CN113549692B - Method for detecting nasopharyngeal carcinoma anti-radiotherapy biomarker based on hybridization chain reaction - Google Patents

Method for detecting nasopharyngeal carcinoma anti-radiotherapy biomarker based on hybridization chain reaction Download PDF

Info

Publication number
CN113549692B
CN113549692B CN202110826871.9A CN202110826871A CN113549692B CN 113549692 B CN113549692 B CN 113549692B CN 202110826871 A CN202110826871 A CN 202110826871A CN 113549692 B CN113549692 B CN 113549692B
Authority
CN
China
Prior art keywords
mir
graphene oxide
solution
mol
hcr1
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN202110826871.9A
Other languages
Chinese (zh)
Other versions
CN113549692A (en
Inventor
杨兆琪
羊杜涛
殷少贤
秦兰
蔡燕飞
金坚
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Jiangnan University
Original Assignee
Jiangnan University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Jiangnan University filed Critical Jiangnan University
Priority to CN202110826871.9A priority Critical patent/CN113549692B/en
Publication of CN113549692A publication Critical patent/CN113549692A/en
Application granted granted Critical
Publication of CN113549692B publication Critical patent/CN113549692B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813—Hybridisation assays
    • C12Q1/6816—Hybridisation assays characterised by the detection means
    • C12Q1/6825—Nucleic acid detection involving sensors
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/106—Pharmacogenomics, i.e. genetic variability in individual responses to drugs and drug metabolism
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/158—Expression markers
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/178—Oligonucleotides characterized by their use miRNA, siRNA or ncRNA
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Analytical Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Immunology (AREA)
  • Genetics & Genomics (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Pathology (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Hospice & Palliative Care (AREA)
  • Oncology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention discloses a method for detecting a nasopharyngeal carcinoma anti-radiotherapy biomarker based on hybridization chain reaction, belonging to the field of molecular biology. The invention discloses a biosensor for detecting a nasopharyngeal carcinoma anti-radiotherapy biomarker based on a hybridization chain reaction, which comprises miR-205, hairpin nucleic acid probes HCR1 and HCR2 and graphene oxide. According to the invention, through the design of hairpin nucleic acid probes HCR1 and HCR2, the biocompatibility and fluorescence quenching effect of graphene oxide are utilized to finish detection of a target miR-205 in living cells and quantitative detection and directional detection of miR-205 in a solution to be detected. The miR-205 detection serving as a biomarker is more accurate, real-time and efficient.

Description

Method for detecting nasopharyngeal carcinoma anti-radiotherapy biomarker based on hybridization chain reaction
Technical Field
The invention relates to a method for detecting a nasopharyngeal carcinoma anti-radiotherapy biomarker based on hybridization chain reaction, belonging to the field of molecular biology.
Background
Nasopharyngeal carcinoma refers to malignant tumor occurring at the top and side walls of the nasopharyngeal cavity, and the incidence rate is the first of ear-nose-throat malignant tumor, and is highest in China and southeast Asia all over the world. Most of nasopharyngeal carcinoma has moderate sensitivity to radiotherapy, so radiotherapy is currently accepted and effective radical treatment means, single radiotherapy is generally adopted in early stage, and comprehensive radiotherapy and chemotherapy mainly including radiotherapy are adopted in late stage. At present, the sensitivity of radiotherapy of tumors is judged clinically by the condition of hypoxia at present, and the most common method for detecting the clinical hypoxia is an oxygen electrode method for directly detecting the oxygen partial pressure of tumor tissues. However, this detection technique requires invasive means and can only assess the local hypoxic status of the tumor. Therefore, there is an urgent need to develop a noninvasive, comprehensive detection method for judging the sensitivity of radiotherapy in patients with nasopharyngeal carcinoma, and to determine a personalized clinical treatment regimen for the patient so as not to delay the treatment.
MircoRNAs (miRNAs) is a single-stranded non-coding small molecule RNA with regulatory function and a length of about 20-24 nt. The existing research shows that the miR-205 content in the nasopharyngeal carcinoma anti-radiotherapy cells is obviously higher, and the nasopharyngeal carcinoma anti-radiotherapy cells can be used as a biomarker for radiotherapy reaction of nasopharyngeal carcinoma patients. The traditional miRNA quantitative detection method has the problems of complex operation, expensive instrument, low sensitivity and the like, such as real-time fluorescence quantitative PCR, a microarray method, northern blot and the like.
Disclosure of Invention
This section is intended to outline some aspects of embodiments of the invention and to briefly introduce some preferred embodiments. Some simplifications or omissions may be made in this section as well as in the description summary and in the title of the application, to avoid obscuring the purpose of this section, the description summary and the title of the invention, which should not be used to limit the scope of the invention.
The invention overcomes the defects existing in the prior art and provides a biosensor for detecting miR-205.
In order to solve the technical problems, the invention provides the following technical scheme:
the first object of the invention is to provide a biosensor for detecting miR-205, which comprises miR-205, a hairpin nucleic acid probe HCR1, a hairpin nucleic acid probe HCR2, graphene oxide and buffer;
the nucleotide sequence of miR-205 is UCCUUCAUUCCACCGGAGUCUG;
the nucleotide sequence of hairpin nucleic acid probe HCR1 contains sequence A and sequence B; the nucleotide sequence of hairpin nucleic acid probe HCR2 contains sequence B and sequence C;
the nucleotide sequences of the sequence A and the miR-205 are complementary, the sequence B is complementary with the sequence B, and the sequence C is TCCTTCATTCCACCGGAGTCTG;
the 5' -end of the nucleotide sequences of the hairpin nucleic acid probes HCR1 and HCR2 is connected with fluorescein.
In one embodiment, the sequence a is AGACTCCGGTGGAATGAAGGA and the sequence B is ACTTTGCAGACTCCGGTGGAAT.
In one embodiment, the nucleotide sequence of HCR1 is ATTCCACCGGAGTCTGCAAAGTCAGACTCCGGTGGAATGAAGGA;
the nucleotide sequence of HCR2 is ACTTTGCAGACTCCGGTGGAATTCCTTCATTCCACCGGAGTCTG.
In one embodiment, the fluorescein label includes, but is not limited to, 5-carboxyfluorescein.
In one embodiment, the buffer is an SPSC buffer; SPSC buffer formulation 50X 10 -9 mol/L Na 2 HPO 4 1 mol/L NaCl, pH 7.4.
The invention also provides application of the biosensor in detecting miR-205 in non-disease diagnosis.
In one embodiment, the assay is a qualitative or quantitative assay.
According to the method for diagnosing the non-diseases of miR-205 by using the biosensor, graphene oxide is added into a solution containing HCR1 and HCR2 for mixed incubation, so that a graphene oxide solution carrying hairpin nucleic acid probes is obtained, and after co-culture with cells, laser confocal imaging is performed.
In one embodiment, the concentration of the hairpin nucleic acid probe solution is 90-120×10 -9 mol/L; the concentration of the graphene oxide is 180-200 mu g/mL; the incubation time is at least 5 min; the time for co-culturing the graphene oxide solution loaded with the hairpin nucleic acid probe and the cells is 4-8 hours.
According to the method for diagnosing the non-diseases of miR-205 by using the biosensor, the solution to be detected is added into the solution containing HCR1 and HCR2 for mixed incubation, then graphene oxide is added for reaction, and fluorescence intensity is detected by using a fluorescence spectrophotometer.
In one embodiment, the concentration of the hairpin nucleic acid probe solution is 90-120×10 -9 mol/L; the concentration of the graphene oxide is 140-160 mu g/mL; the incubation time is at least 1 h, and the incubation temperature is 22-27 ℃.
The invention has the beneficial effects that: the method has the advantages of simple operation, rapid detection and high sensitivity, and the detection limit of miR-205 reaches 2.1X10 -11 The miR-205 has very high specificity in the detection of mol/L, the detection recovery rate of the sensor in 1 per mill of fetal calf serum is 96-122.17%, and the RSD (%) is 0.25-1.69。
Drawings
Fig. 1 is a schematic diagram of the working principle of the present invention.
FIG. 2 is a fluorescence spectrum diagram of the working principle feasibility analysis.
FIG. 3 is a schematic representation of the principle of operation feasibility analysis of nucleic acid electrophoresis.
FIG. 4 is a graph showing the effect of different concentrations of graphene oxide on the adsorption effect of nucleic acid probes.
FIG. 5 is a graph showing the effect of different concentrations of nucleic acid probe on fluorescence background values.
FIG. 6 shows the effect of different temperatures on the effect of hybridization chain reactions.
FIG. 7 shows the effect of time on the effect of hybridization chain reaction.
FIG. 8 is a fluorescence spectrum of a hybridization chain reaction-based graphene oxide sensor for miR-205 detection at different concentrations.
FIG. 9 is a specific response of a hybridization chain reaction based graphene oxide sensor to miR-205.
FIG. 10 feasibility analysis of a hybridization chain reaction based graphene oxide sensor on 1% fetal bovine serum.
FIG. 11 is a graph showing the effect of different concentrations of graphene oxide on the adsorption effect of nucleic acid probes in 1% fetal bovine serum.
FIG. 12 response of graphene oxide sensors based on hybridization chain reaction to different concentration gradients miR-205 in 1%o fetal bovine serum.
FIG. 13 shows the specific response of a hybridization chain reaction based graphene oxide sensor to miR-205 in 1% fetal bovine serum.
Fig. 14 is a fluorescent imaging of graphene oxide sensors in different cells based on hybridization chain reaction.
Detailed Description
In order that the above-recited objects, features and advantages of the present invention will become more apparent, a more particular description of the invention will be rendered by reference to specific embodiments thereof.
In the following description, numerous specific details are set forth in order to provide a thorough understanding of the present invention, but the present invention may be practiced in other ways other than those described herein, and persons skilled in the art will readily appreciate that the present invention is not limited to the specific embodiments disclosed below.
Further, reference herein to "one embodiment" or "an embodiment" means that a particular feature, structure, or characteristic can be included in at least one implementation of the invention. The appearances of the phrase "in one embodiment" in various places in the specification are not necessarily all referring to the same embodiment, nor are separate or alternative embodiments mutually exclusive of other embodiments.
Example 1:
and (5) working principle feasibility analysis.
The implementation steps are as follows:
1. diluting graphene oxide to 1 mg/ml by DEPC water, and uniformly mixing.
2. Fluorescent-labeled hairpin nucleic acid probes HCR1 and HCR2 (sequences 5' -ATTCCACCGGAGTCTGCAAAGTC, respectively) were dissolved in DEPC waterAGACTCCGGTGGAATGAAGGAFAM-3 'and 5' -FAM-ACTTTGCAGACTCCGGTGGAAT TCCTTCATTCCACCGGAGTCTG-3') formulated as 100×10 -6 And (3) mixing the solution in mol/L uniformly. miR-205 forms double strand with the underlined part of HCR1, the HCR1 probe is opened, the non-underlined part of HCR1 forms double strand with the underlined part of HCR2, the HCR2 probe is opened, the italic part of HCR2 forms double strand with the underlined part of HCR1, and the Hybridization Chain Reaction (HCR) is performed by circulating.
3. Dissolving miR-205 (sequence 5'-UCC UUC AUU CCA CCG GAG UCU G-3') in DEPC water to obtain 20×10 -6 And (3) mixing the solution in mol/L uniformly.
4. 7 samples were formulated with SPSC buffer. Wherein, the liquid crystal display device comprises a liquid crystal display device,
sample 1 was 100X 10 in final concentration -9 A mol/L HCR1 solution;
sample 2 was found to have a final concentration of 100X 10 -9 A mol/L HCR2 solution;
sample 3 was 100X 10 in final concentration -9 HCR1 in mol/L and final concentration of 100X 10 -9 A mixed solution of HCR2 in mol/L;
sample 4 was found to have a final concentration of 100X 10 -9 HCR1 in mol/L and final concentration of 100X 10 -9 mixing HCR2 with mol/L and graphene oxide solution with 120 mug/mL for reaction for 10 minutes;
sample 5 was 100X 10 at a final concentration -9 mol/L HCR1 solution and 200X 10 -9 Standing and reacting the mol/L miR-205 solution for 2 hours at 25 ℃, and adding 120 mu g/mL graphene oxide solution to mix and react for 10 minutes;
sample 6 was 100X 10 at a final concentration -9 mol/L HCR2 solution and 200X 10 -9 Standing and reacting the mol/L miR-205 solution for 2 hours at 25 ℃, and adding 120 mu g/mL graphene oxide solution to mix and react for 10 minutes;
sample 7 was found to have a final concentration of 100X 10 -9 mol/L HCR1 solution, 100X 10 -9 mol/L HCR2 solution and 200X 10 - 9 After standing and reacting for 2 hours at 25 ℃ of the mol/L miR-205 solution, 120 mug/mL graphene oxide solution is added for mixing and reacting for 10 minutes.
5. The fluorescence intensity was read using an F-7000 fluorescence spectrophotometer, wherein the excitation wavelength of the fluorescence spectrometer was set to 480 nm, the emission wavelength scan was set to be in the range of 500-600 nm, the excitation slit width was set to 5 nm, and the emission slit width was set to 2.5 nm.
6. 4 samples were prepared and bands were detected using SDS-PAGE electrophoresis: sample 1 was 100X 10 -9 HCR1 in mol/L, sample 2 was 100X 10 -9 HCR2 in mol/L, sample 3 was 40X 10 -9 miR-205 with mol/L and sample 4 containing 100×10 -9 mol/L HCR1, HCR2 and 40X 10 -9 A miR-205 mixed solution with mol/L. The results are shown in FIG. 3.
The SPSC buffer formula of the invention comprises the following components: 50X 10 -9 mol/L Na 2 HPO 4 1 mol/L NaCl, pH 7.4.
FIG. 1 is a schematic diagram showing the operation of the present invention, in which two hairpin nucleic acid probes are in a stable state with each other in a hybridization chain reaction, hairpin nucleic acid probes HCR1 and HCR2 are composed of a hairpin region, a single-stranded cohesive end and a double-stranded complementary region, and HCR1 sequence (5' -ATTCCACCGGAGTCTGCAAAGTCAGACTCCGGTGGAATGAAGGAIn FAM-3'), CAAAGT is a hairpin region, GAAGGA is a single-stranded cohesive end, and the remainder is a complementary double-stranded region; similarly, HCR2 sequence (5' -FAM-ACTTTGCAGACTCCGGTGGAA T TCCTTCATTCCACCGGAGTCTGIn-3'), TCCTTC is a hairpin region, acttttg is a single-stranded cohesive end, and the remainder is a complementary double-stranded region. When the trigger chain miR-205 does not exist, the single-stranded DNA at the tail ends of the two hairpin nucleic acid probes is adsorbed on the surface of the graphene oxide through pi-pi action, and the fluorescent group carried by the hairpin nucleic acid probes is quenched by the graphene oxide under the action of fluorescence resonance energy transfer. When the trigger strand miR-205 exists, the exposed sticky end of the first hairpin HCR1 is complementarily paired with the trigger strand, so that the hairpin HCR1 structure is opened, the exposed sticky end of the first hairpin HCR1 is complementarily paired with the sticky end of the second hairpin HCR2, so that the hairpin HCR2 structure is opened, and at the moment, the exposed sticky end of the HCR2 is identical to the sequence of the trigger strand, so that the structure of the hairpin nucleic acid probe is repeatedly opened. Finally, a hybrid double-stranded copolymer containing sticky ends is formed, and fluorescence is not quenched because double strand cannot be adsorbed by graphene oxide by pi-pi action. The method initiates fluorescence recovery by continuously opening two hairpin nucleic acid probe structures containing FAM fluorescent group markers, and the quantification of miR-205 can be realized by detecting fluorescence intensity in a system.
FIG. 2 is a fluorescence spectrum diagram of the feasibility analysis of the working principle, wherein after graphene oxide is added into a mixed system of HCR1 and HCR2, the fluorescence signal is obviously reduced, and the fact that graphene oxide can adsorb hairpin probes of HCR1 and HCR2 on the surface is proved, so that effective fluorescence quenching is caused. When miR-205 is added into an HCR1 and graphene oxide system, only simple hybridization of miR-205 and HCR1 occurs, and fluorescence is slightly recovered. When miR-205 is added into an HCR2 and graphene oxide system, no reaction occurs, and the fluorescence intensity is hardly changed. When miR-205 is added into the mixture of HCR1 and HCR2, obvious fluorescence enhancement can still be observed in the presence of graphene oxide, which indicates that a phenomenon of recovery of a large amount of fluorescence occurs, and the miR-205 successfully triggers hybridization chain reaction.
FIG. 3 is a graph of the feasibility of a hybridization chain reaction, showing that miR-205 successfully initiates the hybridization chain reaction by the presence of hybridization double-stranded copolymer bands of different lengths in lane 4 containing HCR1, HCR2 and miR-205, and confirming that the principle of an amplification strategy based on the hybridization chain reaction is feasible.
Example 2:
influence of graphene oxide with different concentrations on the adsorption effect of the nucleic acid probe.
The experimental steps are as follows:
1. diluting graphene oxide to 1 mg/ml by DEPC water, and uniformly mixing.
2. Fluorescent-labeled hairpin nucleic acid probes HCR1 and HCR2 (sequences 5' -ATTCCACCGGAGTCTGCAAAGTC, respectively) were dissolved in DEPC waterAGACTCCGGTGGAATGAAGGAFAM-3 'and 5' -FAM-ACTTTGCAGACTCCGGTGGAAT TCCTTCATTCCACC GGAGTCTG-3') formulated as 100×10 -6 And (3) mixing the solution in mol/L uniformly.
3. Dissolving miR-205 (sequence 5'-UCC UUC AUU CCA CCG GAG UCU G-3') in DEPC water to obtain 20×10 -6 And (3) mixing the solution in mol/L uniformly.
4. Will be 100X 10 -9 The mol/L HCR1 and HCR2 were incubated with different concentrations of graphene oxide (0, 20, 40, 60, 80, 100, 120, 140, 160. Mu.g/mL) for 10 min at room temperature.
5. Fluorescence readings were detected using a Hitachi F-7000 fluorescence spectrophotometer. The excitation wavelength was 480 nm, the excitation slit was 5 nm, the emission slit was 2.5 nm, and the fluorescence intensity of 520 nm was detected.
The experimental results are shown in FIG. 4, and the fluorescence intensity is minimized when the graphene oxide concentration is 140. Mu.g/mL. Therefore, the optimal concentration of graphene oxide is 140 μg/mL, where the fluorescent background is the lowest.
Example 3:
effect of different concentrations of nucleic acid probe on fluorescence background value.
The experimental steps are as follows:
1. diluting graphene oxide to 1 mg/ml by DEPC water, and uniformly mixing.
2. Fluorescent-labeled hairpin nucleic acid probes HCR1 and HCR2 (sequences 5' -ATTCCACCGGAGTCTGCAAAGTC, respectively) were dissolved in DEPC waterAGACTCCGGTGGAATGAAGGAFAM-3 'and 5' -FAM-ACTTTGCAGACTCCGGTGGAAT TCCTTCATTCCACC GGAGTCTG-3') formulated as 100×10 -6 And (3) mixing the solution in mol/L uniformly.
3. Dissolving miR-205 (sequence 5'-UCC UUC AUU CCA CCG GAG UCU G-3') in DEPC water to obtain 20×10 -6 And (3) mixing the solution in mol/L uniformly.
4. Will be 200X 10 -9 The miR-205 solution with the mol/L concentration is mixed with HCR1 and HCR2 solutions with different concentrations, and the mixture is kept stand for reaction for 2 hours at 25 ℃.
5. And adding the graphene oxide solution with the concentration of 140 mug/mL into the mixed solution, oscillating, uniformly mixing, and incubating for 10 minutes at room temperature.
6. The reading was performed using a Hitachi F-7000 fluorescence spectrophotometer. The excitation wavelength was 480 nm, the excitation slit was 5 nm, the emission slit was 2.5 nm, and the fluorescence intensity of 520 nm was detected.
As a result of the experiment, as shown in FIG. 5, it can be seen that when the concentrations of the two probes were 100X 10 -9 At mol/L, the amplification effect of fluorescent signal fluctuates at 100X 10 -9 The effect of mol/L is optimal, and therefore, the concentration of the nucleic acid probe is selected to be 100X 10 -9 mol/L is the optimal concentration.
Example 4:
influence of different temperatures on the effect of the hybridization chain reaction.
The experimental steps are as follows:
1. diluting graphene oxide to 1 mg/ml by DEPC water, and uniformly mixing.
2. Fluorescent-labeled hairpin nucleic acid probes HCR1 and HCR2 (sequences 5' -ATTCCACCGGAGTCTGCAAAGTC, respectively) were dissolved in DEPC waterAGACTCCGGTGGAATGAAGGAFAM-3 'and 5' -FAM-ACTTTGCAGACTCCGGTGGAAT TCCTTCATTCCACC GGAGTCTG-3') formulated as 100×10 -6 And (3) mixing the solution in mol/L uniformly.
3. Dissolving miR-205 (sequence 5'-UCC UUC AUU CCA CCG GAG UCU G-3') in DEPC water to obtain 20×10 -6 And (3) mixing the solution in mol/L uniformly.
4. Will be 100X 10 -9 HCR1 solution with mol/L concentration of 100X 10 -9 HCR2 solution with mol/L concentration200 ×10 -9 miR-205 solution with mol/L concentration is mixed and kept stand for reaction for 2 hours at 25 ℃ and 37 ℃ respectively.
5. And adding graphene oxide solutions with different concentrations into the mixed solution, oscillating, uniformly mixing, and incubating for 10 minutes at room temperature.
6. A Hitachi F-7000 fluorescence spectrophotometer was used. The excitation wavelength was 480 nm, the excitation slit was 5 nm, the emission slit was 2.5 nm, and the fluorescence intensity of 520 nm was detected.
As shown in fig. 6, it can be seen that the initial fluorescence intensity is higher at 25 ℃ and the fluorescence response range is larger at different graphene oxide concentrations than at 37 ℃, so that 25 ℃ is selected as the reaction temperature.
Example 5:
influence of different time periods on the hybridization chain reaction effect.
1. Diluting graphene oxide to 1 mg/ml by DEPC water, and uniformly mixing.
2. Fluorescent-labeled hairpin nucleic acid probes HCR1 and HCR2 (sequences 5' -ATTCCACCGGAGTCTGCAAAGTC, respectively) were dissolved in DEPC waterAGACTCCGGTGGAATGAAGGAFAM-3 'and 5' -FAM-ACTTTGCAGACTCCGGTGGAA T TCCTTCATTCCACC GGAGTCTG-3') formulated as 100×10 -6 And (3) mixing the solution in mol/L uniformly.
3. Dissolving miR-205 (sequence 5'-UCC UUC AUU CCA CCG GAG UCU G-3') in DEPC water to obtain 20×10 -6 And (3) mixing the solution in mol/L uniformly.
4. Will be 100X 10 -9 HCR1 solution with mol/L concentration of 100X 10 -9 HCR2 solution with mol/L concentration and 200X 10 -9 And mixing and standing miR-205 solution with mol/L concentration, and reacting at 25 ℃ for different time periods respectively.
5. And adding the graphene oxide solution with the concentration of 140 mug/mL into the mixed solution, oscillating, uniformly mixing, and incubating for 10 minutes at room temperature.
6. The reading was performed using a Hitachi F-7000 fluorescence spectrophotometer. The excitation wavelength was 480 nm, the excitation slit was 5 nm, the emission slit was 2.5 nm, and the fluorescence intensity of 520 nm was detected.
As shown in FIG. 7, it can be seen that when the reaction time exceeds 60 minutes, the reaction conditions in the system are substantially balanced, and 60 minutes is selected as the reaction duration of the experiment.
Example 6:
fluorescence spectrograms of the graphene oxide sensor based on hybridization chain reaction for miR-205 detection of different concentrations.
The experimental steps are as follows:
1. diluting graphene oxide to 1 mg/ml by DEPC water, and uniformly mixing.
2. Fluorescent-labeled hairpin nucleic acid probes HCR1 and HCR2 (sequences 5' -ATTCCACCGGAGTCTGCAAAGTC, respectively) were dissolved in DEPC waterAGACTCCGGTGGAATGAAGGAFAM-3 'and 5' -FAM-ACTTTGCAGACTCCGGTGGAAT TCCTTCATTCCACC GGAGTCTG-3') formulated as 100×10 -6 And (3) mixing the solution in mol/L uniformly.
3. Will be 100X 10 -9 HCR1 solution with mol/L concentration of 100X 10 -9 HCR2 solutions at mol/L concentration and concentrations of 0, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1, 10, 20, 30, 40, 50, 100, 150, 200X 10, respectively - 9 mixing and standing the miR-205 solution with mol/L.
4. After 2 hours of reaction at 25 ℃, graphene oxide solution with a concentration of 140 mug/mL is added, mixed well and incubated for 10 min at room temperature.
5. The reading was performed using a Hitachi F-7000 fluorescence spectrophotometer. The excitation wavelength was 480 nm, the excitation slit was 5 nm, the emission slit was 2.5 nm, and the fluorescence intensity of 520 nm was detected.
As shown in FIG. 8, it can be seen that when the concentration of miR-205 is 0-1X 10 -9 When the mol/L is in the range, the fluorescence intensity is linearly related to the miR-205 concentration, and the linear equation is F=201.53X+337.91, and the correlation coefficient R 2 =0.963. According to the formula 3 sigma/k, the detection limit is calculated to be 21 multiplied by 10 -12 mol/L。
Example 7:
specific response of graphene oxide sensor to miR-205 based on hybridization chain reaction.
The experimental steps are as follows:
1. diluting graphene oxide to 1 mg/ml by DEPC water, and uniformly mixing.
2. Fluorescent-labeled hairpin nucleic acid probes HCR1 and HCR2 (sequences 5' -ATTCCACCGGAGTCTGCAAAGTC, respectively) were dissolved in DEPC waterAGACTCCGGTGGAATGAAGGAFAM-3 'and 5' -FAM-ACTTTGCAGACTCCGGTGGAAT TCCTTCATTCCACC GGAGTCTG-3') formulated as 100×10 -6 And (3) mixing the solution in mol/L uniformly.
3. Will be 100X 10 -9 HCR1 solution with mol/L concentration of 100X 10 -9 HCR2 at mol/L concentration and 200X 10 - 9 NC, miRNA-21, let-7a, miRNA-141, RM3 (sequence of miR-205 mismatched with 3 bases), RM2 (sequence of miR-205 mismatched with 2 bases), RM1 (sequence of miR-205 mismatched with 1 base) and miR-205 solutions with mol/L concentration are respectively mixed and stood.
4. After 2 hours of reaction at 25 ℃, graphene oxide solution with a concentration of 140 mug/mL is added, mixed well and incubated for 10 min at room temperature.
5. The reading was performed using a Hitachi F-7000 fluorescence spectrophotometer. The excitation wavelength was 480 nm, the excitation slit was 5 nm, the emission slit was 2.5 nm, and the fluorescence intensity of 520 nm was detected.
As shown in the experimental results in FIG. 9, it can be seen that the non-complementary targets (NC, miRNA-21, let-7a and miRNA-141) do not cause obvious fluorescence signal change, the fluorescence change rate gradually increases with the decrease of the number of mismatched bases, and the RNA with one base mismatch has about only half of the fluorescence signal change relative to the target RNA, thus indicating that the detection platform has excellent specificity for detecting miR-205.
Example 8:
the feasibility of the graphene oxide sensor based on hybridization chain reaction in 1%o fetal bovine serum was analyzed.
The experimental steps are as follows:
1. 8 samples were formulated with SPSC buffer.
Sample 1 is a solution of fetal bovine serum with a final concentration of 1%;
sample 2 was fetal bovine serum at a final concentration of 1% -9 HCR1 and 100X 10 in mol/L -9 After 2 hours of standing reaction of HCR2 solution with mol/L at 25 ℃, addAdding a graphene oxide solution with a final concentration of 180 mug/mL, and mixing and reacting for 10 minutes;
sample 3 was 1.mu.m fetal bovine serum, 1X 10 -9 miR-205 of mol/L and 100X 10 -9 HCR1 and 100X 10 in mol/L -9 After standing and reacting for 2 hours at 25 ℃ of the HCR2 solution with mol/L, adding the graphene oxide solution with the final concentration of 180 mug/mL, and mixing and reacting for 10 minutes;
sample 4 was fetal bovine serum at a final concentration of 1% -9 miR-205 of mol/L and 100X 10 -9 HCR1 and 100X 10 in mol/L -9 After standing and reacting for 2 hours at 25 ℃ of the HCR2 solution with mol/L, adding the graphene oxide solution with the final concentration of 180 mug/mL, and mixing and reacting for 10 minutes;
sample 5 was fetal bovine serum at a final concentration of 1% -9 miR-205 of mol/L and 100X 10 -9 HCR1 and 100X 10 in mol/L -9 After standing and reacting for 2 hours at 25 ℃ of the HCR2 solution with mol/L, adding the graphene oxide solution with the final concentration of 180 mug/mL, and mixing and reacting for 10 minutes;
sample 6 was fetal bovine serum at a final concentration of 1% -9 miR-205 of mol/L and 100X 10 -9 HCR1 and 100X 10 in mol/L -9 After standing and reacting for 2 hours at 25 ℃ of the HCR2 solution with mol/L, adding the graphene oxide solution with the final concentration of 180 mug/mL, and mixing and reacting for 10 minutes;
sample 7 was fetal bovine serum at a final concentration of 1% -9 miR-205 of mol/L and 100X 10 -9 HCR1 and 100X 10 in mol/L -9 After standing and reacting for 2 hours at 25 ℃ of the HCR2 solution with mol/L, adding the graphene oxide solution with the final concentration of 180 mug/mL, and mixing and reacting for 10 minutes;
sample 8 was fetal bovine serum at a final concentration of 1% -9 HCR1 and 100X 10 in mol/L -9 The solution was allowed to stand still at 25℃for 2 hours after the reaction of the mol/L HCR2 solution.
2. Photographs were taken of the above 8 samples under a fluorescence microscope.
The experimental result is shown in figure 10, and it can be seen that the fluorescence brightness is continuously enhanced along with the increase of the miR-205 concentration in the reaction system, and the stability is higher, so that the detection method is proved to be suitable for the environment of 1%o fetal bovine serum.
Example 9:
in 1%fetal calf serum, the influence of graphene oxide with different concentrations on the adsorption effect of the nucleic acid probe.
The experimental steps are as follows:
1. diluting graphene oxide to 1 mg/ml by DEPC water, and uniformly mixing.
2. Fluorescent-labeled hairpin nucleic acid probes HCR1 and HCR2 (sequences 5' -ATTCCACCGGAGTCTGCAAAGTC, respectively) were dissolved in DEPC waterAGACTCCGGTGGAATGAAGGAFAM-3 'and 5' -FAM-ACTTTGCAGACTCCGGTGGAAT TCCTTCATTCCACC GGAGTCTG-3') formulated as 100×10 -6 And (3) mixing the solution in mol/L uniformly.
3. 100X 10 is added into 1% -9 HCR1 and 100X 10 at mol/L concentration -9 HCR2 solution with mol/L concentration.
4. 200X 10 is added into the mixed solution -9 mixing and standing the miR-205 solution with mol/L, reacting for 2 hours at 25 ℃, and adding graphene oxide solutions with the concentrations of 0, 30, 60, 90, 120, 150, 180, 210, 240, 270 and 300 mug/mL respectively.
5. The reading was performed using a Hitachi F-7000 fluorescence spectrophotometer. The excitation wavelength was 480 nm, the excitation slit was 5 nm, the emission slit was 2.5 nm, and the fluorescence intensity of 520 nm was detected.
As shown in FIG. 11, it can be seen that the decrease in fluorescence intensity was no longer evident when the graphene oxide concentration reached 180. Mu.g/mL. Thus, the optimal concentration of graphene oxide is 180 μg/mL.
Example 10:
in 1%fetal bovine serum, graphene oxide sensors based on hybridization chain reaction respond to miR-205 with different concentration gradients.
The experimental steps are as follows:
1. diluting graphene oxide to 1 mg/ml by DEPC water, and uniformly mixing.
2. Fluorescent-labeled hairpin nucleic acid probes HCR1 and HCR2 (sequences 5' -ATTCCACCGGAGTCTGCAAAGTC, respectively) were dissolved in DEPC waterAGACTCCGGTGGAATGAAGGAFAM-3 'and 5' -FAM-ACTTTGCAGACTCCGGTGGAAT TCCTTCATTCCACC GGAGTCTG-3') formulated as 100×10 -6 And (3) mixing the solution in mol/L uniformly.
3. 100X 10 is added into 1% -9 HCR1 and 100X 10 at mol/L concentration -9 HCR2 solution with mol/L concentration.
4. Adding 0, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1, 3, 5, 7, 10, 20, 30, 40, 50, 100, 150, 200×10 into the above mixed solution -9 mixing and standing the miR-205 solution with mol/L.
5. After 2 hours of reaction at 25 ℃, a graphene oxide solution at a concentration of 180 μg/mL was added.
6. The reading was performed using a Hitachi F-7000 fluorescence spectrophotometer. The excitation wavelength was 480 nm, the excitation slit was 5 nm, the emission slit was 2.5 nm, and the fluorescence intensity of 520 nm was detected.
As shown in FIG. 12, it can be seen that when the concentration of miR-205 is 0-1X 10 -9 When the mol/L is in the range, the fluorescence intensity is linearly related to the miR-205 concentration, and the linear equation is F=72.34X+272.82, and the correlation coefficient R 2 =0.994. According to the formula 3 sigma/k, the detection limit is calculated to be 214 multiplied by 10 -12 mol/L。
Example 11:
in 1%fetal bovine serum, the specific response condition of the oxidized graphene sensor to miR-205 based on hybridization chain reaction.
The experimental steps are as follows:
1. diluting graphene oxide to 1 mg/ml by DEPC water, and uniformly mixing.
2. Fluorescent-labeled hairpin nucleic acid probes HCR1 and HCR2 (sequences 5' -ATTCCACCGGAGTCTGCAAAGTC, respectively) were dissolved in DEPC waterAGACTCCGGTGGAATGAAGGAFAM-3 'and 5' -FAM-ACTTTGCAGACTCCGGTGGAAT TCCTTCATTCCACC GGAGTCTG-3') formulated as 100×10 -6 And (3) mixing the solution in mol/L uniformly.
3. 100X 10 is added into 1% -9 HCR1 and 100X 10 at mol/L concentration -9 HCR2 solution with mol/L concentration.
4. Adding 200×10 of the above mixed solution -9 mol/L NC, miRNA-21, let-7a, miRNA-141, RM3 (sequence of miR-205 mismatched with 3 bases), RM2 (sequence of miR-205 mismatched with 2 bases), RM1 (sequence of miR-205 mismatched with 1 base), miR-205 solution are mixed and stood.
5. After 2 hours of reaction at 25 ℃, a graphene oxide solution at a concentration of 180 μg/mL was added.
6. The reading was performed using a Hitachi F-7000 fluorescence spectrophotometer. The excitation wavelength was 480 nm, the excitation slit was 5 nm, the emission slit was 2.5 nm, and the fluorescence intensity of 520 nm was detected.
As shown in the experimental results in FIG. 13, it can be seen that the non-complementary targets (NC, miRNA-21, let-7a and miRNA-141) do not cause obvious fluorescence signal change, the fluorescence change rate gradually increases with the decrease of mismatched base numbers, and the fluorescence signal change of RNA with one base mismatch relative to the target RNA is less than half, thus proving that the detection platform has excellent specificity for detecting miR-205 in 1%fetal bovine serum.
Example 12:
fluorescent imaging of graphene oxide sensors in different cells based on hybridization chain reactions.
The experimental steps are as follows:
1. diluting graphene oxide to 1 mg/ml by DEPC water, and uniformly mixing.
2. Fluorescent-labeled hairpin nucleic acid probes HCR1 and HCR2 (sequences 5' -ATTCCACCGGAGTCTGCAAAGTC, respectively) were dissolved in DEPC waterAGACTCCGGTGGAATGAAGGAFAM-3 'and 5' -FAM-ACTTTGCAGACTCCGGTGGAAT TCCTTCATTCCACC GGAGTCTG-3') formulated as 100×10 -6 And (3) mixing the solution in mol/L uniformly.
3. Respectively inoculating HepG2 (non-miR-205 expression), KYSE-150 (miR-205 low expression) and KYSE-140 (miR-205 high expression) cells into confocal culture dish, wherein the number of inoculated cells is 3×10 4 And 5% CO at 37deg.C 2 Culture 24 h in incubator.
4. The concentrations were 100X 10 respectively -9 mol/L HCR1 and HCR2 with 180. Mu.g/mL oxygenThe graphene is mixed for 2 hours to ensure that HCR1 and HCR2 are completely adsorbed on the GO surface.
5. The graphene oxide mixed system containing HCR1 and HCR2 and 3 cells are respectively co-cultured for 6 hours, the cells are washed by 1ml PBS for 5 times, and nuclei are stained by DAPI solution.
6. Confocal laser imaging was performed at 488 nm excitation wavelength.
As shown in FIG. 14, the fluorescence intensities in KYSE-140 cells, KYSE-150 cells and HepG2 cells were from strong to weak, demonstrating that the hybridization chain reaction was triggered and imaged by miR-205 in KYSE-140 cells.
Example 13:
the graphene oxide sensor based on hybridization chain reaction is subjected to labeling recovery detection under the condition of 1 per mill of fetal bovine serum.
The experimental steps are as follows:
1. diluting graphene oxide to 1 mg/ml by DEPC water, and uniformly mixing.
2. Fluorescent-labeled hairpin nucleic acid probes HCR1 and HCR2 (sequences 5' -ATTCCACCGGAGTCTGCAAAGTC, respectively) were dissolved in DEPC waterAGACTCCGGTGGAATGAAGGAFAM-3 'and 5' -FAM-ACTTTGCAGACTCCGGTGGAAT TCCTTCATTCCACC GGAGTCTG-3') formulated as 100×10 -6 And (3) mixing the solution in mol/L uniformly.
3. 100X 10 is added into 1% -9 HCR1 and 100X 10 at mol/L concentration -9 HCR2 solution with mol/L concentration.
4. Adding 0.2, 0.4, 0.6, 0.8, 1×10 concentrations of the above mixed solution -9 mixing and standing the miR-205 solution with mol/L.
5. After 2 hours of reaction at 25 ℃, a graphene oxide solution at a concentration of 180 μg/mL was added.
6. The reading was performed using a Hitachi F-7000 fluorescence spectrophotometer. The excitation wavelength was 480 nm, the excitation slit was 5 nm, the emission slit was 2.5 nm, and the fluorescence intensity of 520 nm was detected.
7. Substituting the concentration into a linear equation to calculate the concentration, comparing the concentration with the standard adding concentration, and simultaneously calculating the recovery rate and the RSD value.
The experimental results are shown in table 1, and it can be seen that a good recovery rate is obtained in 1%o fetal bovine serum, and the RSD value is always lower than 2% in 96.74% -122.17%, which indicates that the graphene oxide biosensor based on the hybridization chain reaction can be successfully applied to the labeling detection of 1%o fetal bovine serum samples.
The method has the advantages of simple operation, rapid detection and high sensitivity, and the detection limit of miR-205 in the SPSC buffer solution reaches 21 multiplied by 10 -12 The miR-205 detection method has very high specificity. In 1%fetal calf serum, the detection limit of miR-205 reaches 214 multiplied by 10 -12 The miR-205 detection method has very high specificity in 1 per mill of fetal bovine serum.
Table 1 sensor is in 1%
While the invention has been described with reference to the preferred embodiments, it is not limited thereto, and various changes and modifications can be made therein by those skilled in the art without departing from the spirit and scope of the invention as defined in the appended claims.

Claims (8)

1. A biosensor for detecting miR-205 is characterized by comprising miR-205, a hairpin nucleic acid probe HCR1, a hairpin nucleic acid probe HCR2, graphene oxide and buffer;
the nucleotide sequence of miR-205 is UCCUUCAUUCCACCGGAGUCUG;
the 5' -ends of the nucleotide sequences of the hairpin nucleic acid probes HCR1 and HCR2 are respectively connected with fluorescein;
the nucleotide sequence of HCR1 is ATTCCACCGGAGTCTGCAAAGTCAGACTCCGGTGGAATGAAGGA;
the nucleotide sequence of HCR2 is ACTTTGCAGACTCCGGTGGAATTCCTTCATTCCACCGGAGTCTG.
2. The biosensor for detecting miR-205 of claim 1, wherein the fluorescein label comprises 5-carboxyfluorescein.
3. Use of the biosensor of claim 1 or 2 for detecting miR-205 in non-disease diagnosis.
4. The use according to claim 3, wherein the assay is a qualitative or quantitative assay.
5. The method for detecting the purpose of non-disease diagnosis of miR-205 by using the biosensor in accordance with claim 1 or 2, which is characterized in that graphene oxide is added into a solution containing HCR1 and HCR2 for mixed incubation, so that a graphene oxide solution carrying hairpin nucleic acid probes is obtained, and after co-culture with cells, laser confocal imaging is carried out.
6. The method according to claim 5, wherein the concentration of the hairpin nucleic acid probe solution is 90 to 120X 10 -9 mol/L; the concentration of the graphene oxide is 180-200 mu g/mL; the incubation time is at least 5 min; the time for co-culturing the graphene oxide solution loaded with the hairpin nucleic acid probe and the cells is 4-8 hours.
7. The method for detecting the purpose of non-disease diagnosis of miR-205 by using the biosensor in accordance with claim 1 or 2, which is characterized in that a solution to be detected is added into a solution containing HCR1 and HCR2 for mixed incubation, graphene oxide is added for reaction, and fluorescence intensity is detected by using a fluorescence spectrophotometer.
8. The method according to claim 7, wherein the concentration of the hairpin nucleic acid probe solution is 90 to 120X 10 -9 mol/L; the concentration of the graphene oxide is 140-160 mu g/mL; the incubation time is at least 1 h, and the incubation temperature is 22-27 ℃.
CN202110826871.9A 2021-07-21 2021-07-21 Method for detecting nasopharyngeal carcinoma anti-radiotherapy biomarker based on hybridization chain reaction Active CN113549692B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202110826871.9A CN113549692B (en) 2021-07-21 2021-07-21 Method for detecting nasopharyngeal carcinoma anti-radiotherapy biomarker based on hybridization chain reaction

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202110826871.9A CN113549692B (en) 2021-07-21 2021-07-21 Method for detecting nasopharyngeal carcinoma anti-radiotherapy biomarker based on hybridization chain reaction

Publications (2)

Publication Number Publication Date
CN113549692A CN113549692A (en) 2021-10-26
CN113549692B true CN113549692B (en) 2023-07-25

Family

ID=78132377

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202110826871.9A Active CN113549692B (en) 2021-07-21 2021-07-21 Method for detecting nasopharyngeal carcinoma anti-radiotherapy biomarker based on hybridization chain reaction

Country Status (1)

Country Link
CN (1) CN113549692B (en)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN114032339B (en) * 2021-12-22 2023-09-01 湖南工程学院 Hyperbranched hybridization chain reaction signal amplification system for detecting nasopharyngeal carcinoma, kit and detection method

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN105112445A (en) * 2015-06-02 2015-12-02 广州辉园苑医药科技有限公司 MiR-205 gene knockout kit based on CRISPR-Cas9 gene knockout technology
CN109536612A (en) * 2018-12-24 2019-03-29 朱伟 One kind blood plasma miRNA marker relevant to nasopharyngeal carcinoma auxiliary diagnosis and its application
CN111549124A (en) * 2020-06-17 2020-08-18 黑龙江八一农垦大学 Molecular marker for detecting staphylococcus aureus mastitis of dairy cows and application thereof
CN112043837A (en) * 2020-08-25 2020-12-08 北京大学第一医院 Application of MiR-205-5p in preparation of angiogenesis agent

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20090099034A1 (en) * 2007-06-07 2009-04-16 Wisconsin Alumni Research Foundation Reagents and Methods for miRNA Expression Analysis and Identification of Cancer Biomarkers

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN105112445A (en) * 2015-06-02 2015-12-02 广州辉园苑医药科技有限公司 MiR-205 gene knockout kit based on CRISPR-Cas9 gene knockout technology
CN109536612A (en) * 2018-12-24 2019-03-29 朱伟 One kind blood plasma miRNA marker relevant to nasopharyngeal carcinoma auxiliary diagnosis and its application
CN111549124A (en) * 2020-06-17 2020-08-18 黑龙江八一农垦大学 Molecular marker for detecting staphylococcus aureus mastitis of dairy cows and application thereof
CN112043837A (en) * 2020-08-25 2020-12-08 北京大学第一医院 Application of MiR-205-5p in preparation of angiogenesis agent

Also Published As

Publication number Publication date
CN113549692A (en) 2021-10-26

Similar Documents

Publication Publication Date Title
Zhang et al. Multiplexed detection of microRNAs by tuning DNA-scaffolded silver nanoclusters
CN109001167B (en) Method and kit for detecting Adenosine Triphosphate (ATP) by using strand displacement signal amplification fluorescent sensor based on aptamer and carbon dot
Wang et al. Target-assisted FRET signal amplification for ultrasensitive detection of microRNA
CN105506136B (en) A method of microRNA is detected based on rolling circle amplification and up-conversion
Zouari et al. Ultrasensitive determination of microribonucleic acids in cancer cells with nanostructured-disposable electrodes using the viral protein p19 for recognition of ribonucleic acid/microribonucleic acid homoduplexes
CN106957908A (en) MiRNA and/or target molecules with aptamer detection method and detection probe
CN104928390B (en) A kind of MicroRNA detection method
CN113549692B (en) Method for detecting nasopharyngeal carcinoma anti-radiotherapy biomarker based on hybridization chain reaction
Li et al. Lighting-up RNA aptamer transcription synchronization amplification for ultrasensitive and label-free imaging of microRNA in single cells
Chen et al. A cancer cell membrane vesicle-packaged DNA nanomachine for intracellular microRNA imaging
CN112961907B (en) Fluorescent biosensor for simultaneously detecting two RNAs and preparation and use methods thereof
CN109913534A (en) A method of two kinds of miRNA based on concatenated dna chain circular response and fluorescence resonance energy transfer effect are detected simultaneously
CN112501257B (en) Visualization sensor based on nucleic acid self-assembly enzyme-catalysis-free circRNA living cell imaging
CN110592186B (en) AND molecular logic gate sensing system AND preparation method AND application thereof
CN113462753B (en) Click chemistry mediated single quantum dot nano sensor, method for detecting miRNAs and application
CN114507706B (en) Enzyme DNA repair cascade driving fluorophore coding/de-coding based biosensor and application thereof in telomerase detection
Lan et al. A photoluminescent biosensor based on long-range self-assembled DNA cascades and upconversion nanoparticles for the detection of breast cancer-associated circulating microRNA in serum samples
CN115808409A (en) Construction of ratiometric fluorescence biosensor based on nano platform and double-signal amplification and miRNA detection application
CN111690722A (en) ATP detection nucleic acid sensor based on entropy driving and hybrid chain reaction and preparation method thereof
CN114540503B (en) Tumor inhibition factor kit Let-7a detection kit based on strand displacement and enzyme-assisted circulation signal amplification and application method thereof
CN110564817A (en) light-up silver cluster probe-based fluorescence biosensor and application thereof in miR-122 detection
CN113528666B (en) Multi-type non-coding RNA detection method and application thereof in gastric cancer early warning
CN109652502B (en) Method and kit for label-free fluorescence detection of gene
US11814672B2 (en) Complex of LNA probe and graphene oxide and nucleic acid detection method using same
CN116731709B (en) DON (DON) -control-based method for simultaneously imaging cells of DON and miR-34a by using double-color composite probe

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant