CN113604478B - Baimaigen LcMYB5 gene and application thereof - Google Patents
Baimaigen LcMYB5 gene and application thereof Download PDFInfo
- Publication number
- CN113604478B CN113604478B CN202111009708.XA CN202111009708A CN113604478B CN 113604478 B CN113604478 B CN 113604478B CN 202111009708 A CN202111009708 A CN 202111009708A CN 113604478 B CN113604478 B CN 113604478B
- Authority
- CN
- China
- Prior art keywords
- leu
- asn
- pro
- ser
- asp
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8201—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation
- C12N15/8202—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation by biological means, e.g. cell mediated or natural vector
- C12N15/8205—Agrobacterium mediated transformation
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8242—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
- C12N15/8243—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Biomedical Technology (AREA)
- Organic Chemistry (AREA)
- Biotechnology (AREA)
- Molecular Biology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Zoology (AREA)
- General Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- General Health & Medical Sciences (AREA)
- Microbiology (AREA)
- Plant Pathology (AREA)
- Physics & Mathematics (AREA)
- Cell Biology (AREA)
- Nutrition Science (AREA)
- Botany (AREA)
- Gastroenterology & Hepatology (AREA)
- Medicinal Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides a hundred vein root LcMYB5 gene, wherein the nucleotide sequence of the hundred vein root LcMYB5 gene is selected from SEQ ID No:3-8, and at least one of the sequences shown in seq id no; the application of the Baimaigen LcMYB5 gene in improving the tannin content of plant leaves is also provided. The invention identifies a new key regulatory gene LcMYB5 for regulating tannin biosynthesis in the Baimaigen for the first time. The Baimaigen LcMYB5 gene provides a new candidate gene for cultivating pasture varieties with high-content tannin in leaves, and provides a new way for cultivating the novel pasture varieties with anti-tympanites quality; can be used for further genetic improvement to increase the content of leaf tannin in Baimaigen; can also be used for genetically improving pasture with low content of tannin or non-accumulated tannin in leaves to increase the content of tannin so as to prevent or slow down the occurrence of tympanites, thereby reducing economic loss.
Description
Technical Field
The invention relates to a Baimaigen LcMYB5 gene and application thereof, in particular to application of the Baimaigen LcMYB5 gene in regulating and controlling tannin content, and belongs to the technical field of genetic engineering application.
Background
Tannins (Proanthocyanidins) are flavonoid secondary metabolites with important activities in plants. Not only plays an important role in the regulation of seed dormancy, longevity and germination, but also is involved in regulating biotic and abiotic stress of plants. In animal husbandry, tannin in pasture can also inhibit the growth of ruminant rumen alcogenase, reduce methane release, inhibit the growth of gastrointestinal parasites, improve animal fertility, promote the development of fetuses, wool yield and lactation, and proper amount of tannin can also effectively prevent the frequent lethal tympanites of ruminants such as cattle and sheep. When the content of tannin in the alfalfa is higher than 2% of dry weight, the occurrence of the tympanites of ruminants such as cattle, sheep and the like can be effectively prevented; in addition, it has antioxidant, antiinflammatory and anticancer effects, and is beneficial to human health. Therefore, studies on tannin biosynthesis and regulation are an important research direction in the field of plant secondary metabolism.
The Baimai root (Lotus corniculatus L.) is a plant belonging to the family Leguminosae, is a perennial high-quality pasture widely planted in the world, and is distributed in various places in China. The Baimai root has the capability of growing under severe conditions of low fertilizer, acidity, high salt and the like, has high nutritive value and good palatability, is safe for livestock feeding, and is excellent pasture in animal husbandry production. In recent years, studies on agronomic traits and resistance evaluation, tissue culture, gene cloning, genetic engineering improvement and the like of Baimai roots are increasing. However, few studies have been made on the synthesis of leaf tannins in Baimaigen, and only in 1983 Ross et al performed population analysis on leaf tannins of nearly 200 different Baimaigen varieties, and leaf tannins were found to have polymorphisms in content and to be controlled by dominant inheritance of a single gene, but no intensive studies have been made on genes. Therefore, the molecular mechanism of leaf tannin biosynthesis of Baimaigen is still unclear, preventing breeding efforts to further increase leaf tannin content by genetic improvement.
Disclosure of Invention
The invention aims to provide a novel key regulatory gene LcMYB5 for regulating tannin biosynthesis in Baimaigen, wherein the LcMYB5 gene provides a novel candidate gene for cultivating pasture varieties with high tannin content in leaves, and provides a novel approach for cultivating novel pasture varieties with anti-tympanites quality.
According to one aspect of the present application, there is provided a baculo lcmeb 5 gene, the nucleotide sequence of which baculo lcmeb 5 gene is selected from the group consisting of SEQ ID nos: 3. SEQ ID No: 4. SEQ ID No: 5. SEQ ID No: 6. SEQ ID No:7 and SEQ ID No:8, and at least one of the sequences shown in figure 8.
In some embodiments, the sequence of the transcript of the baccarat root lcmeb 5 gene is selected from the group consisting of SEQ ID nos: 9. SEQ ID No: 10. SEQ ID No: 11. SEQ ID No: 12. SEQ ID No:13 and SEQ ID No:14, and at least one of the sequences shown in fig. 14.
Specifically, the amino acid sequence of the transcript is selected from the group consisting of SEQ ID nos: 15. SEQ ID No: 16. SEQ ID No: 17. SEQ ID No: 18. SEQ ID No:19 and SEQ ID No:20, and at least one of the sequences shown in seq id no.
According to another aspect of the application, the application of the Baimaigen LcMYB5 gene in improving the tannin content of plant leaves is also provided.
According to another aspect of the application, the application of the Baimaigen LcMYB5 gene in plant genetic improvement and breeding is also provided.
According to another aspect of the application, the application of the Baimaigen LcMYB5 gene in regulating and controlling tannin synthesis related genes is also provided.
In some embodiments, the tannin synthesis associated gene is selected from at least one of the genes LjCHS-1, ljCHS-2, ljF H-1, ljLAR, ljANR, ljTT, ljTT9, ljTT8L1, ljTTG2, ljTTG1L1, and LjTTG1L 2.
In some embodiments, the Baimaigen lcmeb 5 gene is capable of increasing the expression level of a gene associated with tannin synthesis.
Specifically, the nucleotide sequence of the Baimaigen LcMYB5 gene is selected from SEQ ID No: 3. SEQ ID No: 4. SEQ ID No: 5. SEQ ID No: 6. SEQ ID No:7 and SEQ ID No:8, and at least one of the sequences shown in figure 8.
Specifically, the sequence of the transcript of the Baimaigen LcMYB5 gene is selected from SEQ ID No: 9. SEQ ID No: 10. SEQ ID No: 11. SEQ ID No: 12. SEQ ID No:13 and SEQ ID No:14, and at least one of the sequences shown in fig. 14.
The beneficial effects of the invention are as follows:
1. the invention identifies a new key regulatory gene LcMYB5 for regulating tannin biosynthesis in the Baimaigen for the first time. The Baimaigen LcMYB5 gene provides a new candidate gene for cultivating pasture varieties with high-content tannin in leaves, and provides a new way for cultivating the novel pasture varieties with anti-tympanites quality.
2. The application of the Baimaigen LcMYB5 gene in improving the content of the leaf tannin of plants, wherein the Baimaigen LcMYB5 gene can activate the expression of the tannin synthesis related genes, increase the accumulation of the tannin and can be used for further genetic improvement and increase of the leaf tannin content in the Baimaigen; can also be used for genetically improving pasture with low content of tannin or non-accumulated tannin in leaves to increase the content of tannin so as to prevent or slow down the occurrence of tympanites, thereby reducing economic loss.
3. The application system analyzes and regulates the molecular mechanism of leaf tannin biosynthesis, and further has important theoretical and application values for quality improvement of pasture tannin by a genetic engineering method.
Drawings
FIG. 1 shows the tannin content in the leaves of different hundred vein roots;
FIG. 2 shows the content of tannin in various tissues of Japanese Baimaigen;
FIG. 3 shows the gene expression levels of Japanese Baimai root LjANR;
FIG. 4 shows the expression levels of different genes of Baimaigen in Japan;
FIG. 5 is a phylogenetic tree of the Baimaigen LcMYB5 gene;
FIG. 6 shows the results of subcellular localization analysis of the LcMYB5 gene;
FIG. 7 shows the transcriptional activity results of the Baimaigen LcMYB5a and LcMYB5b genes;
FIG. 8 shows the content of soluble tannins, insoluble tannins and total flavonoids in LcMYB5a and LcMYB5b overexpressing materials; the A diagram is the content of soluble tannin measured by a DMACA method, the B diagram is the content of soluble tannin measured by an n-butanol hydrochloric acid method, the C diagram is the content of insoluble tannin measured by an n-butanol hydrochloric acid method, and the D diagram is the content of total flavonoids;
FIG. 9 shows the flavonol content of LcMYB5a and LcMYB5b overexpressing materials;
FIG. 10 shows the anthocyanin content of LcMYB5a and LcMYB5b overexpressing materials;
FIG. 11 shows the expression levels of tannin synthesis associated genes in LcMYB5a and LcMYB5b overexpressing materials.
Detailed Description
The experimental methods used in the following examples are conventional methods unless otherwise specified.
Materials, reagents and the like used in the following examples are commercially available unless otherwise specified.
Example 1
The tannin content in its leaves was quantitatively determined by collecting 38 Baimaigen (Lotus corniculatus l.) germplasm resources. The tannin content per gram dry weight of the leaf was found to be from the lowest 0mg to the highest 88.4mg as shown in figure 1. The diversity of the tannin content in the germ plasm resource leaves lays a foundation for identifying key regulatory genes for tannin synthesis in the Baimaigen leaves.
Meanwhile, since japanese Baimai is diploid, the genome is also revealed, and has been widely used as a model plant for research. Japanese lotus root (lotus japonica l.) is also closely related to japanese lotus root (Lotus corniculatus l.). Thus, the study also analyzed the tannin distribution pattern of japanese Baimai roots, and found that accumulation of tannins was hardly detected in the leaves, stems and roots of japanese Baimai roots; small amounts of tannins were also found in flowers, with tannins being predominantly concentrated in the seed coat of the seed, as shown in fig. 2. LjANR, the first key enzyme in tannin synthesis, has a gene expression level very similar to the tannin distribution pattern, and the correlation coefficient reaches 0.89 as shown in FIG. 3.
Further adopting a reverse genetics method, comprising the following specific steps: a total of four probes (Tm 1624.33_at, tm1624.28_at, tm1040.12_at and Tm1040.12 _at) were obtained from the CDS sequences (AtTT 2, atMYB5, mtPAR, mtMYB14 and MtMYB 5) of key MYB transcription factors regulating tannin biosynthesis in Arabidopsis and alfalfa model species, first Blast on https:// ljgea. Noble.org/v2/blast_search_form. Php website. These correspond to 4 genes which are likely to regulate tannin synthesis (t 1040.12_at is LjMYB5, t 1040.12_at is LjTT2a, t 1624.28_at is LjTT2b, t 1624.33_at is LjTT2 c), respectively, where LjTT2a, ljTT2b and LjTT2c have been reported by other studies: only LjTT2a regulates tannin synthesis in the seed coats. It was analyzed that the correlation coefficients between the gene expression levels of LjTT2a, ljTT2b and LjTT2c and the distribution pattern of tannins were all lower than 0; and their gene expression levels were relatively low in various tissues and lower than that of LjMYB5, as shown in FIG. 4; the correlation coefficient between the gene expression level of LjMYB5 and tannin was also high. Thus, ljMYB5 may be a key regulatory gene in Japanese Baimai root that regulates tannin biosynthesis. The nucleotide sequence of the LjMYB5 gene is shown as SEQ ID No:1, the amino acid sequence of which is shown as SEQ ID No: 2.
Example 2
The lcmeb 5 gene was cloned from leaves of the plant material (B91) with the highest tannin content. The 6 genomic sequences of the LcMYB5 gene were cloned as LcMYB5A, lcMYB5B, lcMYB5C, lcMYB5D, lcMYB E and LcMYB5F (intron sequences, other coding region sequences, along the horizontal line).
LcMYB5A：
ATGAGGAACCCGATAGCATCATCATCAACGAACAAGAAGAAGAGCAGTACTACAACTGGTAATGAAAATGGCACGACTGTTACTACTACTCCGTGCTGCAGCAAAGTTGGGTTGAAGAGAGGGCCATGGACACCGGAGGAAGACGAGGTGTTGGCCAGTTTCATAAGGAAAGAAGGCGAAGGTCGCTGGAGAACGCTTCCAAAAAGAGCCGGCCTCCTCCGCTGCGGTAAGAGCTGCCGCCTCCGCTGGATGAACTACCTCCGCCCCTCCGTCAAACGCGGCCAGATCGCCCCCGACGAGGAAGATCTCATCCTCCGCCTTCACCGCCTCCTCGGCAACCGGTACCTCTTCTCCTCGATCGATCTTCCTTTT ATCTAGCTTAGGGTTTGCTACGAACTTTGCTTAACTAATTAATTAATTTTAAATAAACATATATATATAGCTAGGG CTTGATTTAATTACACTTTATTTAATTACCATTTCATCAATCATGTTTAGGATATAGTACAACAATTCATTTTGAA ACTAACATTAATTCTAGCAAGAAGCTTTCTTAAATAGCTTCTGGGTGTTAAAATTGATTCTGATGTTACATTTACA GGTGGTCTTTGATAGCGGGAAGAATTCCGGGAAGAACTGATAATGAGATAAAGAACTTCTGGAACACCCATCTCAGCAAGAAGCTTATCAGCCAAGGGATTGATCCAAGAACCCACAAGCCTCTCAACCCAGAACTATCTATTCCCTCTTCTTCCACTACTCCACCACCACCACCACCTTCCAAGCCTCTTCCTGTGATCACAAATCACCAAACACTTCATGAAACTACTACTCATCATCATCTCAATATTGCTAGTGTCAACCAAGAATGTGATGAGGGTCAATATCAATATCAACAACCTCAAGCAGTAGCTGCTGCTGCATATATGGTAGCTAATGATATTCCTGATGATGTTCCTTCCATGGATCATCTACTTGCCAACAACAACAACAACCAGGACTACAATGATATCAATTATTGTTCTGATGATATCTTTTCTTCCTTCCTCAATTCTCTGATCAATGAGGATGCGTTCTCTGCCCAGCGCCACCTGCAATCGGAGCATCATGATGACCTTGCACAGGATCCTGTTACTTCATCAACACCACAAGGTTATAATGGCATTGGTGTTGCATGGGAATTGCCCCTCATGCCTGCTAATTTCAGCCAAAATGAACACAGCCATGAGGTTGATGATCATCACAAATAG(SEQ ID No：3)。
LcMYB5B：
ATGAGGAACCCGATAGCATCATCATCAACGAACAAGAAGAAGAACAGTACAACTACTGGCAATGAAAATGGCACGACTGCTACTACTACTCCGTGCTGCAGCAAAGTTGGGTTGAAGAGAGGGCCATGGACACCGGAGGAAGACGAGGTGTTGGCCAGTTTCATAAGGAAAGAAGGCGAAGGTCGCTGGAGAACGCTTCCAAAAAGAGCCGGCCTCCTCCGCTGCGGTAAGAGCTGCCGCCTCCGCTGGATGAACTACCTCCGCCCCTCCGTCAAACGCGGCCAGATCGCCCCCGACGAGGAAGATCTCATCCTCCGCCTTCACCGCCTCCTCGGCAACCGGTACCTCCTCTCCTCGATCGATCTCCCTTTT ATCTAGCTTAGGGTTTGCTACGAACTTTGCTTAACTAATTAATTAATTTTAAATAAACATATATATATATATAGCT AGGGCTTGATTTAATTACCATTTCATCAATCATGTTTAGGATATAGTACAACAATTCATTTTGAAACTAACATTAA TTCTAGCAAGAAGCTTTCTTAAATAGCTTCTGGGTGTTAAAATTGATTCTGATGATTCTGATGTTACAGGTGGTCTTTGATAGCGGGAAGAATTCCGGGAAGAACTGATAATGAGATAAAGAACTTCTGGAACACCCATCTCAGCAAGAAGCTTATCAGCCAAGGGATTGATCCAAGAACCCACAAGCCTCTCAACCCAGAACTATCTATTCCCTCTTCTTCCACTACTCCACCACCACCACCTTCCAAGCCTCTTCCTGTGATCACAAATCACCAAACACTTCATGAAACTACTACTCATCATCATCTCAATATTGCTAGTGTCAACCAAGAATGTGATGAGGGTCAATATCAATATCAACAACCTCAAGCAGTAGCTGCTGCTGCATATATGGTAGCTAATGATATTCCTGATGATGATATTCCTTCCATGGATCATCTACTTGCCAACAACAACAACAACAACCAGGACTACAATGATATCAATTATTGTTCTGATGATATCTTTTCTTCCTTCCTCAATTCTCTGATCAATGAGGATGCGTTCTCTGCCCAGCGCCACCTGCAATCGGAGCATCATGATGACCTTGCACAGGATCCTGTTACTTCATCAACACCACAAGGTTATAATGGCATTGGTGTTGCATGGGAATTGCCCCTCATGCCTGCTAATTTCAGCCAAAATGAACACAGCCATGAGGTTGATGATCATCACAAATAG(SEQ ID No：4)。
LcMYB5C：
ATGAGGAACCCGATAGCATCATCATCAACGAACAAGAAGAAGAACAGTACAACTACTGGCAATGAAAATGACACGACTGCTACTACTACTCCGTGCTGCAGCAAAGTTGGGTTGAAGAGAGGGCCATGGACACCGGAGGAAGACGAGGTGTTGGCCAGTTTCATAAGGAAAGAAGGCGAAGGTCGCTGGAGAACGCTTCCAAAAAGAGCCGGCCTCCTCCGCTGCGGTAAGAGCTGCCGCCTCCGCTGGATGAACTACCTCCGCCCCTCCGTCAAACGCGGCCAGATCGCCCCCGACGAGGAAGATCTCATCCTCCGCCTTCACCGCCTCCTCGGCAACCGGTACCTCTTCTCCTCGATCGATCTTCCTTTT ATCTAGCTTAGGGTTTGCTACGAACTTTGCTTAACTAATTAAATAATTTTAAATAAACATATATATATATAGCTAG GGCTTGATTTAATTACACTTTATTTAATTACCATTTCATCAATCATGTTTAGGATATAGTACAACAATTCATTTTG AAACTAACATTAATTCTAGCAAGAAGCTTTCTTAAATAGCTTCTGGGTGTTAAAATTGATTCTGATGTTACATTTA CAGGTGGTCTTTGATAGCGGGAAGAATTCCGGGAAGAACTGATAATGAGATAAAGAACTTCTGGAACACCCATCTCAGCAAGAAGCTTATCAGCCAAGGGATTGATCCAAGAACCCACAAGCCTCTCAACCCAGAACTATCTATTCCCTCTTCTTCCACTACTCCACCACCACCACCACCTTCCAAGCCTCTTCCTGTGATCACAAATCACCAAACACTTCATGAAACTACTACTCATCATCATCTCAATATTGCTAGTGTCAACCAAGAATGTGATGAGGGTCAATATCAATATCAACAACCTCAAGCAGTAGCTGCTGCTGCATATATGGTAGCTAATGATATTCCTGATGATGTTCCTTCCATGGATCATCTACTTGCCAACAACAACAACAACCAGGACTACAATGATATCAATTATTGTTCTGATGATATCTTTTCTTCCTTCCTCAATTCTCTGATCAATGAGGATGCGTTCTCTGCCCAGCGCCACCTGCAATCGGAGCATCATGATGACCTTGCACAGGATCCTGTTACTTCATCAACACCACAAGGTTATAATGGCATTGGTGTTGCATGGGAATTGCCCCTCATGCCTGCTAATTTCAGCCAAAATGAACACAGCCATGAGGTTGATGATCATCACAAATAG(SEQ ID No：5)。
LcMYB5D：
ATGAGGAACCCGATAGCATCATCATCAACGAACAAGAAGAAGAACAGTACAACTACTGGCAATGAAAATGACACGACTGCTACTACTACTCCGTGCTGCAGCAAAGTTGGGTTGAAGAGAGGGCCATGGACACCGGAGGAAGACGAGGTGTTGGCCAGTTTCATAAGGAAAGAAGGCGAAGGTCGCTGGAGAACGCTTCCAAAAAGAGCCGGCCTCCTCCGCTGCGGTAAGAGCTGCCGCCTCCGCTGGATGAACTACCTCCGCCCCTCCGTCAAACGCGGCCAGATCGCCCCCGACGAGGAAGATCTCATCCTCCGACTTCACCGCCTCCTCGGCAACCGGTACCTCTTCTCCTCGATCGATCTTCCTTTT ATCTAGCTTAGGGTTTGCTACGAACTTTGCTTAACTAATTAAATAATTTTAAATAAACATATATATATATAGCTAG GGCTTGATTTAATTACACTTTATTTAATTACCATTTCATCAATCATGTTTAGGATATAGTACAACAATTCATTTTG AAACTAACATTAATTCTAGCAAGAAGCTTTCTTAAATAGCTTCTGGGTGTTAAAATTGATTCTGATGTTACATTTA CAGGTGGTCTTTGATAGCGGGAAGAATTCCGGGAAGAACTGATAATGAGATAAAGAACTTCTGGAACACCCATCTCAGCAAGAAGCTTATCAGCCAAGGGATTGATCCAAGAACCCACAAGCCTCTCAACCCAGAACTATCTATTCCCTCTTCTTCCACTACTCCACCACCACCACCACCTTCCAAGCCTCTTCCTGTGATCACAAATCACCAAACACTTCATGAAACTACTACTCATCATCATCTCAATATTGCTAGTGTCAACCAAGAATGTGATGAGGGTCAATATCAATATCAACAACCTCAAGCAGTAGCTGCTGCTGCATATATGGTAGCTAATGATATTCCTGATGATGTTCCTTCCATGGATCATCTACTTGCCAACAACAACAACAACCAGGACTACAATGATATCAATTATTGTTCTGATGATATCTTTTCTTCCTTCCTCAATTCTCTGATCAATGAGGATGCGTTCTCTGCCCAGCGCCACCTGCAATCGGAGCATCATGATGACCTTGCACAGGATCCTGTTACTTCATCAACACCACAAGGTTATAATGGCATTGGTGTTGCATGGGAATTGCCCCTCATGCCTGCTAATTTCAGCCAAAATGAACACAGCCATGAGGTTGATGATCATCACAAATAG(SEQ ID No：6)。
LcMYB5E：
ATGAGGAACCCGATAGCATCATCATCAACGAACAAGAAGAAGAACAGTACAACTACTGGCAATGAAAATGGCACGACTGCTACTACTACTCCGTGCTGCAGCAAAGTTGGGTTGAAGAGAGGGCCATGGACACCGGAGGAAGACGAGGTGTTGGCCAGTTTCATAAGGAAAGAAGGCGAAGGTCGCTGGAGAACGCTTCCAAAAAGAGCCGGCCTCCTCCGCTGCGGTAAGAGCTGCCGCCTCCGCTGGATGAACTACCTCCGCCCCTCCGTCAAACGCGGCCAGATCGCCCCCGACGAGGAAGATCTCATCCTCCGCCTTCACCGCCTCCTCGGCAACCGGTACCTCCTCTCCTCGATCGATCTTCCTTTT ATCTAGCTTAGGGTTTTCTACGAACTTTGCTTAACTAATTAATTAATTTTAAATAAACATATATATATAGCTAGGG CTTGATTTAATTACACTTTATTTAATTACACTTTCATCAATCATGTTTAGGATACAGTACAACAATTCATTTTGAA ACTAACATTAATTCTAGCAAGAAGCTTTCTTAAATAGCTTCTGGGTGTTAAAATTGATTTTGATGTTACAGGTGGTCTTTGATAGCGGGAAGAATTCCGGGAAGAACTGATAATGAGATAAAGAACTTCTGGAACACCCATCTCAGCAAGAAGCTTATCAGCCAAGGGATTGATCCAAGAACCCACAAGCCTCTCAACCCAGAACTATCTATTCCCTCTTCTTCCACTACTCCACCACCACCACCACCTTCCAAGCCTCTTCCTGTGATCACAAATCACCAAACACTTCATGAAACTACTACTCATCATCATCTCAATATTGCTAGTGTCAACCAAGAATGTGATGAGGGTCAATATCAATATCAACAACCTCAAGCAGTAGCTGCTGCTGCATATATGGTAGCTAATGATATTCCTGATGATGATATTCCTTCCATGGATCATCTACTTGCCAACAACAACAACAACAACCAGGACTACAATGATATCAATTATTGTTCTGATGATATCTTTTCTTCCTTCCTCAATTCTCTGATCAATGAGGATGCGTTCTCTGCCCAGCGCCACCTGCAATCGGAGCATCATGATGACCTTGCACAGGATCCTGTTACTTCATCAACACCACAAGGTTATAATGGCATTGGTGTTGCATGGGAATTGCCCCTCATGCCTGCTAATTTCAGCCAAAATGAACACAGCCATGAGGTTGATGATCATCACAAATAG(SEQ IDNo：7)。
LcMYB5F：
ATGAGGAACCCGATAGCATCATCATCAACGAACAAGAAGAAGAACAGTACAACTACTGGCAATGAAAATGGCACGACTGCTACTACTACTCCGTGCTGCAGCAAAGTTGGGTTGAAGAGAGGGCCATGGACACCGGAGGAAGACGAGGTGTTGGCCAGTTTCATAAGGAAAGAAGGCGAAGGTCGCTGGAGAACGCTTCCAAAAAGAGCCGGCCTCCTCCGCTGCGGTAAGAGCTGCCGCCTCCGCTGGATGAACTACCTCCGCCCCTCCGTCAAACGCGGCCAGATCGCCCCCGACGAGGAAGATCTCATCCTCCGACTTCACCGCCTCCTCGGCAACCGGTACCTCTTCTCCTCGATCGATCTTCCTTTT ATCTAGCTTAGGGTTTGCTACGAACTTTGCTTAACTAATTAATTAATTTTAAATAAACATATATATATAGCTAGGG CTTGATTTAATTACACTTTATTTAATTACCATTTCATCAATCATGTTTAGGATATAGTACAACAATTCATTTTGAA ACTAACATTAATTCTAGCAAGAAGCTTTCTTAAATAGCTTCTGGGTGTTAAAATTGATTCTGATGTTACATTTACA GGTGGTCTTTGATAGCGGGAAGAATTCCGGGAAGAACTGATAATGAGATAAAGAACTTCTGGAACACCCATCTCAGCAAGAAGCTTATCAGCCAAGGGATTGATCCAAGAACCCACAAGCCTCTCAACCCAGAACTATCTATTCCCTCTTCTTCCACTACTCCACCACCACCACCACCTTCCAAGCCTGTTCCTGTGATCACAAATCACCAAACACTTCATGAAACTACTACTCATCATCATCTCAATATTGCTAGTGTCAACCAAGAATGTGATGAGGGTCAATATCAATATCAACAACCTCAAGCAGTAGCTGCTGCTGCATATATGGTAGCTAATGATATTCCTGATGATGTTCCTTCCATGGATCATCTACTTGCCAACAACAACAACAACCAGGACTACAATGATATCAATTATTGTTCTGATGATATCTTTTCTTCCTTCCTCAATTCTCTGATCAATGAGGATGCGTTCTCTGCCCATCGCCACCTGCAATCGGAGCATCATGATGACCTTGCACAGGATCCTGTTACTTCATCAACACCACAAGGTTATAATGGCATTGGTGTTGCATGGGAATTGCCCCTCATGCCTGCTAATTTCAGCCAAAATGAACACAGCCATGAGGTTGATGATCATCACAAATAG(SEQ ID No：8)。
Transcripts of LcMYB5A-LcMYB5F were further found, named LcMYB5A, lcMYB5b, lcMYB5c, lcMYB5d, lcMYB5e and LcMYB5F, respectively. The protein sequences encoded by these 6 transcripts are also highly similar and highly homologous to the protein sequence of LjMYB5, differing in amino acids at a total of only 10 positions. Wherein LcMYB5a is most similar to LjMYB5, and only 2 positions are different; while lcmeyb 5b is least similar to LjMYB5, with 6 sites being different. The most similar and least similar are chosen as representatives, and therefore lcmeb 5a and lcmeb 5b are chosen as subjects. The protein sequences they encode were highly similar, so LcMYB5a and LcMYB5b were selected for further investigation.
Wherein, the nucleotide sequence of LcMYB5a is shown in SEQ ID No:9, the amino acid sequence of which is shown as SEQ ID No: 15; the nucleotide sequence of LcMYB5b is shown as SEQ ID No:10, the amino acid sequence of which is shown as SEQ ID No: shown at 16; the nucleotide sequence of LcMYB5c is shown as SEQ ID No:11, the amino acid sequence of which is shown as SEQ ID No: shown at 17; the nucleotide sequence of LcMYB5d is shown as SEQ ID No:12, the amino acid sequence of which is shown as SEQ ID No: shown at 18; the nucleotide sequence of LcMYB5e is shown as SEQ ID No:13, the amino acid sequence of which is shown in SEQ ID No: 19; the nucleotide sequence of LcMYB5f is shown as SEQ ID No:14, the amino acid sequence of which is shown in SEQ ID No: shown at 20.
The LcMYB5a and LcMYB5b genes are further subjected to stop codon removal, and the genes are cloned between enzyme cleavage sites Nco1 and Spe1 of the pCAMBIA 1302 vector respectively by a seamless cloning method. The obtained positive clone is transferred into agrobacterium GV3101 strain after being verified by gene sequencing. Tobacco leaves grown for 4 weeks were respectively injected with either the bacterial liquid of GV3101 of lcmeb 5a or the bacterial liquid of GV3101 of lcmeb 5b, and after 36-48 hours of greenhouse culture, the distribution positions of GFP fluorescence were observed using a laser confocal microscope, as shown in fig. 6, confirming that both proteins of lcmeb 5a and lcmeb 5b were localized in the nuclei.
The specific steps of the transcriptional activity analysis experiment include: constructing corresponding effector vector. The obtained positive clone is subjected to gene sequencing and verification, and plasmids without endotoxin are extracted; protoplasts were isolated from Arabidopsis leaves grown for 4 weeks, and the reporter plasmids and plasmids GAL4DB, GAL4DB-LcMYB5a, GAL4DB-LcMYB5b were transferred into protoplasts, respectively, using the PEG-mediated method, and placed in an incubator at 25℃overnight for light-shielding cultivation. The enzyme activity of each sample was quantitatively analyzed by using a dual luciferase reporter system from promega company, as shown in fig. 7, and the results of fig. 7 indicate that lcmeb 5a and lcmeb 5b both have transcriptional activation, and the biosynthesis of tannins was positively regulated by activating the related gene expression in the tannin synthesis pathway.
In order to further analyze the biological functions of lcmeb 5a and lcmeb 5b, lcmeb 5a and lcmeb 5b genes were cloned into entry vector pENTR, respectively, and the obtained positive clones were confirmed by gene sequencing and LR reactions were entered into pB2GW7 vector. Then transferred into the Agrobacterium ARqual1 strain. The bacterial liquid of ARqual1 of LcMYB5a or the bacterial liquid of ARqual1 of LcMYB5b are used for respectively infecting the Baimaigen seedlings, and the over-expression transgenic materials of the Baimaigen seedlings are obtained. Quantitative analysis of the tannin content revealed that the content of both soluble tannin and insoluble tannin in the overexpressed material was greatly increased, 2-fold higher than that of the control, as shown in fig. 8. While none of the other flavonoids, such as flavonols and anthocyanins, were significantly altered, as shown in figures 9 and 10. These results indicate that lcmeb 5a and lcmeb 5b specifically upregulate tannin biosynthesis.
Total RNA was extracted using the RNA extraction kit from Promega, and cDNA was synthesized using the One-Step gDNA removal and cDNA synthesis kit from Whole gold company. Gene expression level analysis was performed on an ABI 7500real-time Detection System (Applied Biosystems, USA) instrument using a 2X RealStar Green Fast Mixture (GeneStar, shanghai, china) reagent. By transcriptome sequencing analysis and real-time quantitative PCR analysis, specific PCR procedures were as follows: pre-denaturation at 95℃for 2min,40 cycles (denaturation at 95℃for 15s, annealing at 60℃for 30s, extension at 72℃for 30 s). The results are shown in fig. 11, and the results of fig. 11 reveal the molecular mechanism of lcmeb 5a and lcmeb 5b upregulating tannins. In the LcMYB5a and LcMYB5b overexpressing plant material, the expression levels of the 12 genes (LjCHS-1, ljCHS-2, ljF H-1, ljLAR, ljANR, ljTT, ljTT9, ljTT8L1, ljTTG2, ljTTG1L1 and LjTTG1L 2) closely related to tannin synthesis were 3.2 times higher than the control; these results indicate that lcmeb 5 greatly increases tannin biosynthesis by activating the expression of these 12 genes by transcription.
The hundred-pulse root LcMYB5 gene and the application thereof provided by the invention are described in detail. The principles and embodiments of the present invention have been described herein with reference to specific examples, the description of which is intended only to facilitate an understanding of the method of the present invention and its core ideas. It should be noted that it will be apparent to those skilled in the art that various modifications and adaptations of the invention can be made without departing from the principles of the invention and these modifications and adaptations are intended to be within the scope of the invention as defined in the following claims.
Sequence listing
<110> Beijing livestock veterinary research institute of China agricultural sciences
<120> one hundred vein root LcMYB5 gene and its application
<130> CNP210012
<160> 20
<170> SIPOSequenceListing 1.0
<210> 1
<211> 993
<212> DNA
<213> Lotus corniculatus
<400> 1
atgaggaacc cgatagcatc atcatcaacg aacaagaaga agagcagtac tacaactggt 60
aatgaaaatg gcacgactgt tactactact ccgtgctgca gcaaagttgg gttgaagaga 120
gggccatgga caccggagga agacgaggtg ttggccagtt tcataaggaa agaaggcgaa 180
ggtcgctgga gaacgcttcc aaaaagagcc ggcctcctcc gctgcggtaa gagctgccgc 240
ctccgctgga tgaactacct ccgcccctct gtcaaacgcg gccagatcgc ccccgacgaa 300
gaagatctca tcctccgcct tcaccgcctc ctcggcaacc ggtggtcttt gatagcggga 360
agaattccgg gaagaactga taatgagata aagaacttct ggaacaccca tctcagcaag 420
aagcttatca gccaagggat tgatccaaga acccacaagc ctctcaaccc agaactatct 480
attccctctt cttccactac tccaccacca ccaccacctt ccaagcctct tcctgtgatc 540
acaaatcacc aaacacttca tgaaactact actcatcatc atctcaatat tgctagtgtc 600
aaccaagaat gtgatgaggg tcaatatcaa tatcaacaac ctcaagcagt agctgctgct 660
gcatatatgg tagctaatga tattcctgat gatgatgttc cttccatggg tcatctactt 720
gccaacaaca acaacaacca ggactacaat gatatcaatt attgttctga tgatatcttt 780
tcttccttcc tcaattctct gatcaatgag gatgctttct ctgcccagcg ccacctgcaa 840
tcggagcatc atgatgacct tgcacaggat cctgtaactt catcaacacc acaaggttat 900
aatggcattg gtgttgcatg ggaattgccc ctcatgcctg ctaatttcag ccaaaatgaa 960
cacagccatg aggttgatga tcatcacaaa tag 993
<210> 2
<211> 330
<212> PRT
<213> Lotus corniculatus
<400> 2
Met Arg Asn Pro Ile Ala Ser Ser Ser Thr Asn Lys Lys Lys Ser Ser
1 5 10 15
Thr Thr Thr Gly Asn Glu Asn Gly Thr Thr Val Thr Thr Thr Pro Cys
20 25 30
Cys Ser Lys Val Gly Leu Lys Arg Gly Pro Trp Thr Pro Glu Glu Asp
35 40 45
Glu Val Leu Ala Ser Phe Ile Arg Lys Glu Gly Glu Gly Arg Trp Arg
50 55 60
Thr Leu Pro Lys Arg Ala Gly Leu Leu Arg Cys Gly Lys Ser Cys Arg
65 70 75 80
Leu Arg Trp Met Asn Tyr Leu Arg Pro Ser Val Lys Arg Gly Gln Ile
85 90 95
Ala Pro Asp Glu Glu Asp Leu Ile Leu Arg Leu His Arg Leu Leu Gly
100 105 110
Asn Arg Trp Ser Leu Ile Ala Gly Arg Ile Pro Gly Arg Thr Asp Asn
115 120 125
Glu Ile Lys Asn Phe Trp Asn Thr His Leu Ser Lys Lys Leu Ile Ser
130 135 140
Gln Gly Ile Asp Pro Arg Thr His Lys Pro Leu Asn Pro Glu Leu Ser
145 150 155 160
Ile Pro Ser Ser Ser Thr Thr Pro Pro Pro Pro Pro Pro Ser Lys Pro
165 170 175
Leu Pro Val Ile Thr Asn His Gln Thr Leu His Glu Thr Thr Thr His
180 185 190
His His Leu Asn Ile Ala Ser Val Asn Gln Glu Cys Asp Glu Gly Gln
195 200 205
Tyr Gln Tyr Gln Gln Pro Gln Ala Val Ala Ala Ala Ala Tyr Met Val
210 215 220
Ala Asn Asp Ile Pro Asp Asp Asp Val Pro Ser Met Gly His Leu Leu
225 230 235 240
Ala Asn Asn Asn Asn Asn Gln Asp Tyr Asn Asp Ile Asn Tyr Cys Ser
245 250 255
Asp Asp Ile Phe Ser Ser Phe Leu Asn Ser Leu Ile Asn Glu Asp Ala
260 265 270
Phe Ser Ala Gln Arg His Leu Gln Ser Glu His His Asp Asp Leu Ala
275 280 285
Gln Asp Pro Val Thr Ser Ser Thr Pro Gln Gly Tyr Asn Gly Ile Gly
290 295 300
Val Ala Trp Glu Leu Pro Leu Met Pro Ala Asn Phe Ser Gln Asn Glu
305 310 315 320
His Ser His Glu Val Asp Asp His His Lys
325 330
<210> 3
<211> 1250
<212> DNA
<213> Lotus corniculatus
<400> 3
atgaggaacc cgatagcatc atcatcaacg aacaagaaga agagcagtac tacaactggt 60
aatgaaaatg gcacgactgt tactactact ccgtgctgca gcaaagttgg gttgaagaga 120
gggccatgga caccggagga agacgaggtg ttggccagtt tcataaggaa agaaggcgaa 180
ggtcgctgga gaacgcttcc aaaaagagcc ggcctcctcc gctgcggtaa gagctgccgc 240
ctccgctgga tgaactacct ccgcccctcc gtcaaacgcg gccagatcgc ccccgacgag 300
gaagatctca tcctccgcct tcaccgcctc ctcggcaacc ggtacctctt ctcctcgatc 360
gatcttcctt ttatctagct tagggtttgc tacgaacttt gcttaactaa ttaattaatt 420
ttaaataaac atatatatat agctagggct tgatttaatt acactttatt taattaccat 480
ttcatcaatc atgtttagga tatagtacaa caattcattt tgaaactaac attaattcta 540
gcaagaagct ttcttaaata gcttctgggt gttaaaattg attctgatgt tacatttaca 600
ggtggtcttt gatagcggga agaattccgg gaagaactga taatgagata aagaacttct 660
ggaacaccca tctcagcaag aagcttatca gccaagggat tgatccaaga acccacaagc 720
ctctcaaccc agaactatct attccctctt cttccactac tccaccacca ccaccacctt 780
ccaagcctct tcctgtgatc acaaatcacc aaacacttca tgaaactact actcatcatc 840
atctcaatat tgctagtgtc aaccaagaat gtgatgaggg tcaatatcaa tatcaacaac 900
ctcaagcagt agctgctgct gcatatatgg tagctaatga tattcctgat gatgttcctt 960
ccatggatca tctacttgcc aacaacaaca acaaccagga ctacaatgat atcaattatt 1020
gttctgatga tatcttttct tccttcctca attctctgat caatgaggat gcgttctctg 1080
cccagcgcca cctgcaatcg gagcatcatg atgaccttgc acaggatcct gttacttcat 1140
caacaccaca aggttataat ggcattggtg ttgcatggga attgcccctc atgcctgcta 1200
atttcagcca aaatgaacac agccatgagg ttgatgatca tcacaaatag 1250
<210> 4
<211> 1245
<212> DNA
<213> Lotus corniculatus
<400> 4
atgaggaacc cgatagcatc atcatcaacg aacaagaaga agaacagtac aactactggc 60
aatgaaaatg gcacgactgc tactactact ccgtgctgca gcaaagttgg gttgaagaga 120
gggccatgga caccggagga agacgaggtg ttggccagtt tcataaggaa agaaggcgaa 180
ggtcgctgga gaacgcttcc aaaaagagcc ggcctcctcc gctgcggtaa gagctgccgc 240
ctccgctgga tgaactacct ccgcccctcc gtcaaacgcg gccagatcgc ccccgacgag 300
gaagatctca tcctccgcct tcaccgcctc ctcggcaacc ggtacctcct ctcctcgatc 360
gatctccctt ttatctagct tagggtttgc tacgaacttt gcttaactaa ttaattaatt 420
ttaaataaac atatatatat atatagctag ggcttgattt aattaccatt tcatcaatca 480
tgtttaggat atagtacaac aattcatttt gaaactaaca ttaattctag caagaagctt 540
tcttaaatag cttctgggtg ttaaaattga ttctgatgat tctgatgtta caggtggtct 600
ttgatagcgg gaagaattcc gggaagaact gataatgaga taaagaactt ctggaacacc 660
catctcagca agaagcttat cagccaaggg attgatccaa gaacccacaa gcctctcaac 720
ccagaactat ctattccctc ttcttccact actccaccac caccaccttc caagcctctt 780
cctgtgatca caaatcacca aacacttcat gaaactacta ctcatcatca tctcaatatt 840
gctagtgtca accaagaatg tgatgagggt caatatcaat atcaacaacc tcaagcagta 900
gctgctgctg catatatggt agctaatgat attcctgatg atgatattcc ttccatggat 960
catctacttg ccaacaacaa caacaacaac caggactaca atgatatcaa ttattgttct 1020
gatgatatct tttcttcctt cctcaattct ctgatcaatg aggatgcgtt ctctgcccag 1080
cgccacctgc aatcggagca tcatgatgac cttgcacagg atcctgttac ttcatcaaca 1140
ccacaaggtt ataatggcat tggtgttgca tgggaattgc ccctcatgcc tgctaatttc 1200
agccaaaatg aacacagcca tgaggttgat gatcatcaca aatag 1245
<210> 5
<211> 1252
<212> DNA
<213> Lotus corniculatus
<400> 5
atgaggaacc cgatagcatc atcatcaacg aacaagaaga agaacagtac aactactggc 60
aatgaaaatg acacgactgc tactactact ccgtgctgca gcaaagttgg gttgaagaga 120
gggccatgga caccggagga agacgaggtg ttggccagtt tcataaggaa agaaggcgaa 180
ggtcgctgga gaacgcttcc aaaaagagcc ggcctcctcc gctgcggtaa gagctgccgc 240
ctccgctgga tgaactacct ccgcccctcc gtcaaacgcg gccagatcgc ccccgacgag 300
gaagatctca tcctccgcct tcaccgcctc ctcggcaacc ggtacctctt ctcctcgatc 360
gatcttcctt ttatctagct tagggtttgc tacgaacttt gcttaactaa ttaaataatt 420
ttaaataaac atatatatat atagctaggg cttgatttaa ttacacttta tttaattacc 480
atttcatcaa tcatgtttag gatatagtac aacaattcat tttgaaacta acattaattc 540
tagcaagaag ctttcttaaa tagcttctgg gtgttaaaat tgattctgat gttacattta 600
caggtggtct ttgatagcgg gaagaattcc gggaagaact gataatgaga taaagaactt 660
ctggaacacc catctcagca agaagcttat cagccaaggg attgatccaa gaacccacaa 720
gcctctcaac ccagaactat ctattccctc ttcttccact actccaccac caccaccacc 780
ttccaagcct cttcctgtga tcacaaatca ccaaacactt catgaaacta ctactcatca 840
tcatctcaat attgctagtg tcaaccaaga atgtgatgag ggtcaatatc acctcaagca 900
gtagctgctg ctgcatatat ggtagctaat gatattcctg atgatgttcc ttccatggat 960
catctacttg ccaacaacaa caacaaccag gactacaatg atatcaatta ttgttctgat 1020
gatatctttt cttccttcct caattctctg atcaatgagg atgcgttctc tgcccagcgc 1080
cacctgcaat cggagcatca tgatgacctt gcacaggatc ctgaatatca acattacttc 1140
atcaacacca caaggttata atggcattgg tgttgcatgg gaattgcccc tcatgcctgc 1200
taatttcagc caaaatgaac acagccatga ggttgatgat catcacaaat ag 1252
<210> 6
<211> 1252
<212> DNA
<213> Lotus corniculatus
<400> 6
atgaggaacc cgatagcatc atcatcaacg aacaagaaga agaacagtac aactactggc 60
aatgaaaatg acacgactgc tactactact ccgtgctgca gcaaagttgg gttgaagaga 120
gggccatgga caccggagga agacgaggtg ttggccagtt tcataaggaa agaaggcgaa 180
ggtcgctgga gaacgcttcc aaaaagagcc ggcctcctcc gctgcggtaa gagctgccgc 240
ctccgctgga tgaactacct ccgcccctcc gtcaaacgcg gccagatcgc ccccgacgag 300
gaagatctca tcctccgact tcaccgcctc ctcggcaacc ggtacctctt ctcctcgatc 360
gatcttcctt ttatctagct tagggtttgc tacgaacttt gcttaactaa ttaaataatt 420
ttaaataaac atatatatat atagctaggg cttgatttaa ttacacttta tttaattacc 480
atttcatcaa tcatgtttag gatatagtac aacaattcat tttgaaacta acattaattc 540
tagcaagaag ctttcttaaa tagcttctgg gtgttaaaat tgattctgat gttacattta 600
caggtggtct ttgatagcgg gaagaattcc gggaagaact gataatgaga taaagaactt 660
ctggaacacc catctcagca agaagcttat cagccaaggg attgatccaa gaacccacaa 720
gcctctcaac ccagaactat ctattccctc ttcttccact actccaccac caccaccacc 780
ttccaagcct cttcctgtga tcacaaatca ccaaacactt catgaaacta ctactcatca 840
tcatctcaat attgctagtg tcaaccaaga atgtgatgag ggtcaatatc aatatcaaca 900
acctcaagca gtagctgctg ctgcatatat ggtagctaat gatattcctg atgatgttcc 960
ttccatggat catctacttg ccaacaacaa caacaaccag gactacaatg atatcaatta 1020
ttgttctgat gatatctttt cttccttcct caattctctg atcaatgagg atgcgttctc 1080
tgcccagcgc cacctgcaat cggagcatca tgatgacctt gcacaggatc ctgttacttc 1140
atcaacacca caaggttata atggcattgg tgttgcatgg gaattgcccc tcatgcctgc 1200
taatttcagc caaaatgaac acagccatga ggttgatgat catcacaaat ag 1252
<210> 7
<211> 1250
<212> DNA
<213> Lotus corniculatus
<400> 7
atgaggaacc cgatagcatc atcatcaacg aacaagaaga agaacagtac aactactggc 60
aatgaaaatg gcacgactgc tactactact ccgtgctgca gcaaagttgg gttgaagaga 120
gggccatgga caccggagga agacgaggtg ttggccagtt tcataaggaa agaaggcgaa 180
ggtcgctgga gaacgcttcc aaaaagagcc ggcctcctcc gctgcggtaa gagctgccgc 240
ctccgctgga tgaactacct ccgcccctcc gtcaaacgcg gccagatcgc ccccgacgag 300
gaagatctca tcctccgcct tcaccgcctc ctcggcaacc ggtacctcct ctcctcgatc 360
gatcttcctt ttatctagct tagggttttc tacgaacttt gcttaactaa ttaattaatt 420
ttaaataaac atatatatat agctagggct tgatttaatt acactttatt taattacact 480
ttcatcaatc atgtttagga tacagtacaa caattcattt tgaaactaac attaattcta 540
gcaagaagct ttcttaaata gcttctgggt gttaaaattg attttgatgt tacaggtggt 600
ctttgatagc gggaagaatt ccgggaagaa ctgataatga gataaagaac ttctggaaca 660
cccatctcag caagaagctt atcagccaag ggattgatcc aagaacccac aagcctctca 720
acccagaact atctattccc tcttcttcca ctactccacc accaccacca ccttccaagc 780
ctcttcctgt gatcacaaat caccaaacac ttcatgaaac tactactcat catcatctca 840
atattgctag tgtcaaccaa gaatgtgatg agggtcaata tcaatatcaa caacctcaag 900
cagtagctgc tgctgcatat atggtagcta atgatattcc tgatgatgat attccttcca 960
tggatcatct acttgccaac aacaacaaca acaaccagga ctacaatgat atcaattatt 1020
gttctgatga tatcttttct tccttcctca attctctgat caatgaggat gcgttctctg 1080
cccagcgcca cctgcaatcg gagcatcatg atgaccttgc acaggatcct gttacttcat 1140
caacaccaca aggttataat ggcattggtg ttgcatggga attgcccctc atgcctgcta 1200
atttcagcca aaatgaacac agccatgagg ttgatgatca tcacaaatag 1250
<210> 8
<211> 1250
<212> DNA
<213> Lotus corniculatus
<400> 8
atgaggaacc cgatagcatc atcatcaacg aacaagaaga agaacagtac aactactggc 60
aatgaaaatg gcacgactgc tactactact ccgtgctgca gcaaagttgg gttgaagaga 120
gggccatgga caccggagga agacgaggtg ttggccagtt tcataaggaa agaaggcgaa 180
ggtcgctgga gaacgcttcc aaaaagagcc ggcctcctcc gctgcggtaa gagctgccgc 240
ctccgctgga tgaactacct ccgcccctcc gtcaaacgcg gccagatcgc ccccgacgag 300
gaagatctca tcctccgact tcaccgcctc ctcggcaacc ggtacctctt ctcctcgatc 360
gatcttcctt ttatctagct tagggtttgc tacgaacttt gcttaactaa ttaattaatt 420
ttaaataaac atatatatat agctagggct tgatttaatt acactttatt taattaccat 480
ttcatcaatc atgtttagga tatagtacaa caattcattt tgaaactaac attaattcta 540
gcaagaagct ttcttaaata gcttctgggt gttaaaattg attctgatgt tacatttaca 600
ggtggtcttt gatagcggga agaattccgg gaagaactga taatgagata aagaacttct 660
ggaacaccca tctcagcaag aagcttatca gccaagggat tgatccaaga acccacaagc 720
ctctcaaccc agaactatct attccctctt cttccactac tccaccacca ccaccacctt 780
ccaagcctgt tcctgtgatc acaaatcacc aaacacttca tgaaactact actcatcatc 840
atctcaatat tgctagtgtc aaccaagaat gtgatgaggg tcaatatcaa tatcaacaac 900
ctcaagcagt agctgctgct gcatatatgg tagctaatga tattcctgat gatgttcctt 960
ccatggatca tctacttgcc aacaacaaca acaaccagga ctacaatgat atcaattatt 1020
gttctgatga tatcttttct tccttcctca attctctgat caatgaggat gcgttctctg 1080
cccatcgcca cctgcaatcg gagcatcatg atgaccttgc acaggatcct gttacttcat 1140
caacaccaca aggttataat ggcattggtg ttgcatggga attgcccctc atgcctgcta 1200
atttcagcca aaatgaacac agccatgagg ttgatgatca tcacaaatag 1250
<210> 9
<211> 990
<212> DNA
<213> Lotus corniculatus
<400> 9
atgaggaacc cgatagcatc atcatcaacg aacaagaaga agagcagtac tacaactggt 60
aatgaaaatg gcacgactgt tactactact ccgtgctgca gcaaagttgg gttgaagaga 120
gggccatgga caccggagga agacgaggtg ttggccagtt tcataaggaa agaaggcgaa 180
ggtcgctgga gaacgcttcc aaaaagagcc ggcctcctcc gctgcggtaa gagctgccgc 240
ctccgctgga tgaactacct ccgcccctcc gtcaaacgcg gccagatcgc ccccgacgag 300
gaagatctca tcctccgcct tcaccgcctc ctcggcaacc ggtggtcttt gatagcggga 360
agaattccgg gaagaactga taatgagata aagaacttct ggaacaccca tctcagcaag 420
aagcttatca gccaagggat tgatccaaga acccacaagc ctctcaaccc agaactatct 480
attccctctt cttccactac tccaccacca ccaccacctt ccaagcctct tcctgtgatc 540
acaaatcacc aaacacttca tgaaactact actcatcatc atctcaatat tgctagtgtc 600
aaccaagaat gtgatgaggg tcaatatcaa tatcaacaac ctcaagcagt agctgctgct 660
gcatatatgg tagctaatga tattcctgat gatgttcctt ccatggatca tctacttgcc 720
aacaacaaca acaaccagga ctacaatgat atcaattatt gttctgatga tatcttttct 780
tccttcctca attctctgat caatgaggat gcgttctctg cccagcgcca cctgcaatcg 840
gagcatcatg atgaccttgc acaggatcct gttacttcat caacaccaca aggttataat 900
ggcattggtg ttgcatggga attgcccctc atgcctgcta atttcagcca aaatgaacac 960
agccatgagg ttgatgatca tcacaaatag 990
<210> 10
<211> 993
<212> DNA
<213> Lotus corniculatus
<400> 10
atgaggaacc cgatagcatc atcatcaacg aacaagaaga agaacagtac aactactggc 60
aatgaaaatg gcacgactgc tactactact ccgtgctgca gcaaagttgg gttgaagaga 120
gggccatgga caccggagga agacgaggtg ttggccagtt tcataaggaa agaaggcgaa 180
ggtcgctgga gaacgcttcc aaaaagagcc ggcctcctcc gctgcggtaa gagctgccgc 240
ctccgctgga tgaactacct ccgcccctcc gtcaaacgcg gccagatcgc ccccgacgag 300
gaagatctca tcctccgcct tcaccgcctc ctcggcaacc ggtggtcttt gatagcggga 360
agaattccgg gaagaactga taatgagata aagaacttct ggaacaccca tctcagcaag 420
aagcttatca gccaagggat tgatccaaga acccacaagc ctctcaaccc agaactatct 480
attccctctt cttccactac tccaccacca ccaccttcca agcctcttcc tgtgatcaca 540
aatcaccaaa cacttcatga aactactact catcatcatc tcaatattgc tagtgtcaac 600
caagaatgtg atgagggtca atatcaatat caacaacctc aagcagtagc tgctgctgca 660
tatatggtag ctaatgatat tcctgatgat gatattcctt ccatggatca tctacttgcc 720
aacaacaaca acaacaacca ggactacaat gatatcaatt attgttctga tgatatcttt 780
tcttccttcc tcaattctct gatcaatgag gatgcgttct ctgcccagcg ccacctgcaa 840
tcggagcatc atgatgacct tgcacaggat cctgttactt catcaacacc acaaggttat 900
aatggcattg gtgttgcatg ggaattgccc ctcatgcctg ctaatttcag ccaaaatgaa 960
cacagccatg aggttgatga tcatcacaaa tag 993
<210> 11
<211> 960
<212> DNA
<213> Lotus corniculatus
<400> 11
atgaggaacc cgatagcatc atcatcaacg aacaagaaga agaacagtac aactactggc 60
aatgaaaatg acacgactgc tactactact ccgtgctgca gcaaagttgg gttgaagaga 120
gggccatgga caccggagga agacgaggtg ttggccagtt tcataaggaa agaaggcgaa 180
ggtcgctgga gaacgcttcc aaaaagagcc ggcctcctcc gctgcggtaa gagctgccgc 240
ctccgctgga tgaactacct ccgcccctcc gtcaaacgcg gccagatcgc ccccgacgag 300
gaagatctca tcctccgcct tcaccgcctc ctcggcaacc ggtggtcttt gatagcggga 360
agaattccgg gaagaactga taatgagata aagaacttct ggaacaccca tctcagcaag 420
aagcttatca gccaagggat tgatccaaga acccacaagc ctctcaaccc agaactatct 480
attccctctt cttccactac tccaccacca ccaccacctt ccaagcctct tcctgtgatc 540
acaaatcacc aaacacttca tgaaactact actcatcatc atctcaatat tgctagtgtc 600
aaccaagaat gtgatgaggg tcaatatcaa tatcaacaac ctcaagcagt agctgctgct 660
gcatatatgg tagctaatga tattcctgat gatgttcctt ccatggatca tctacttgcc 720
aacaacaaca acaaccagga ctacaatgat atcaattatt gttctgatga tatcttttct 780
tccttcctca attctctgat caatgaggat gcgttctctg cccagcgcca cctgcaatcg 840
gagcatcatg atgaccttgc acaggatcct gttacttcat caacaccaca aggttataat 900
ggcattggtg ttgcatggga attgcccctc atgcctgcta atttcagcca aaatgaacac 960
agccatgagg ttgatgatca tcacaaatag 990
<210> 12
<211> 960
<212> DNA
<213> Lotus corniculatus
<400> 12
atgaggaacc cgatagcatc atcatcaacg aacaagaaga agaacagtac aactactggc 60
aatgaaaatg acacgactgc tactactact ccgtgctgca gcaaagttgg gttgaagaga 120
gggccatgga caccggagga agacgaggtg ttggccagtt tcataaggaa agaaggcgaa 180
ggtcgctgga gaacgcttcc aaaaagagcc ggcctcctcc gctgcggtaa gagctgccgc 240
ctccgctgga tgaactacct ccgcccctcc gtcaaacgcg gccagatcgc ccccgacgag 300
gaagatctca tcctccgact tcaccgcctc ctcggcaacc ggtggtcttt gatagcggga 360
agaattccgg gaagaactga taatgagata aagaacttct ggaacaccca tctcagcaag 420
aagcttatca gccaagggat tgatccaaga acccacaagc ctctcaaccc agaactatct 480
attccctctt cttccactac tccaccacca ccaccacctt ccaagcctct tcctgtgatc 540
acaaatcacc aaacacttca tgaaactact actcatcatc atctcaatat tgctagtgtc 600
aaccaagaat gtgatgaggg tcaatatcaa tatcaacaac ctcaagcagt agctgctgct 660
gcatatatgg tagctaatga tattcctgat gatgttcctt ccatggatca tctacttgcc 720
aacaacaaca acaaccagga ctacaatgat atcaattatt gttctgatga tatcttttct 780
tccttcctca attctctgat caatgaggat gcgttctctg cccagcgcca cctgcaatcg 840
gagcatcatg atgaccttgc acaggatcct gttacttcat caacaccaca aggttataat 900
ggcattggtg ttgcatggga attgcccctc atgcctgcta atttcagcca aaatgaacac 960
agccatgagg ttgatgatca tcacaaatag 990
<210> 13
<211> 996
<212> DNA
<213> Lotus corniculatus
<400> 13
atgaggaacc cgatagcatc atcatcaacg aacaagaaga agaacagtac aactactggc 60
aatgaaaatg gcacgactgc tactactact ccgtgctgca gcaaagttgg gttgaagaga 120
gggccatgga caccggagga agacgaggtg ttggccagtt tcataaggaa agaaggcgaa 180
ggtcgctgga gaacgcttcc aaaaagagcc ggcctcctcc gctgcggtaa gagctgccgc 240
ctccgctgga tgaactacct ccgcccctcc gtcaaacgcg gccagatcgc ccccgacgag 300
gaagatctca tcctccgcct tcaccgcctc ctcggcaacc ggtggtcttt gatagcggga 360
agaattccgg gaagaactga taatgagata aagaacttct ggaacaccca tctcagcaag 420
aagcttatca gccaagggat tgatccaaga acccacaagc ctctcaaccc agaactatct 480
attccctctt cttccactac tccaccacca ccaccacctt ccaagcctct tcctgtgatc 540
acaaatcacc aaacacttca tgaaactact actcatcatc atctcaatat tgctagtgtc 600
aaccaagaat gtgatgaggg tcaatatcaa tatcaacaac ctcaagcagt agctgctgct 660
gcatatatgg tagctaatga tattcctgat gatgatattc cttccatgga tcatctactt 720
gccaacaaca acaacaacaa ccaggactac aatgatatca attattgttc tgatgatatc 780
ttttcttcct tcctcaattc tctgatcaat gaggatgcgt tctctgccca gcgccacctg 840
caatcggagc atcatgatga ccttgcacag gatcctgtta cttcatcaac accacaaggt 900
tataatggca ttggtgttgc atgggaattg cccctcatgc ctgctaattt cagccaaaat 960
gaacacagcc atgaggttga tgatcatcac aaatag 996
<210> 14
<211> 990
<212> DNA
<213> Lotus corniculatus
<400> 14
atgaggaacc cgatagcatc atcatcaacg aacaagaaga agaacagtac aactactggc 60
aatgaaaatg gcacgactgc tactactact ccgtgctgca gcaaagttgg gttgaagaga 120
gggccatgga caccggagga agacgaggtg ttggccagtt tcataaggaa agaaggcgaa 180
ggtcgctgga gaacgcttcc aaaaagagcc ggcctcctcc gctgcggtaa gagctgccgc 240
ctccgctgga tgaactacct ccgcccctcc gtcaaacgcg gccagatcgc ccccgacgag 300
gaagatctca tcctccgact tcaccgcctc ctcggcaacc ggtggtcttt gatagcggga 360
agaattccgg gaagaactga taatgagata aagaacttct ggaacaccca tctcagcaag 420
aagcttatca gccaagggat tgatccaaga acccacaagc ctctcaaccc agaactatct 480
attccctctt cttccactac tccaccacca ccaccacctt ccaagcctgt tcctgtgatc 540
acaaatcacc aaacacttca tgaaactact actcatcatc atctcaatat tgctagtgtc 600
aaccaagaat gtgatgaggg tcaatatcaa tatcaacaac ctcaagcagt agctgctgct 660
gcatatatgg tagctaatga tattcctgat gatgttcctt ccatggatca tctacttgcc 720
aacaacaaca acaaccagga ctacaatgat atcaattatt gttctgatga tatcttttct 780
tccttcctca attctctgat caatgaggat gcgttctctg cccatcgcca cctgcaatcg 840
gagcatcatg atgaccttgc acaggatcct gttacttcat caacaccaca aggttataat 900
ggcattggtg ttgcatggga attgcccctc atgcctgcta atttcagcca aaatgaacac 960
agccatgagg ttgatgatca tcacaaatag 990
<210> 15
<211> 329
<212> PRT
<213> Lotus corniculatus
<400> 15
Met Arg Asn Pro Ile Ala Ser Ser Ser Thr Asn Lys Lys Lys Ser Ser
1 5 10 15
Thr Thr Thr Gly Asn Glu Asn Gly Thr Thr Val Thr Thr Thr Pro Cys
20 25 30
Cys Ser Lys Val Gly Leu Lys Arg Gly Pro Trp Thr Pro Glu Glu Asp
35 40 45
Glu Val Leu Ala Ser Phe Ile Arg Lys Glu Gly Glu Gly Arg Trp Arg
50 55 60
Thr Leu Pro Lys Arg Ala Gly Leu Leu Arg Cys Gly Lys Ser Cys Arg
65 70 75 80
Leu Arg Trp Met Asn Tyr Leu Arg Pro Ser Val Lys Arg Gly Gln Ile
85 90 95
Ala Pro Asp Glu Glu Asp Leu Ile Leu Arg Leu His Arg Leu Leu Gly
100 105 110
Asn Arg Trp Ser Leu Ile Ala Gly Arg Ile Pro Gly Arg Thr Asp Asn
115 120 125
Glu Ile Lys Asn Phe Trp Asn Thr His Leu Ser Lys Lys Leu Ile Ser
130 135 140
Gln Gly Ile Asp Pro Arg Thr His Lys Pro Leu Asn Pro Glu Leu Ser
145 150 155 160
Ile Pro Ser Ser Ser Thr Thr Pro Pro Pro Pro Pro Pro Ser Lys Pro
165 170 175
Leu Pro Val Ile Thr Asn His Gln Thr Leu His Glu Thr Thr Thr His
180 185 190
His His Leu Asn Ile Ala Ser Val Asn Gln Glu Cys Asp Glu Gly Gln
195 200 205
Tyr Gln Tyr Gln Gln Pro Gln Ala Val Ala Ala Ala Ala Tyr Met Val
210 215 220
Ala Asn Asp Ile Pro Asp Asp Val Pro Ser Met Asp His Leu Leu Ala
225 230 235 240
Asn Asn Asn Asn Asn Gln Asp Tyr Asn Asp Ile Asn Tyr Cys Ser Asp
245 250 255
Asp Ile Phe Ser Ser Phe Leu Asn Ser Leu Ile Asn Glu Asp Ala Phe
260 265 270
Ser Ala Gln Arg His Leu Gln Ser Glu His His Asp Asp Leu Ala Gln
275 280 285
Asp Pro Val Thr Ser Ser Thr Pro Gln Gly Tyr Asn Gly Ile Gly Val
290 295 300
Ala Trp Glu Leu Pro Leu Met Pro Ala Asn Phe Ser Gln Asn Glu His
305 310 315 320
Ser His Glu Val Asp Asp His His Lys
325
<210> 16
<211> 330
<212> PRT
<213> Lotus corniculatus
<400> 16
Met Arg Asn Pro Ile Ala Ser Ser Ser Thr Asn Lys Lys Lys Asn Ser
1 5 10 15
Thr Thr Thr Gly Asn Glu Asn Gly Thr Thr Ala Thr Thr Thr Pro Cys
20 25 30
Cys Ser Lys Val Gly Leu Lys Arg Gly Pro Trp Thr Pro Glu Glu Asp
35 40 45
Glu Val Leu Ala Ser Phe Ile Arg Lys Glu Gly Glu Gly Arg Trp Arg
50 55 60
Thr Leu Pro Lys Arg Ala Gly Leu Leu Arg Cys Gly Lys Ser Cys Arg
65 70 75 80
Leu Arg Trp Met Asn Tyr Leu Arg Pro Ser Val Lys Arg Gly Gln Ile
85 90 95
Ala Pro Asp Glu Glu Asp Leu Ile Leu Arg Leu His Arg Leu Leu Gly
100 105 110
Asn Arg Trp Ser Leu Ile Ala Gly Arg Ile Pro Gly Arg Thr Asp Asn
115 120 125
Glu Ile Lys Asn Phe Trp Asn Thr His Leu Ser Lys Lys Leu Ile Ser
130 135 140
Gln Gly Ile Asp Pro Arg Thr His Lys Pro Leu Asn Pro Glu Leu Ser
145 150 155 160
Ile Pro Ser Ser Ser Thr Thr Pro Pro Pro Pro Pro Ser Lys Pro Leu
165 170 175
Pro Val Ile Thr Asn His Gln Thr Leu His Glu Thr Thr Thr His His
180 185 190
His Leu Asn Ile Ala Ser Val Asn Gln Glu Cys Asp Glu Gly Gln Tyr
195 200 205
Gln Tyr Gln Gln Pro Gln Ala Val Ala Ala Ala Ala Tyr Met Val Ala
210 215 220
Asn Asp Ile Pro Asp Asp Asp Ile Pro Ser Met Asp His Leu Leu Ala
225 230 235 240
Asn Asn Asn Asn Asn Asn Gln Asp Tyr Asn Asp Ile Asn Tyr Cys Ser
245 250 255
Asp Asp Ile Phe Ser Ser Phe Leu Asn Ser Leu Ile Asn Glu Asp Ala
260 265 270
Phe Ser Ala Gln Arg His Leu Gln Ser Glu His His Asp Asp Leu Ala
275 280 285
Gln Asp Pro Val Thr Ser Ser Thr Pro Gln Gly Tyr Asn Gly Ile Gly
290 295 300
Val Ala Trp Glu Leu Pro Leu Met Pro Ala Asn Phe Ser Gln Asn Glu
305 310 315 320
His Ser His Glu Val Asp Asp His His Lys
325 330
<210> 17
<211> 329
<212> PRT
<213> Lotus corniculatus
<400> 17
Met Arg Asn Pro Ile Ala Ser Ser Ser Thr Asn Lys Lys Lys Asn Ser
1 5 10 15
Thr Thr Thr Gly Asn Glu Asn Asp Thr Thr Ala Thr Thr Thr Pro Cys
20 25 30
Cys Ser Lys Val Gly Leu Lys Arg Gly Pro Trp Thr Pro Glu Glu Asp
35 40 45
Glu Val Leu Ala Ser Phe Ile Arg Lys Glu Gly Glu Gly Arg Trp Arg
50 55 60
Thr Leu Pro Lys Arg Ala Gly Leu Leu Arg Cys Gly Lys Ser Cys Arg
65 70 75 80
Leu Arg Trp Met Asn Tyr Leu Arg Pro Ser Val Lys Arg Gly Gln Ile
85 90 95
Ala Pro Asp Glu Glu Asp Leu Ile Leu Arg Leu His Arg Leu Leu Gly
100 105 110
Asn Arg Trp Ser Leu Ile Ala Gly Arg Ile Pro Gly Arg Thr Asp Asn
115 120 125
Glu Ile Lys Asn Phe Trp Asn Thr His Leu Ser Lys Lys Leu Ile Ser
130 135 140
Gln Gly Ile Asp Pro Arg Thr His Lys Pro Leu Asn Pro Glu Leu Ser
145 150 155 160
Ile Pro Ser Ser Ser Thr Thr Pro Pro Pro Pro Pro Pro Ser Lys Pro
165 170 175
Leu Pro Val Ile Thr Asn His Gln Thr Leu His Glu Thr Thr Thr His
180 185 190
His His Leu Asn Ile Ala Ser Val Asn Gln Glu Cys Asp Glu Gly Gln
195 200 205
Tyr Gln Tyr Gln Gln Pro Gln Ala Val Ala Ala Ala Ala Tyr Met Val
210 215 220
Ala Asn Asp Ile Pro Asp Asp Val Pro Ser Met Asp His Leu Leu Ala
225 230 235 240
Asn Asn Asn Asn Asn Gln Asp Tyr Asn Asp Ile Asn Tyr Cys Ser Asp
245 250 255
Asp Ile Phe Ser Ser Phe Leu Asn Ser Leu Ile Asn Glu Asp Ala Phe
260 265 270
Ser Ala Gln Arg His Leu Gln Ser Glu His His Asp Asp Leu Ala Gln
275 280 285
Asp Pro Val Thr Ser Ser Thr Pro Gln Gly Tyr Asn Gly Ile Gly Val
290 295 300
Ala Trp Glu Leu Pro Leu Met Pro Ala Asn Phe Ser Gln Asn Glu His
305 310 315 320
Ser His Glu Val Asp Asp His His Lys
325
<210> 18
<211> 329
<212> PRT
<213> Lotus corniculatus
<400> 18
Met Arg Asn Pro Ile Ala Ser Ser Ser Thr Asn Lys Lys Lys Asn Ser
1 5 10 15
Thr Thr Thr Gly Asn Glu Asn Asp Thr Thr Ala Thr Thr Thr Pro Cys
20 25 30
Cys Ser Lys Val Gly Leu Lys Arg Gly Pro Trp Thr Pro Glu Glu Asp
35 40 45
Glu Val Leu Ala Ser Phe Ile Arg Lys Glu Gly Glu Gly Arg Trp Arg
50 55 60
Thr Leu Pro Lys Arg Ala Gly Leu Leu Arg Cys Gly Lys Ser Cys Arg
65 70 75 80
Leu Arg Trp Met Asn Tyr Leu Arg Pro Ser Val Lys Arg Gly Gln Ile
85 90 95
Ala Pro Asp Glu Glu Asp Leu Ile Leu Arg Leu His Arg Leu Leu Gly
100 105 110
Asn Arg Trp Ser Leu Ile Ala Gly Arg Ile Pro Gly Arg Thr Asp Asn
115 120 125
Glu Ile Lys Asn Phe Trp Asn Thr His Leu Ser Lys Lys Leu Ile Ser
130 135 140
Gln Gly Ile Asp Pro Arg Thr His Lys Pro Leu Asn Pro Glu Leu Ser
145 150 155 160
Ile Pro Ser Ser Ser Thr Thr Pro Pro Pro Pro Pro Pro Ser Lys Pro
165 170 175
Leu Pro Val Ile Thr Asn His Gln Thr Leu His Glu Thr Thr Thr His
180 185 190
His His Leu Asn Ile Ala Ser Val Asn Gln Glu Cys Asp Glu Gly Gln
195 200 205
Tyr Gln Tyr Gln Gln Pro Gln Ala Val Ala Ala Ala Ala Tyr Met Val
210 215 220
Ala Asn Asp Ile Pro Asp Asp Val Pro Ser Met Asp His Leu Leu Ala
225 230 235 240
Asn Asn Asn Asn Asn Gln Asp Tyr Asn Asp Ile Asn Tyr Cys Ser Asp
245 250 255
Asp Ile Phe Ser Ser Phe Leu Asn Ser Leu Ile Asn Glu Asp Ala Phe
260 265 270
Ser Ala Gln Arg His Leu Gln Ser Glu His His Asp Asp Leu Ala Gln
275 280 285
Asp Pro Val Thr Ser Ser Thr Pro Gln Gly Tyr Asn Gly Ile Gly Val
290 295 300
Ala Trp Glu Leu Pro Leu Met Pro Ala Asn Phe Ser Gln Asn Glu His
305 310 315 320
Ser His Glu Val Asp Asp His His Lys
325
<210> 19
<211> 331
<212> PRT
<213> Lotus corniculatus
<400> 19
Met Arg Asn Pro Ile Ala Ser Ser Ser Thr Asn Lys Lys Lys Asn Ser
1 5 10 15
Thr Thr Thr Gly Asn Glu Asn Gly Thr Thr Ala Thr Thr Thr Pro Cys
20 25 30
Cys Ser Lys Val Gly Leu Lys Arg Gly Pro Trp Thr Pro Glu Glu Asp
35 40 45
Glu Val Leu Ala Ser Phe Ile Arg Lys Glu Gly Glu Gly Arg Trp Arg
50 55 60
Thr Leu Pro Lys Arg Ala Gly Leu Leu Arg Cys Gly Lys Ser Cys Arg
65 70 75 80
Leu Arg Trp Met Asn Tyr Leu Arg Pro Ser Val Lys Arg Gly Gln Ile
85 90 95
Ala Pro Asp Glu Glu Asp Leu Ile Leu Arg Leu His Arg Leu Leu Gly
100 105 110
Asn Arg Trp Ser Leu Ile Ala Gly Arg Ile Pro Gly Arg Thr Asp Asn
115 120 125
Glu Ile Lys Asn Phe Trp Asn Thr His Leu Ser Lys Lys Leu Ile Ser
130 135 140
Gln Gly Ile Asp Pro Arg Thr His Lys Pro Leu Asn Pro Glu Leu Ser
145 150 155 160
Ile Pro Ser Ser Ser Thr Thr Pro Pro Pro Pro Pro Pro Ser Lys Pro
165 170 175
Leu Pro Val Ile Thr Asn His Gln Thr Leu His Glu Thr Thr Thr His
180 185 190
His His Leu Asn Ile Ala Ser Val Asn Gln Glu Cys Asp Glu Gly Gln
195 200 205
Tyr Gln Tyr Gln Gln Pro Gln Ala Val Ala Ala Ala Ala Tyr Met Val
210 215 220
Ala Asn Asp Ile Pro Asp Asp Asp Ile Pro Ser Met Asp His Leu Leu
225 230 235 240
Ala Asn Asn Asn Asn Asn Asn Gln Asp Tyr Asn Asp Ile Asn Tyr Cys
245 250 255
Ser Asp Asp Ile Phe Ser Ser Phe Leu Asn Ser Leu Ile Asn Glu Asp
260 265 270
Ala Phe Ser Ala Gln Arg His Leu Gln Ser Glu His His Asp Asp Leu
275 280 285
Ala Gln Asp Pro Val Thr Ser Ser Thr Pro Gln Gly Tyr Asn Gly Ile
290 295 300
Gly Val Ala Trp Glu Leu Pro Leu Met Pro Ala Asn Phe Ser Gln Asn
305 310 315 320
Glu His Ser His Glu Val Asp Asp His His Lys
325 330
<210> 20
<211> 329
<212> PRT
<213> Lotus corniculatus
<400> 20
Met Arg Asn Pro Ile Ala Ser Ser Ser Thr Asn Lys Lys Lys Asn Ser
1 5 10 15
Thr Thr Thr Gly Asn Glu Asn Gly Thr Thr Ala Thr Thr Thr Pro Cys
20 25 30
Cys Ser Lys Val Gly Leu Lys Arg Gly Pro Trp Thr Pro Glu Glu Asp
35 40 45
Glu Val Leu Ala Ser Phe Ile Arg Lys Glu Gly Glu Gly Arg Trp Arg
50 55 60
Thr Leu Pro Lys Arg Ala Gly Leu Leu Arg Cys Gly Lys Ser Cys Arg
65 70 75 80
Leu Arg Trp Met Asn Tyr Leu Arg Pro Ser Val Lys Arg Gly Gln Ile
85 90 95
Ala Pro Asp Glu Glu Asp Leu Ile Leu Arg Leu His Arg Leu Leu Gly
100 105 110
Asn Arg Trp Ser Leu Ile Ala Gly Arg Ile Pro Gly Arg Thr Asp Asn
115 120 125
Glu Ile Lys Asn Phe Trp Asn Thr His Leu Ser Lys Lys Leu Ile Ser
130 135 140
Gln Gly Ile Asp Pro Arg Thr His Lys Pro Leu Asn Pro Glu Leu Ser
145 150 155 160
Ile Pro Ser Ser Ser Thr Thr Pro Pro Pro Pro Pro Pro Ser Lys Pro
165 170 175
Val Pro Val Ile Thr Asn His Gln Thr Leu His Glu Thr Thr Thr His
180 185 190
His His Leu Asn Ile Ala Ser Val Asn Gln Glu Cys Asp Glu Gly Gln
195 200 205
Tyr Gln Tyr Gln Gln Pro Gln Ala Val Ala Ala Ala Ala Tyr Met Val
210 215 220
Ala Asn Asp Ile Pro Asp Asp Val Pro Ser Met Asp His Leu Leu Ala
225 230 235 240
Asn Asn Asn Asn Asn Gln Asp Tyr Asn Asp Ile Asn Tyr Cys Ser Asp
245 250 255
Asp Ile Phe Ser Ser Phe Leu Asn Ser Leu Ile Asn Glu Asp Ala Phe
260 265 270
Ser Ala His Arg His Leu Gln Ser Glu His His Asp Asp Leu Ala Gln
275 280 285
Asp Pro Val Thr Ser Ser Thr Pro Gln Gly Tyr Asn Gly Ile Gly Val
290 295 300
Ala Trp Glu Leu Pro Leu Met Pro Ala Asn Phe Ser Gln Asn Glu His
305 310 315 320
Ser His Glu Val Asp Asp His His Lys
325
Claims (3)
1. The application of the Baimaigen LcMYB5 gene in improving the tannin content of Baimaigen leaves is characterized in that the nucleotide sequence of the Baimaigen LcMYB5 gene is selected from SEQ ID No: 3. and SEQ ID No:4, and at least one of the sequences shown in fig. 4.
2. The application of the Baimaigen LcMYB5 gene in Baimaigen genetic improvement and breeding is characterized in that the nucleotide sequence of the Baimaigen LcMYB5 gene is selected from SEQ ID No: 3. and SEQ ID No: 4. at least one of the sequences shown.
3. The application of the Baimaigen LcMYB5 gene in regulating and controlling Baimaigen tannin synthesis related genes is characterized in that the nucleotide sequence of the Baimaigen LcMYB5 gene is selected from SEQ ID No: 3. and SEQ ID No: 4. at least one of the sequences shown;
the tannin synthesis related genes are selected from at least one of LjCHS-1, ljCHS-2, ljF H-1, ljLAR, ljANR, ljTT, ljTT9, ljTT8L1, ljTTG2, ljTTG1L1 and LjTTG1L2 genes;
the Baimaigen LcMYB5 gene can improve the expression level of genes related to Baimaigen tannin synthesis.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111009708.XA CN113604478B (en) | 2021-08-31 | 2021-08-31 | Baimaigen LcMYB5 gene and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111009708.XA CN113604478B (en) | 2021-08-31 | 2021-08-31 | Baimaigen LcMYB5 gene and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN113604478A CN113604478A (en) | 2021-11-05 |
| CN113604478B true CN113604478B (en) | 2023-05-23 |
Family
ID=78309805
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202111009708.XA Active CN113604478B (en) | 2021-08-31 | 2021-08-31 | Baimaigen LcMYB5 gene and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN113604478B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN115043921A (en) * | 2022-06-30 | 2022-09-13 | 中国科学院华南植物园 | Lotus corniculatus plant type related gene LjLAZY3 and application thereof |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101503466B (en) * | 2002-06-14 | 2011-08-24 | 中国科学院上海生命科学研究院 | Birdsfoot trefoil root flower type and inflorescence structure regulating protein, preparation and use thereof |
| WO2006010096A2 (en) * | 2004-07-09 | 2006-01-26 | The Samuel Roberts Noble Foundation, Inc. | Genetic manipulation of condensed tannins |
-
2021
- 2021-08-31 CN CN202111009708.XA patent/CN113604478B/en active Active
Also Published As
| Publication number | Publication date |
|---|---|
| CN113604478A (en) | 2021-11-05 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN109576284B (en) | Multifunctional MYB transcription factor gene and application thereof | |
| CN110184247B (en) | Alfalfa melatonin synthetic gene MsASMT and application thereof in regulation and control of plant melatonin and flavonoid synthesis | |
| CN110950943B (en) | Alfalfa 'WL525' embryonic development late protein MsLEA-D34 and coding gene thereof | |
| CN110872598B (en) | Cotton drought-resistant related gene GhDT1 and application thereof | |
| CN112322630B (en) | MsSPL13 gene and application thereof | |
| CN106591322A (en) | Gingko MADS-box transcription factor gene GbMADS9 for controlling blossoming of plants and encoding protein and application of Gingko MADS-box transcription factor gene GbMADS9 | |
| CN109161553A (en) | A kind of pears transcription factor PbBP and its application | |
| CN113604478B (en) | Baimaigen LcMYB5 gene and application thereof | |
| CN112694524B (en) | Anti-fusarium wilt PHD transcription factor ClPHD23, gene, expression vector, transformant and application thereof | |
| KR20140135719A (en) | Modulation of seed vigor | |
| CN114736280B (en) | Application of ZmROA1 protein in regulation and control of plant tolerance | |
| CN114369616B (en) | Application of tomato SISPS gene in improving high temperature resistance of plants | |
| CN116120413A (en) | SlHAT5 gene and application thereof in high temperature stress resistance of tomatoes | |
| CN110358774B (en) | Gene, protein, gene expression cassette, expression vector, host cell, method and application for controlling rice flowering time | |
| CN109988229B (en) | Chimonanthus praecox CpFT gene and application thereof | |
| CN109486838B (en) | Transcription factor gene for regulating plant flavonoid synthesis and application thereof | |
| CN114277041A (en) | Application of soybean gibberellin 3 beta-hydroxylase encoding gene GmGA3ox1 | |
| CN113481210A (en) | Application of cotton GhDof1.7 gene in promotion of salt tolerance of plants | |
| CN115820695B (en) | Gene PGI1 and PGI2 for regulating rice chalkiness, and encoding protein and application thereof | |
| CN114891805B (en) | MsHMG-Y gene and encoding protein and application thereof | |
| CN114908068B (en) | Pear callose synthase PbrCalS5 and encoding gene and application thereof | |
| CN114807177B (en) | Wild buckwheat rhizome transcription factor FdFAR1 gene and application thereof | |
| CN110240641B (en) | Rice DPS1 gene and application of coded protein thereof | |
| CN114875044B (en) | Wild grape VyVTE gene, protein coded by same and application thereof | |
| CN115029354B (en) | Plant growth regulating gene PmGRF7 and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |