes.
7. The use according to claim 6, wherein said tannin synthesis-associated gene is selected from at least one of the genes LjCHS-1, LjCHS-2, LjF3H-1, LjLAR, LjANR, LjTT15, LjTT9, LjTT8, LjTT8L1, LjTTG2, LjTTG1L1 and LjTTG1L 2.
8. The use of claim 6, wherein the Lotus corniculatus LcMYB5 gene is capable of increasing the expression level of a tannin synthesis related gene.
9. The use according to any one of claims 4-8, wherein the nucleotide sequence of the Lotus corniculatus LcMYB5 gene is selected from SEQ ID No: 3. SEQ ID No: 4. SEQ ID No: 5. SEQ ID No: 6. SEQ ID No: 7 and SEQ ID No: 8.
10. The use according to any one of claims 4 to 8, wherein the sequence of the transcript of the Lotus corniculatus LcMYB5 gene is selected from the group consisting of SEQ ID No: 9. SEQ ID No: 10. SEQ ID No: 11. SEQ ID No: 12. SEQ ID No: 13 and SEQ ID No: 14, or a pharmaceutically acceptable salt thereof.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111009708.XA CN113604478B (en) | 2021-08-31 | 2021-08-31 | Baimaigen LcMYB5 gene and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111009708.XA CN113604478B (en) | 2021-08-31 | 2021-08-31 | Baimaigen LcMYB5 gene and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN113604478A true CN113604478A (en) | 2021-11-05 |
| CN113604478B CN113604478B (en) | 2023-05-23 |
Family
ID=78309805
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202111009708.XA Active CN113604478B (en) | 2021-08-31 | 2021-08-31 | Baimaigen LcMYB5 gene and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN113604478B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN115043921A (en) * | 2022-06-30 | 2022-09-13 | 中国科学院华南植物园 | Lotus corniculatus plant type related gene LjLAZY3 and application thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1464060A (en) * | 2002-06-14 | 2003-12-31 | 中国科学院上海植物生理研究所 | Bridsfoot trefoil pattern schema and anthotaxis structure regulating gene encoding protein and use thereof |
| US20060123508A1 (en) * | 2004-07-09 | 2006-06-08 | Samuel Roberts Nobel Foundation | Genetic manipulation of condensed tannins |
-
2021
- 2021-08-31 CN CN202111009708.XA patent/CN113604478B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1464060A (en) * | 2002-06-14 | 2003-12-31 | 中国科学院上海植物生理研究所 | Bridsfoot trefoil pattern schema and anthotaxis structure regulating gene encoding protein and use thereof |
| US20060123508A1 (en) * | 2004-07-09 | 2006-06-08 | Samuel Roberts Nobel Foundation | Genetic manipulation of condensed tannins |
Non-Patent Citations (7)
| Title |
|---|
| FRANCISCO JOSÉ ESCARAY ET AL.: "The R2R3-MYB TT2b and the bHLH TT8 genes are the major regulators of proanthocyanidin biosynthesis in the leaves of Lotus species", 《PLANTA》 * |
| JIANG W. AND PANG Y.: "MZ223885.1", 《GENBANK》 * |
| JIANG W. AND PANG Y.: "MZ223886.1", 《GENBANK》 * |
| JIANG W. AND PANG Y.: "MZ223887.1", 《GENBANK》 * |
| JIANG W. AND PANG Y.: "MZ223888.1", 《GENBANK》 * |
| JIANG W. AND PANG Y.: "MZ223889.1", 《GENBANK》 * |
| JIANG W. AND PANG Y.: "MZ223890.1", 《GENBANK》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN115043921A (en) * | 2022-06-30 | 2022-09-13 | 中国科学院华南植物园 | Lotus corniculatus plant type related gene LjLAZY3 and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN113604478B (en) | 2023-05-23 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN109576284B (en) | Multifunctional MYB transcription factor gene and application thereof | |
| CN110184247B (en) | Alfalfa melatonin synthetic gene MsASMT and application thereof in regulation and control of plant melatonin and flavonoid synthesis | |
| CN110950943B (en) | Alfalfa 'WL525' embryonic development late protein MsLEA-D34 and coding gene thereof | |
| CN110872598B (en) | Cotton drought-resistant related gene GhDT1 and application thereof | |
| CN112322630B (en) | MsSPL13 gene and application thereof | |
| CN107299104A (en) | Application of the REVOLUTA genes in regulation and control legume vanelets number and leaf-stem ratio | |
| CN109161553A (en) | A kind of pears transcription factor PbBP and its application | |
| CN109608530B (en) | Soybean low-phosphorus response gene for promoting lateral root formation, protein and application thereof | |
| CN113604478B (en) | Baimaigen LcMYB5 gene and application thereof | |
| CN113088526B (en) | Heat shock related gene ZmHsf11 and application thereof in regulation and control of plant heat resistance | |
| CN112694524B (en) | Anti-fusarium wilt PHD transcription factor ClPHD23, gene, expression vector, transformant and application thereof | |
| CN107267521A (en) | A kind of cabbage type rape and NAC87 transcription factor genes and its application in arabidopsis | |
| CN113564198A (en) | Application of RNAi (ribonucleic acid interference) on PALM1 gene to increase number of small leaves of leguminous forage | |
| CN107338255A (en) | Application of the PINNATE PENTAFOLIATA2 genes in legume leaflet quantity is regulated and controled | |
| CN108823220B (en) | Cloning and application of waxy synthesis related gene MdCER1 in apple | |
| CN114736280B (en) | Application of ZmROA1 protein in regulation and control of plant tolerance | |
| CN114657188B (en) | Gene PK1 for regulating cadmium accumulation of rice, protein and application thereof | |
| CN108456683B (en) | Function and application of gene SID1 for regulating heading stage of rice | |
| CN113481210B (en) | Application of cotton GhDof1.7 gene in promotion of salt tolerance of plants | |
| CN114807181A (en) | Application of rice OsCKX3 gene in regulation and control of rice leaf included angle | |
| CN101514344A (en) | Flavone synthetase gene and polypeptide encoded thereby | |
| CN114369616A (en) | Application of tomato SISPS gene in improving high temperature resistance of plants | |
| CN109988229B (en) | Chimonanthus praecox CpFT gene and application thereof | |
| CN110358774B (en) | Gene, protein, gene expression cassette, expression vector, host cell, method and application for controlling rice flowering time | |
| CN114277041A (en) | Application of soybean gibberellin 3 beta-hydroxylase encoding gene GmGA3ox1 |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |