CN113584048B

CN113584048B - Application of OsHin1 gene in prevention and control of meloidogyne pseudograminis

Info

Publication number: CN113584048B
Application number: CN202110826475.6A
Authority: CN
Inventors: 陈建松; 李治文
Original assignee: Rice Research Institute Guangdong Academy Of Agricultural Sciences
Current assignee: Rice Research Institute Guangdong Academy Of Agricultural Sciences
Priority date: 2021-07-21
Filing date: 2021-07-21
Publication date: 2022-04-08
Anticipated expiration: 2041-07-21
Also published as: CN113584048A

Abstract

The invention discloses application of an OsHin1 gene in prevention and control of root-knot nematodes of Poaceae, and belongs to the technical field of plant disease prevention and control. The nucleotide sequence of the OsHin1 gene is shown as SEQ ID NO.1, and the coded amino acid sequence is shown as SEQ ID NO. 2. The OsHin1 gene overexpression can reduce the infection of the pseudogramineous root-knot nematode, and the OsHin1 gene knockout can improve the infection of the pseudogramineous root-knot nematode, so that the OsHin1 gene knock-out can be applied to preparing a pseudogramineous root-knot nematode prevention and control product and cultivating the rice resisting the pseudogramineous root-knot nematode.

Description

Application of OsHin1 gene in prevention and control of meloidogyne pseudograminis

Technical Field

The invention relates to the technical field of plant disease control, in particular to application of an OsHin1 gene in controlling root-knot nematodes of poaceae.

Background

Rice is the major food for more than about half of the world's population. Root knot nematodes (meloidogyne. graminicola) are one of the most harmful plant parasitic nematodes on rice and cause losses in rice yield of up to 87%. The pseudogramineae meloidogyne is widely distributed, and is particularly reported in the main rice producing areas of the world, such as countries and regions of India, Nepal, Burma, Bengal, Laos, Grlulia, Libiya, Thailand, Philippines, Indonesia, Pakistan, Singapore, Vietnam and the like. In recent years, pseudogramineous root-knot nematodes have been discovered in succession in Guangdong, Guangxi, Fujian, Yunnan, Hunan, Sichuan and Jiangxi in China, and are seriously harmful in some areas, threatening the production safety of rice. Because the nematode has a wide host range, a short life-cycle and is very water-resistant, it is difficult to control by conventional means. Disease-resistant breeding is the most effective prevention and control means of the root-knot nematodes, and at present, a graminoid root-knot nematode resistance gene needs to be screened urgently to provide a basis for preventing and controlling the graminoid root-knot nematodes.

Disclosure of Invention

In view of the above, the invention researches the OsHin1 gene, which shows significant effect on the prevention and control of the meloidogyne pseudograminis.

The invention adopts the following technical scheme:

the application of the OsHin1 gene in preventing and controlling root-knot nematodes of Poaceae is characterized in that the nucleotide sequence of the OsHin1 gene is shown as SEQ ID NO.1, and the coded amino acid sequence is shown as SEQ ID NO. 2.

The invention discovers for the first time that the rice gene OsHin1 has the function of resisting the pseudogramineous root-knot nematode, and the gene has important application value and prospect in the aspect of preventing and controlling the pseudogramineous root-knot nematode.

Furthermore, the OsHin1 gene overexpression can reduce the infection of the root-knot nematode of poaceae,

the OsHin1 gene knockout can improve the infection of the root-knot nematode of poaceae.

The OsHin1 gene can be applied to preparation of a root-knot nematode prevention and control product of poaceae.

For example, an overexpression vector or a gene knockout vector is constructed by using the OsHin1 gene, the overexpression vector can be used for cultivating graminoid root-knot nematode resistant rice, and the gene knockout vector can be used for cultivating graminoid root-knot nematode sensitive rice, so that the development of graminoid root-knot nematode prevention and control products is facilitated.

The OsHin1 gene is applied to the cultivation of the rice resisting the root-knot nematode of poaceae.

Further, the invention provides a recombinant vector for preventing and controlling root-knot nematodes of poaceae, wherein the recombinant vector is an overexpression vector or a gene knockout vector of the OsHin1 gene.

Further, the invention provides a recombinant bacterium for preventing and controlling root-knot nematodes of poaceae, which contains the recombinant vector.

In conclusion, the rice OsHin1 gene provided by the invention has wide application prospects in the aspect of preventing and controlling root-knot nematodes of poaceae.

Drawings

FIG. 1 shows the expression of OsHin1 gene in rice roots after infection with root knot nematode belonging to the family Poaceae;

FIG. 2 shows the GUS staining results of rice roots after infection by root-knot nematodes of Gramineae;

wherein A is a GUS staining pattern after 3 days of infection of root-knot nematode pCAMBIA1305.1: OsHin1pro: GUS transgenic rice of poaceae; b is a GUS staining pattern after the root-knot nematode of pseudogramineae infects wild rice for 3 days;

FIG. 3 is a schematic diagram showing the pCAMBIA1305.1: Ubi: OsHin1 overexpression vector;

FIG. 4 shows the position of the mutation target sequence on the OsHin1 gene;

FIG. 5 is a schematic diagram of a knock-out vector;

FIG. 6 shows the rice mutation site with OsHin1 gene knockout;

FIG. 7 shows OsHin1 gene knock-out rice infected with root knot nematode of Gramineae;

a is qRT-PCR verification of OsHin1 gene knockout rice OsHin1 gene transcription level; b is the number of female insects in roots 17 days after the root-knot nematode of the family pseudobenthiaceae infects OsHin1 knock-out rice and wild rice;

FIG. 8 shows a rice plant overexpressing OsHin1 gene infected by root-knot nematode belonging to the family Poaceae;

a is qRT-PCR verification of the transcription level of OsHin1 gene of over-expressed rice; b is the number of female insects in roots 17 days after the root-knot nematode infection of the pseudobenthiaceae over-expressed OsHin1 rice and wild rice.

Detailed Description

The technical solutions in the embodiments of the present invention are clearly and completely described below, and it is obvious that the described embodiments are only a part of the embodiments of the present invention, and not all embodiments. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.

Example 1 identification of nematode infestation by the OsHin1 Gene of Rice

1. Rice culture and nematode inoculation

The wild type Nipponbare rice which grows for 2 weeks is taken, 200 root knot nematodes of poaceae are inoculated to each plant, and the missed nematode rice roots are taken as negative control. The rice culture conditions are as follows: the temperature is 28 ℃, and the light/dark cycle is 16h/8 h.

2. Rice total RNA extraction and cDNA synthesis

Taking each group of Nipponbare rice roots at different periods after inoculation, and extracting total RNA.

The total RNA of rice is obtained by using a method of an RNAprep pure Plant Kit, and the method comprises the following specific steps:

(1) 100mg of Nipponbare rice roots were quickly ground into powder in a mortar containing liquid nitrogen, and then transferred to a solution containing 450. mu.L of RL (1%. beta. -mercaptoethanol) and vigorously shaken.

(2) The lysate was transferred to a CS filter column and centrifuged at 12000rpm for 1 min. And (3) sucking the supernatant in the collecting tube into a new RNase-Free centrifuge tube, slowly adding absolute ethyl alcohol with the volume of 0.5 time of the supernatant, uniformly mixing, transferring the obtained solution and the precipitate into an adsorption column CR3, centrifuging at 12000rpm for 30s, pouring the waste liquid in the collecting tube, and then putting the adsorption column CR3 back into the collecting tube.

(3) mu.L of deproteinized liquid RW1 was added to adsorption column CR3, centrifuged at 12000rpm for 30s, the waste liquid in the collection tube was decanted, and adsorption column CR3 was returned to the collection tube. Adding 80 μ L of DNase 1 working solution into an adsorption column CR3 to prepare DNase 1 working solution: the 10 u LDNase 1 stock solution is put into a new RNase-Free centrifuge tube, and 70 u L RDD solution is added, and the mixture is gently mixed. Add 80. mu.L of DNase 1 working solution to adsorption column CR3 and leave it at room temperature for 15 min.

(4) 350 mu L of deproteinized liquid RW1 was added to adsorption column CR3, centrifuged at 12000rpm for 30s, the waste liquid in the collection tube was decanted, and adsorption column CR3 was returned to the collection tube. Adding 500 μ L of rinsing solution RW into adsorption column CR3, standing at room temperature for 2min, centrifuging at 12000rpm for 30s, removing waste liquid in the collection tube, and returning adsorption column CR3 to the collection tube. This operation was repeated twice.

(5) Centrifuging at 12000rpm for 2min, and discarding waste liquid. The adsorption column CR3 was left at room temperature for several minutes to thoroughly dry the residual rinse solution from the adsorption material.

(6) Placing the adsorption column CR3 into a new RNase-Free centrifuge tube, and suspending and dripping 30-100 mu L of RNase-Free ddH into the middle part of the adsorption membrane₂O, standing at room temperature for 2min, and centrifuging at 12000rpm for 2min to obtain an RNA solution.

Obtaining of rice cDNA was performed by reverse transcription with reference to Synthesis SuperMix for qPCR (One-Step gDNA Removal) kit method.

3. Real-time fluorescent quantitative PCR

Real-time fluorescent quantitative PCR experiment process reference

qPCR MasterMix kit method.

The obtained cDNA was used as a template, and the upstream and downstream primers were as follows:

OsHin1-qRT-F：TCCTTCTACCTGCAGGACCTC；

OsHin1-qRT-R:GTAGGTGACGAAGACGTCGAG；

selecting OsUBQ-F: CCAGTAAGTCCTCAGCCATGGAG and OsUBQ-R: GGACACAATGATTAGGGATC as an internal reference.

The experiment is carried out three times of technical repetition and three times of biological repetition, and the relative expression quantity of the gene adopts 2^-ΔΔCTAnd (4) calculating.

The expression change of OsHin1 gene in rice after 2 days, 5 days, 7 days, 12 days and 15 days of root knot nematode infestation of Poaceae is shown in FIG. 1. The results showed that the OsHin1 gene began to be up-regulated in expression level 2 days after nematode infestation and reached the highest level at 5-7 days; during the later stages of nematode infestation (12 to 15 days), the expression level of the OsHin1 gene continues to decrease. The results show that the OsHin1 gene of rice can identify the infection of nematode in early stage of rice and can be inhibited by nematode effector protein in later stage of nematode infection.

4. Poaceae-like root-knot nematode tissue section and GUS staining

Through bioinformatics analysis, a sequence of 2000bp before the start codon position of the OsHin1 gene is obtained, and the nucleotide sequence is shown as SEQ ID NO. 3. A2000 bp promoter-containing fragment of OsHin1 was cloned into pCAMBIA1305.1 by PCR to replace the 35s promoter in front of GUS gene, and GUS expression vector pCAMBIA1305.1: OsHin1pro: GUS was obtained.

Through the way of rice transgenosis, pCAMBIA1305.1: OsHin1pro: GUS is transferred into Nipponbare rice. Root-knot nematodes of pseudogramineae were collected, transgenic rice containing pCAMBIA1305.1: OsHin1pro: GUS and wild type japonica rice were infected, the roots of the rice were collected 3 days later, and the results were observed by microscopy using x-gluc staining solution for GUS staining.

GUS staining experiment results are shown in FIG. 2, and GUS protein is specifically expressed at the nematode infection site position in the early nematode infection stage, which indicates that the transcription of OsHin1 can be specifically stimulated in the nematode infection process.

Example 2 cloning of Rice OsHin1 Gene and vector construction

Cloning of OsHin1 Gene

Rice cDNA was obtained as in example 1.

The full-length cDNA sequence of the OsHin1 gene contains an open reading frame of 675bp (SEQ ID NO:1) and codes for 224AA (SEQ ID NO: 2).

The OsHin1 gene was amplified using rice cDNA as a template by using the following specific primers:

OsHin1-BamH1-F：ATGAGCAAGGAGAAGCAC；

OsHin1-Pst1-R：CACCTCGACGCTGCACCC。

vector construction of OsHin1 Gene

The 35s promoter in pCAMBIA1305 is replaced by a maize ubiquitin promoter Ubi by double enzyme digestion to obtain the pCAMBIA1305: Ubi rice expression vector. The OsHin1 fragment containing the BamH1/Pst1 cleavage site amplified in step 1 was ligated into pCAMBIA1305: Ubi expression vector to obtain over-expression vector pCAMBIA1305.1: Ubi: OsHin1 (FIG. 3).

Mutant targets CAAGCCGTCCTTCTACCTGCAGG and GACAAAGAGGTGGTAGCTGCCGG were designed according to the OsHin1 gene (fig. 4), and wuhan berk biotechnology limited was entrusted to insert the synthetic target sequence into CRISPR/Cas9 vector pbwa (v) H _ Cas9i2 vector to obtain a gene knockout vector (fig. 5).

Example 3 overexpression of the OsHin1 Gene in Rice and transformation of mutant plants

Wild type japonica rice callus transformation was performed by agrobacterium carrying the overexpression vector and the knock-out vector of example 2, respectively.

Through antibiotic and PCR screening, 12 rice positive transformation plants with OsHin1 gene mutation and 25 rice positive transformation plants with OsHin1 gene overexpression are obtained.

Sequencing analysis of the OsHin1 knock-out strain resulted in 3 homozygous strains for later experiments (FIG. 6). Meanwhile, qRT-PCR examined the transcription of the OsHin1 gene in mutant rice, and the results are shown in FIG. 7A.

Finally, through analysis of qRT-PCR, 3 over-expressed plants with higher OsHin1 gene expression level were selected for later experiments (FIG. 8A).

Example 4 disease susceptibility differences between Positive transformed plants of Rice and wild-type Nipponbare Rice

Seeds of wild type Nipponbare rice and OsHin1 gene over-expression rice positive transformation plants and OsHin1 gene mutation rice positive transformation plants screened in example 3 are taken for culture medium germination, the germinated plants are transplanted into a tube, about 200 nematode 2-instar larvae are inoculated to each plant after 14 days of growth, and female counting is carried out after continuous culture for 17 days.

Observing and counting the number of female root-knot nematodes in root knots by adopting an acid fuchsin dyeing method; the specific method comprises the following steps: taking out all root tissues of the plants, soaking in 5% NaClO solution for 10min, cleaning with clear water, and soaking in water for 20 min; adding 25 times diluted mother solution of fuchsin solution (0.5% acid fuchsin solution), heating to boil in microwave oven, cooling at room temperature, washing with clear water, observing with optical microscope, and counting.

The experimental results are shown in FIGS. 7-8, the number of female insects in the rice plant with OsHin1 gene knockout is significantly higher than that in wild Japanese rice (FIG. 7B);

the results of OsHin1 over-expressing rice plants with significantly fewer female insects in rice roots than wild type (FIG. 8B) indicate that OsHin1 can improve nematode resistance in rice.

The general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the invention. Thus, the present invention is not intended to be limited to the embodiments shown herein but is to be accorded the widest scope consistent with the principles and novel features disclosed herein.

Sequence listing

<110> Rice research institute of Guangdong province academy of agricultural sciences

Application of <120> OsHin1 gene in prevention and control of meloidogyne pseudograminis

<160> 3

<170> SIPOSequenceListing 1.0

<210> 1

<211> 675

<212> DNA

<213> Artificial

<400> 1

atgagcaagg agaagcacca caagcgggag caccacctcc ggcgatgctg cggcgggatg 60

gcggcgtgca tcctggcgct ggtcctcgtc gtcggcttca tcgcgctcgt cgtctacctc 120

gcgctccgcc cctccaagcc gtccttctac ctgcaggacc tccagctccg ctccgtcgac 180

ctcggcgacc cctccctctc cgccaccgcg caggtcaccc tcgcctcccg caaccccaat 240

gaccacgtcg gcgtccacta ccgccgcctc gacgtcttcg tcacctaccg cgacgaaccc 300

gtcacggtgc ccgtctccct cccgccgacc taccagggcc accgcgacgt caccatctgg 360

tcgcccgtgc tctccggcga gtccgtcccc gtggcgggct tcgtcgccga cgcgctcagg 420

caggacgtcg ccgccgggta cgtcgcgctg caggtgaagg tcgacggccg cgtcaagtgg 480

aaggtcggca gctgggtctc cggcagctac cacctctttg tcagctgccc cgccatgctc 540

gcctccgccg gaccaggcgg cgtcggcccc atgcctctcg gcggcgcctc cgccgccgtc 600

gtgaacggca ccggcgccgg cgccgtcgcg tcgctcaggt tcacgcagcc gacagggtgc 660

agcgtcgagg tgtga 675

<210> 2

<211> 224

<212> PRT

<213> Artificial

<400> 2

Met Ser Lys Glu Lys His His Lys Arg Glu His His Leu Arg Arg Cys

1 5 10 15

Cys Gly Gly Met Ala Ala Cys Ile Leu Ala Leu Val Leu Val Val Gly

20 25 30

Phe Ile Ala Leu Val Val Tyr Leu Ala Leu Arg Pro Ser Lys Pro Ser

35 40 45

Phe Tyr Leu Gln Asp Leu Gln Leu Arg Ser Val Asp Leu Gly Asp Pro

50 55 60

Ser Leu Ser Ala Thr Ala Gln Val Thr Leu Ala Ser Arg Asn Pro Asn

65 70 75 80

Asp His Val Gly Val His Tyr Arg Arg Leu Asp Val Phe Val Thr Tyr

85 90 95

Arg Asp Glu Pro Val Thr Val Pro Val Ser Leu Pro Pro Thr Tyr Gln

100 105 110

Gly His Arg Asp Val Thr Ile Trp Ser Pro Val Leu Ser Gly Glu Ser

115 120 125

Val Pro Val Ala Gly Phe Val Ala Asp Ala Leu Arg Gln Asp Val Ala

130 135 140

Ala Gly Tyr Val Ala Leu Gln Val Lys Val Asp Gly Arg Val Lys Trp

145 150 155 160

Lys Val Gly Ser Trp Val Ser Gly Ser Tyr His Leu Phe Val Ser Cys

165 170 175

Pro Ala Met Leu Ala Ser Ala Gly Pro Gly Gly Val Gly Pro Met Pro

180 185 190

Leu Gly Gly Ala Ser Ala Ala Val Val Asn Gly Thr Gly Ala Gly Ala

195 200 205

Val Ala Ser Leu Arg Phe Thr Gln Pro Thr Gly Cys Ser Val Glu Val

210 215 220

<210> 3

<211> 2003

<212> DNA

<213> Artificial

<400> 3

cggtcgcccg agggagagag agatagagat ggagagagag agagagattt ggggatgata 60

ggtgggcccg aacgcttttt tattttttat ttgctgactg gattgcaacg ttgccgccac 120

gtgtgcaagc ttaagccaaa accactcaga atagtgcttg ggggggggtt aatttgtccg 180

gtagtgtaaa atgtccggtt ttgttgttca aggggtaatt cgatcgactg ttatagttcg 240

gggggtaatt catacttttt cctttacaaa accgacgaaa accggacgca ctattgaaaa 300

atgatttttt ttacaggcac tcctactgca cgagcggacc gagtgggtaa ctccacgact 360

gcctgtactg aagtctgtta ggggggagcc gtcctggttc acctacgaag acaggattaa 420

tttttagtta aaattgaact ttttgactgg ctcgagaata taaattgctc gcttttctgt 480

ccaaatttta aaaatggatt tgattttttt tcaaaaaaaa acttgaccag atcttgtcta 540

aaacaaaagt ttttttatga aaaccaagta cggtgaactt gctagctagt atagtcaagc 600

ggtctcgtgt cattattatt ccataggtgt atgacacaat acgtgccctc atatatgcac 660

atcttatatc accgttttct tctctatcaa taatgggtgt taccatgaac aatcgctagt 720

tctgcttgta ggggatgcca tgcatgagca atgcgtcatc ctgagtttga atccgtacaa 780

atacaggtta tctcactgtt ttcttctcta ttaataatga atgcagtgaa aatagtaaga 840

tacaatgggt acttcgtatt ccaacaattt catatatgca gtgaaattgg atccaattac 900

attatcgaaa aataatatgt acacacacag tgagagtgtg agactatagt tagatgcatg 960

gggtgtgtgt gtgtatgaca gatgcgtaaa attttagtta tctcattttt cttcatatgc 1020

atgctgaaaa ttattgagtt ttcagattaa gtggtgggtg tgcgtgcatg tcttgagatc 1080

accaacccaa aaagttggaa acaatagcat aattccattg ccgtcctata cgttgaccaa 1140

attaacaagt ttgagtaaaa cttacttaaa agcaccgaat tagcacacga tcgagcctcg 1200

atccatccta agcgcgcaaa ggaaacacac atgcagtggg gcacaaatct aaaggcagat 1260

tgatcgatca tgcagaaatc gcccccaaac cagtaaccga tggcccatca gatcatctac 1320

aagaggttac ctagcatagc atagcataaa gaacaacccc aagcacaacg atcgaaagaa 1380

tcttcttcgg ttgagacgta gctttcgatc cagagctctc tgcctctcta gctagcttca 1440

attcccttca aaatttaaag agtaaaatgc atttacagtc cttaaacttg tacagttgtg 1500

tcatatagat cccaaaaatt gtcaaaatgc atatctaggt accaaaactt gtcaaagtgt 1560

atccaggtcc caaaacttat ctcaaaacac gtcatgtctg tgtggcatgc cacatcaacg 1620

ccacgtagga ttctaaaggg gttgtggtga tttgggacct agatgacaca ctatgacaag 1680

ttctggtact tagatatgca ttttgagagt ttagcgacct atatgacaca cccctacaag 1740

tttaaatact gcacgtgcac tttactcaaa tttcaaaggc gaaattttaa aacccttttc 1800

tttctttgag tacggacact taaattcaat tcgttcgctc cactaatctt aaaagccatt 1860

attactctct tactcgcttt catatctaac gcccctctct ctctctctct ctcactcagc 1920

aacagctcgc agctcactct ctcactctac tactcgtagc taagctagct cgcgccgccg 1980

ccgccgccgt cgccgccgcc atg 2003

Claims

The application of OsHin1 gene in preventing and controlling root-knot nematode of poaceae is characterized in that,

the nucleotide sequence of the OsHin1 gene is shown as SEQ ID NO.1, and the coded amino acid sequence is shown as SE Q ID NO. 2.
2. The use according to claim 1,

overexpression of the OsHin1 gene in rice cells reduces infection of root-knot nematodes of Poaceae.
The application of the OsHin1 gene in preparing a control product of root-knot nematodes of Poaceae is characterized in that,

the nucleotide sequence of the OsHin1 gene is shown as SEQ ID NO.1, and the coded amino acid sequence is shown as SE Q ID NO. 2.
4. Use according to claim 3,

an overexpression vector is constructed by using the OsHin1 gene.
The application of the OsHin1 gene in cultivating the rice resisting the root-knot nematode of poaceae is characterized in that,

the nucleotide sequence of the OsHin1 gene is shown as SEQ ID NO.1, and the coded amino acid sequence is shown as SE Q ID NO. 2.