CN113549692A - Method for detecting radiotherapeutic biomarker for nasopharyngeal carcinoma based on hybrid chain reaction - Google Patents

Method for detecting radiotherapeutic biomarker for nasopharyngeal carcinoma based on hybrid chain reaction Download PDF

Info

Publication number
CN113549692A
CN113549692A CN202110826871.9A CN202110826871A CN113549692A CN 113549692 A CN113549692 A CN 113549692A CN 202110826871 A CN202110826871 A CN 202110826871A CN 113549692 A CN113549692 A CN 113549692A
Authority
CN
China
Prior art keywords
mir
solution
graphene oxide
hcr1
hcr2
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN202110826871.9A
Other languages
Chinese (zh)
Other versions
CN113549692B (en
Inventor
杨兆琪
羊杜涛
殷少贤
秦兰
蔡燕飞
金坚
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Jiangnan University
Original Assignee
Jiangnan University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Jiangnan University filed Critical Jiangnan University
Priority to CN202110826871.9A priority Critical patent/CN113549692B/en
Publication of CN113549692A publication Critical patent/CN113549692A/en
Application granted granted Critical
Publication of CN113549692B publication Critical patent/CN113549692B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813—Hybridisation assays
    • C12Q1/6816—Hybridisation assays characterised by the detection means
    • C12Q1/6825—Nucleic acid detection involving sensors
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/106—Pharmacogenomics, i.e. genetic variability in individual responses to drugs and drug metabolism
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/158—Expression markers
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/178—Oligonucleotides characterized by their use miRNA, siRNA or ncRNA
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Abstract

The invention discloses a method for detecting radioresistance therapy biomarkers of nasopharyngeal carcinoma based on hybrid chain reaction, belonging to the field of molecular biology. The invention discloses a biosensor for detecting radiotherapeutic biomarkers for nasopharyngeal carcinoma based on hybrid chain reaction, which comprises miR-205, a hairpin nucleic acid probe HCR1, HCR2 and graphene oxide. According to the invention, through the design of hairpin nucleic acid probes HCR1 and HCR2, the detection of a target miR-205 in a living cell and the quantitative detection and the directional detection of miR-205 in a solution to be detected are completed by utilizing the biocompatibility and the fluorescence quenching effect of graphene oxide. The miR-205 serving as a biomarker is detected more accurately, in real time and efficiently.

Description

Method for detecting radiotherapeutic biomarker for nasopharyngeal carcinoma based on hybrid chain reaction
Technical Field
The invention relates to a method for detecting radioresistance therapy biomarkers of nasopharyngeal carcinoma based on hybrid chain reaction, belonging to the field of molecular biology.
Background
Nasopharyngeal carcinoma refers to malignant tumors occurring at the top and lateral walls of the nasopharyngeal cavity, the incidence rate of the malignant tumors is the first of otorhinolaryngological tumors, and the incidence rate of the malignant tumors is highest in China and south-east Asia countries in the world. Most of nasopharyngeal carcinoma has moderate sensitivity to radiotherapy, so radiotherapy is a radical treatment means which is generally accepted and effective at present, simple radiotherapy is adopted in the early stage, and radiotherapy and chemotherapy comprehensive treatment means which mainly adopts radiotherapy is adopted in the late stage. At present, the radiotherapy sensitivity of tumor is usually judged clinically by the hypoxic condition, and the most common method for clinical hypoxic detection is an oxygen electrode method for directly detecting the oxygen partial pressure of tumor tissues. However, this detection technique requires invasive means and can only assess the local hypoxic state of the tumor. Therefore, there is an urgent need to develop a non-invasive and comprehensive detection method for determining the radiotherapy sensitivity of nasopharyngeal carcinoma patients and determining a personalized clinical treatment scheme for the patients so as to avoid delaying treatment.
MircoRNAs (miRNAs) are single-stranded non-coding small RNA molecules with the length of about 20-24nt and the regulatory function. The existing research shows that the content of miR-205 in radioresistant and radiotherapy cells of nasopharyngeal carcinoma is obviously higher, and the cells can be used as biomarkers of radiotherapeutic reaction of patients with nasopharyngeal carcinoma. The traditional miRNA quantitative detection method comprises real-time fluorescence quantitative PCR, a microarray method, Northern blot and the like, but has the problems of complex operation, expensive instrument, low sensitivity and the like.
Disclosure of Invention
This section is for the purpose of summarizing some aspects of embodiments of the invention and to briefly introduce some preferred embodiments. In this section, as well as in the abstract and the title of the invention of this application, simplifications or omissions may be made to avoid obscuring the purpose of the section, the abstract and the title, and such simplifications or omissions are not intended to limit the scope of the invention.
The invention overcomes the defects in the prior art and provides a biosensor for detecting miR-205.
In order to solve the technical problems, the invention provides the following technical scheme:
the first purpose of the invention is to provide a biosensor for detecting miR-205, which comprises miR-205, a hairpin nucleic acid probe HCR1, a hairpin nucleic acid probe HCR2, graphene oxide and buffer;
the nucleotide sequence of miR-205 is shown in SEQ ID NO. 1;
the nucleotide sequence of hairpin nucleic acid probe HCR1 contained sequence a and sequence B; the nucleotide sequence of hairpin nucleic acid probe HCR2 contained sequence B and sequence C;
the nucleotide sequence of sequence A is complementary with that of miR-205, sequence B is complementary with sequence B, and sequence C is TCCTTCATTCCACCGGAGTCTG;
the 5' ends of the nucleotide sequences of the hairpin nucleic acid probes HCR1 and HCR2 are linked to fluorescein.
In one embodiment, the sequence a is AGACTCCGGTGGAATGAAGGA and the sequence B is ACTTTGCAGACTCCGGTGGAAT.
In one embodiment, the nucleotide sequence of HCR1 is set forth in SEQ ID No.1 and the nucleotide sequence of HCR2 is set forth in SEQ ID No. 2.
In one embodiment, the fluorescein label includes, but is not limited to, 5-carboxyfluorescein.
In one embodiment, the buffer is an SPSC buffer; the formula of the SPSC buffer solution is 50 multiplied by 10-9mol/LNa2HPO41mol/L NaCl, pH 7.4.
The invention also provides application of the biosensor in detecting miR-205 in non-disease diagnosis.
In one embodiment, the detection is a qualitative or quantitative detection.
According to the method for carrying out non-disease diagnosis on miR-205 by the biosensor, graphene oxide is added into a solution containing HCR1 and HCR2 for mixed incubation to obtain a graphene oxide solution loaded with a hairpin nucleic acid probe, and after the graphene oxide solution is co-cultured with cells, laser confocal imaging is carried out.
In one embodiment, the concentration of the hairpin nucleic acid probe solution is 90-120X 10-9mol/L; the concentration of the graphene oxide is 180-200 mug/mL; the incubation time is at least 5 min; the co-culture time of the graphene oxide solution loaded with the hairpin nucleic acid probe and the cells is4～8h。
The biosensor is used for carrying out non-disease diagnosis on the miR-205, the solution to be detected is added into the solution containing HCR1 and HCR2 for mixed incubation, graphene oxide is added for reaction, and a fluorescence spectrophotometer is used for detecting fluorescence intensity.
In one embodiment, the concentration of the hairpin nucleic acid probe solution is 90-120X 10-9mol/L; the concentration of the graphene oxide is 140-160 mu g/mL; the incubation time is at least 1h, and the incubation temperature is 22-27 ℃.
The invention has the beneficial effects that: the method has the advantages of simple operation, rapid detection and high sensitivity, and the detection limit of miR-205 reaches 2.1 multiplied by 10-11mol/L, the miR-205 detection method has very high specificity, the detection recovery rate of the sensor in 1 per mill fetal calf serum is 96-122.17%, and the RSD (%) is 0.25-1.69.
Drawings
Fig. 1 is a schematic diagram of the working principle of the present invention.
FIG. 2 is a fluorescence spectrum of feasibility analysis of the working principle.
FIG. 3 is a diagram of nucleic acid electrophoresis for feasibility analysis of working principle.
FIG. 4 shows the effect of different concentrations of graphene oxide on the adsorption effect of nucleic acid probes.
FIG. 5 is a graph showing the effect of different concentrations of nucleic acid probe on the background fluorescence value.
FIG. 6 shows the effect of different temperatures on the hybridization chain reaction effect.
FIG. 7 shows the effect of different times on the hybridization chain reaction effect.
FIG. 8 is a fluorescence spectrum diagram of a graphene oxide sensor based on a hybridization chain reaction for detecting miR-205 with different concentrations.
FIG. 9 shows the specific response of a graphene oxide sensor based on a hybridization chain reaction to miR-205.
Fig. 10 feasibility analysis of graphene oxide sensors based on hybridization chain reaction in 1% fetal bovine serum.
FIG. 11 shows the effect of graphene oxide with different concentrations on the adsorption effect of nucleic acid probes in 1 ‰ fetal calf serum.
FIG. 12 shows the response of a graphene oxide sensor based on a hybrid chain reaction to miR-205 with different concentration gradients in 1% fetal calf serum.
FIG. 13 shows the specific response of the graphene oxide sensor based on the hybrid chain reaction to miR-205 in 1% fetal calf serum.
Fig. 14 shows fluorescence imaging of graphene oxide sensors in different cells based on hybridization chain reaction.
Detailed Description
In order to make the aforementioned objects, features and advantages of the present invention comprehensible, embodiments accompanied with examples are described in detail below.
In the following description, numerous specific details are set forth in order to provide a thorough understanding of the present invention, but the present invention may be practiced in other ways than those specifically described and will be readily apparent to those of ordinary skill in the art without departing from the spirit of the present invention, and therefore the present invention is not limited to the specific embodiments disclosed below.
Furthermore, reference herein to "one embodiment" or "an embodiment" means that a particular feature, structure, or characteristic described in connection with the embodiment is included in at least one implementation of the invention. The appearances of the phrase "in one embodiment" in various places in the specification are not necessarily all referring to the same embodiment, nor are separate or alternative embodiments mutually exclusive of other embodiments.
Example 1:
and (5) analyzing the feasibility of the working principle.
The implementation steps are as follows:
1. and (4) diluting the graphene oxide to 1mg/ml by DEPC water, and mixing uniformly.
2. The fluorescence-labeled hairpin nucleic acid probes HCR1 and HCR2 (sequences 5' -ATTCCACCGGAGTCTGCAAAGTC, respectively) were dissolved in DEPC waterAGACTCCGGTGGAATGAAGGA-FAM-3' and
Figure BDA0003174055240000031
) Is prepared into 100X 10-6mol/L solutionAnd (4) uniformly mixing. miR-205 is complementary to an underlined portion of HCR1 to form a double strand, the HCR1 probe is opened, a non-underlined portion of HCR1 is complementary to an underlined portion of HCR2 to form a double strand, the HCR2 probe is opened, an italic portion of HCR2 is complementary to an underlined portion of HCR1 to form a double strand, and the process is repeated to perform a hybrid strand reaction (HCR).
3. Dissolving miR-205 (sequence 5'-UCC UUC AUU CCA CCG GAG UCU G-3') with DEPC water, and preparing into 20 × 10 solution-6mixing the solution of mol/L.
4. 7 samples were prepared with SPSC buffer. Wherein the content of the first and second substances,
sample 1 at a final concentration of 100X 10-9A mol/L HCR1 solution;
sample 2 at a final concentration of 100X 10-9A mol/L HCR2 solution;
sample 3 at a final concentration of 100X 10-9HCR1 in mol/L and a final concentration of 100X 10-9A mixed solution of HCR2 in mol/L;
sample 4 at a final concentration of 100X 10-9HCR1 in mol/L and a final concentration of 100X 10-9mixing and reacting mol/L HCR2 with 120 mu g/mL graphene oxide solution for 10 minutes to obtain a solution;
sample 5 at a final concentration of 100X 10-9mol/L HCR1 solution and 200X 10-9Standing and reacting the mol/L miR-205 solution for 2 hours at 25 ℃, adding 120 mu g/mL graphene oxide solution, and mixing and reacting for 10 minutes to obtain a solution;
sample 6 at a final concentration of 100X 10-9mol/L HCR2 solution and 200X 10-9Standing and reacting the mol/L miR-205 solution for 2 hours at 25 ℃, adding 120 mu g/mL graphene oxide solution, and mixing and reacting for 10 minutes to obtain a solution;
sample 7 at a final concentration of 100X 10-9mol/L HCR1 solution, 100X 10-9mol/L HCR2 solution and 200X 10- 9And standing the mol/Lmur-205 solution at 25 ℃ for 2 hours, adding 120 mu g/mL graphene oxide solution, and mixing and reacting the solution for 10 minutes.
5. The fluorescence intensity was read using an F-7000 spectrofluorometer, where the excitation wavelength of the spectrometer was set to 480nm, the emission wavelength scan was set to 500-600nm, the excitation slit width was set to 5nm, and the emission slit width was set to 2.5 nm.
6. 4 samples were prepared and the bands were detected using SDS-PAGE electrophoresis: sample 1 was 100X 10-9mol/L HCR1, sample 2 100X 10-9mol/L HCR2, sample 3 40X 10-9The mol/L miR-205, sample 4 contains 100 x 10-9mol/L of HCR1, HCR2 and 40X 10-9And (3) mixing the solution with mol/L miR-205. The results are shown in FIG. 3.
The SPSC buffer solution formula of the invention comprises: 50X 10-9mol/L Na2HPO41mol/L NaCl, pH 7.4.
FIG. 1 is a schematic diagram showing the operation of the present invention, in which two hairpin nucleic acid probes HCR1 and HCR2 are in a stable state with respect to each other in a hybridization chain reaction, and the hairpin nucleic acid probes HCR1 and HCR2 are composed of a hairpin region, a single-stranded cohesive end and a double-stranded complementary region, and a sequence of HCR1 (5' -ATTCCACCGGAGTCTGCAAAGTC)AGACTCCGGTGGAATGAAGGA-FAM-3'), CAAAGT as hairpin region, GAAGGA as single stranded sticky end, the remainder being complementary double stranded region; likewise, HCR2 sequence
Figure BDA0003174055240000041
In (3), TCCTTC is a hairpin region, ACTTTG is a single-stranded sticky end, and the remainder is a complementary double-stranded region. When the trigger chain miR-205 does not exist, single-stranded DNA at the tail ends of the two hairpin nucleic acid probes is adsorbed on the surface of the graphene oxide through pi-pi action, and fluorescent groups carried by the hairpin nucleic acid probes are quenched by the graphene oxide under the action of fluorescence resonance energy transfer. In the presence of the trigger strand miR-205, the complementary pairing of the naked sticky end of the first hairpin HCR1 with the trigger strand results in the opening of the hairpin HCR1 structure, and the complementary pairing of the exposed sticky end with the sticky end of the second hairpin HCR2 results in the opening of the hairpin HCR2 structure, and the repeated opening of the hairpin nucleic acid probe structure is caused by the exposed sticky end of HCR2 being identical in sequence to the trigger strand. Finally, a hybridized double-stranded copolymer containing sticky ends is formed, and fluorescence is not quenched because the double strands cannot be adsorbed by oxidized graphene through pi-pi action. The method comprises continuously opening two kinds of hair containing FAM fluorophore labelsThe nucleic acid probe structure is used for triggering fluorescence recovery, and the quantification of miR-205 can be realized by detecting the fluorescence intensity in a system.
FIG. 2 is a fluorescence spectrum for feasibility analysis of working principle, and after graphene oxide is added into a mixed system of HCR1 and HCR2, the fluorescence signal is significantly reduced, which proves that the graphene oxide can adsorb hairpin probes of HCR1 and HCR2 on the surface, thereby leading to effective fluorescence quenching. When the miR-205 is added into the HCR1 and graphene oxide system, only simple hybridization of the miR-205 and the HCR1 occurs, and the fluorescence is slightly recovered. When the miR-205 is added into the HCR2 and graphene oxide system, no reaction occurs, and the fluorescence intensity is almost unchanged. When miR-205 is added into a mixture of HCR1 and HCR2, obvious fluorescence enhancement can be still observed in the presence of graphene oxide, which indicates that a phenomenon of recovery of a large amount of fluorescence occurs, and the hybrid chain reaction is successfully triggered by miR-205.
FIG. 3 is a hybridization chain reaction feasibility analysis diagram, and hybrid double-stranded copolymer bands with different lengths appear in a lane 4 containing HCR1, HCR2 and miR-205 at the same time, which proves that the miR-205 successfully initiates the hybridization chain reaction and confirms that the principle of the amplification strategy based on the hybridization chain reaction is feasible.
Example 2:
influence of graphene oxide with different concentrations on the adsorption effect of the nucleic acid probe.
The experimental steps are as follows:
1. and (4) diluting the graphene oxide to 1mg/ml by DEPC water, and mixing uniformly.
2. The fluorescence-labeled hairpin nucleic acid probes HCR1 and HCR2 (sequences 5' -ATTCCACCGGAGTCTGCAAAGTC, respectively) were dissolved in DEPC waterAGACTCCGGTGGAATGAAGGA-FAM-3' and
Figure BDA0003174055240000051
) Is prepared into 100X 10-6mixing the solution of mol/L.
3. Dissolving miR-205 (sequence 5'-UCC UUC AUU CCA CCG GAG UCU G-3') with DEPC water, and preparing into 20 × 10 solution-6mixing the solution of mol/L.
4. Will be 100X 10-9mol/L HCR1 and HCR2 withGraphene oxide (0, 20, 40, 60, 80, 100, 120, 140, 160 μ g/mL) at different concentrations was incubated at room temperature for 10 min.
5. Fluorescence readings were measured using a Hitachi F-7000 spectrofluorometer. The excitation wavelength is 480nm, the excitation slit is 5nm, the emission slit is 2.5nm, and the fluorescence intensity of 520nm is detected.
As shown in FIG. 4, the fluorescence intensity was minimized when the graphene oxide concentration was 140. mu.g/mL. Therefore, the optimal concentration of graphene oxide is 140 μ g/mL, where the fluorescence background is lowest.
Example 3:
influence of different concentrations of nucleic acid probe on the background value of fluorescence.
The experimental steps are as follows:
1. and (4) diluting the graphene oxide to 1mg/ml by DEPC water, and mixing uniformly.
2. The fluorescence-labeled hairpin nucleic acid probes HCR1 and HCR2 (sequences 5' -ATTCCACCGGAGTCTGCAAAGTC, respectively) were dissolved in DEPC waterAGACTCCGGTGGAATGAAGGA-FAM-3' and
Figure BDA0003174055240000061
) Is prepared into 100X 10-6mixing the solution of mol/L.
3. Dissolving miR-205 (sequence 5'-UCC UUC AUU CCA CCG GAG UCU G-3') with DEPC water, and preparing into 20 × 10 solution-6mixing the solution of mol/L.
4. Will be 200X 10-9And mixing the miR-205 solution with mol/L concentration with HCR1 and HCR2 solutions with different concentrations, standing, and reacting at 25 ℃ for 2 hours.
5. Adding a graphene oxide solution with the concentration of 140 mu g/mL into the mixed solution, shaking, uniformly mixing, and incubating for 10 minutes at room temperature.
6. Hitachi F-7000 spectrofluorometer readings were used. The excitation wavelength is 480nm, the excitation slit is 5nm, the emission slit is 2.5nm, and the fluorescence intensity of 520nm is detected.
The results of the experiment are shown in FIG. 5, and it can be seen that when the concentrations of the two probes are 100X 10-9At mol/L, the amplification effect of the fluorescence signal fluctuates at 100X 10-9Effect at mol/LOptimally, therefore, the concentration of nucleic acid probe is selected to be 100X 10-9mol/L is the optimum concentration.
Example 4:
influence of different temperatures on the effectiveness of the hybridization chain reaction.
The experimental steps are as follows:
1. and (4) diluting the graphene oxide to 1mg/ml by DEPC water, and mixing uniformly.
2. The fluorescence-labeled hairpin nucleic acid probes HCR1 and HCR2 (sequences 5' -ATTCCACCGGAGTCTGCAAAGTC, respectively) were dissolved in DEPC waterAGACTCCGGTGGAATGAAGGA-FAM-3' and
Figure BDA0003174055240000062
) Is prepared into 100X 10-6mixing the solution of mol/L.
3. Dissolving miR-205 (sequence 5'-UCC UUC AUU CCA CCG GAG UCU G-3') with DEPC water, and preparing into 20 × 10 solution-6mixing the solution of mol/L.
4. Will be 100X 10-9HCR1 solution with mol/L concentration, 100X 10-9Solution of HCR2 with a concentration of mol/L and 200X 10-9And mixing and standing the miR-205 solution with the mol/L concentration, and reacting at 25 ℃ and 37 ℃ for 2 hours respectively.
5. Adding graphene oxide solutions with different concentrations into the mixed solution, oscillating, uniformly mixing, and incubating for 10 minutes at room temperature.
6. Hitachi F-7000 spectrofluorometer was used. The excitation wavelength is 480nm, the excitation slit is 5nm, the emission slit is 2.5nm, and the fluorescence intensity of 520nm is detected.
As shown in fig. 6, it can be seen that, at different graphene oxide concentrations, the initial fluorescence intensity at 25 ℃ is higher and the fluorescence response range is wider than that at 37 ℃, so 25 ℃ is selected as the reaction temperature.
Example 5:
the effect of different durations on the effect of the hybridization chain reaction.
1. And (4) diluting the graphene oxide to 1mg/ml by DEPC water, and mixing uniformly.
2. Solubilization of fluorescently labeled hairpin nucleic acid probes HCR1 and HCR2 with DEPC WaterAre respectively 5' -ATTCCACCGGAGTCTGCAAAGTCAGACTCCGGTGGAATGAAGGA-FAM-3' and
Figure BDA0003174055240000071
) Is prepared into 100X 10-6mixing the solution of mol/L.
3. Dissolving miR-205 (sequence 5'-UCC UUC AUU CCA CCG GAG UCU G-3') with DEPC water, and preparing into 20 × 10 solution-6mixing the solution of mol/L.
4. Will be 100X 10-9HCR1 solution with mol/L concentration, 100X 10-9Solution of HCR2 with a concentration of mol/L and 200X 10-9And mixing and standing the miR-205 solution with the mol/L concentration, and reacting at 25 ℃ for different time lengths respectively.
5. Adding a graphene oxide solution with the concentration of 140 mu g/mL into the mixed solution, shaking, uniformly mixing, and incubating for 10 minutes at room temperature.
6. Hitachi F-7000 spectrofluorometer readings were used. The excitation wavelength is 480nm, the excitation slit is 5nm, the emission slit is 2.5nm, and the fluorescence intensity of 520nm is detected.
The experimental results are shown in fig. 7, and it can be seen that when the reaction time exceeds 60 minutes, the reaction conditions in the system are almost balanced, and 60 minutes is selected as the reaction time of the experiment.
Example 6:
and (3) a fluorescence spectrogram of the graphene oxide sensor based on the hybridization chain reaction for detecting miR-205 with different concentrations.
The experimental steps are as follows:
1. and (4) diluting the graphene oxide to 1mg/ml by DEPC water, and mixing uniformly.
2. The fluorescence-labeled hairpin nucleic acid probes HCR1 and HCR2 (sequences 5' -ATTCCACCGGAGTCTGCAAAGTC, respectively) were dissolved in DEPC waterAGACTCCGGTGGAATGAAGGA-FAM-3' and
Figure BDA0003174055240000081
) Is prepared into 100X 10-6mixing the solution of mol/L.
3. Will be 100X 10-9HCR1 solution with mol/L concentration, 100X 10-9HCR in mol/L concentration2 solution and concentration of 0, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1, 10, 20, 30, 40, 50, 100, 150, 200 × 10-9mixing and standing the miR-205 solution at mol/L.
4. After reacting for 2 hours at 25 ℃, adding a graphene oxide solution with the concentration of 140 mu g/mL, mixing uniformly, and incubating for 10min at room temperature.
5. Hitachi F-7000 spectrofluorometer readings were used. The excitation wavelength is 480nm, the excitation slit is 5nm, the emission slit is 2.5nm, and the fluorescence intensity of 520nm is detected.
As shown in FIG. 8, it can be seen that the concentration of miR-205 is 0-1X 10-9When the concentration of the miR-205 is in a mol/L range, the fluorescence intensity is linearly related to the concentration of the miR-205, the linear equation is F-201.53X +337.91, and the correlation coefficient R20.963. According to the formula 3 sigma/k, the detection limit is calculated to be 21 multiplied by 10-12mol/L。
Example 7:
and (3) specific response condition of the graphene oxide sensor based on the hybrid chain reaction to miR-205.
The experimental steps are as follows:
1. and (4) diluting the graphene oxide to 1mg/ml by DEPC water, and mixing uniformly.
2. The fluorescence-labeled hairpin nucleic acid probes HCR1 and HCR2 (sequences 5' -ATTCCACCGGAGTCTGCAAAGTC, respectively) were dissolved in DEPC waterAGACTCCGGTGGAATGAAGGA-FAM-3' and
Figure BDA0003174055240000082
) Is prepared into 100X 10-6mixing the solution of mol/L.
3. Will be 100X 10-9HCR1 solution with mol/L concentration, 100X 10-9HCR2 at mol/L concentration and 200X 10- 9NC, miRNA-21, Let-7a, miRNA-141, RM3(miR-205 mismatch 3-base sequence), RM2(miR-205 mismatch 2-base sequence), RM1(miR-205 mismatch 1-base sequence) and miR-205 solutions at mol/L concentration are mixed and stood respectively.
4. After reacting for 2 hours at 25 ℃, adding a graphene oxide solution with the concentration of 140 mu g/mL, mixing uniformly, and incubating for 10min at room temperature.
5. Hitachi F-7000 spectrofluorometer readings were used. The excitation wavelength is 480nm, the excitation slit is 5nm, the emission slit is 2.5nm, and the fluorescence intensity of 520nm is detected.
The experimental results are shown in fig. 9, and it can be seen that the non-complementary targets (NC, miRNA-21, Let-7a, and miRNA-141) do not cause significant fluorescence signal change, the fluorescence change rate gradually increases with the decrease of the number of mismatched bases, and the RNA with one base mismatch has only half of the fluorescence signal change relative to the target RNA, which indicates that the detection platform has excellent specificity for detecting miR-205.
Example 8:
and (3) carrying out feasibility analysis on the graphene oxide sensor based on the hybrid chain reaction in 1 per thousand fetal bovine serum.
The experimental steps are as follows:
1. 8 samples were prepared with SPSC buffer.
Sample 1 is a solution of fetal bovine serum at a final concentration of 1 ‰;
sample 2 was fetal bovine serum at a final concentration of 1 ‰, 100X 10-9mol/L HCR1 and 100X 10-9Standing and reacting the solution of HCR2 of mol/L for 2 hours at 25 ℃, adding a graphene oxide solution of which the final concentration is 180 mu g/mL, and mixing and reacting for 10 minutes;
sample 3 was fetal bovine serum at a final concentration of 1 ‰, 1 × 10-9mol/L miR-205, 100 x 10-9mol/L HCR1 and 100X 10-9Standing and reacting the solution of HCR2 of mol/L for 2 hours at 25 ℃, adding a graphene oxide solution of which the final concentration is 180 mu g/mL, and mixing and reacting for 10 minutes;
sample 4 was fetal bovine serum at a final concentration of 1 ‰, 10 × 10-9mol/L miR-205, 100 x 10-9mol/L HCR1 and 100X 10-9Standing and reacting the solution of HCR2 of mol/L for 2 hours at 25 ℃, adding a graphene oxide solution of which the final concentration is 180 mu g/mL, and mixing and reacting for 10 minutes;
sample 5 is fetal bovine serum at a final concentration of 1 ‰, 50 × 10-9mol/L miR-205, 100 x 10-9mol/L HCR1 and 100X 10-9After allowing the solution of HCR2 in mol/L to stand at 25 ℃ for 2 hours, oxygen was added to the solution to a final concentration of 180. mu.g/mLMixing the graphene solution and reacting for 10 minutes to obtain a solution;
sample 6 was fetal bovine serum at a final concentration of 1 ‰, 100X 10-9mol/L miR-205, 100 x 10-9mol/L HCR1 and 100X 10-9Standing and reacting the solution of HCR2 of mol/L for 2 hours at 25 ℃, adding a graphene oxide solution of which the final concentration is 180 mu g/mL, and mixing and reacting for 10 minutes;
sample 7 is fetal bovine serum at a final concentration of 1 ‰, 200 × 10-9mol/L miR-205, 100 x 10-9mol/L HCR1 and 100X 10-9Standing and reacting the solution of HCR2 of mol/L for 2 hours at 25 ℃, adding a graphene oxide solution of which the final concentration is 180 mu g/mL, and mixing and reacting for 10 minutes;
sample 8 was fetal bovine serum at a final concentration of 1 ‰, 100X 10-9mol/L HCR1 and 100X 10-9The solution was left to stand for 2 hours at 25 ℃ in mol/L HCR2 solution.
2. Photographs were taken of the above 8 samples under a fluorescence microscope.
The experimental result is shown in fig. 10, and it can be seen that the fluorescence brightness is continuously enhanced along with the increase of the concentration of the miR-205 in the reaction system, and the detection method has high stability, and is proved to be suitable for the environment of 1 per mill fetal calf serum.
Example 9:
influence of graphene oxide with different concentrations on the adsorption effect of the nucleic acid probe in 1 per mill fetal calf serum.
The experimental steps are as follows:
1. and (4) diluting the graphene oxide to 1mg/ml by DEPC water, and mixing uniformly.
2. The fluorescence-labeled hairpin nucleic acid probes HCR1 and HCR2 (sequences 5' -ATTCCACCGGAGTCTGCAAAGTC, respectively) were dissolved in DEPC waterAGACTCCGGTGGAATGAAGGA-FAM-3' and
Figure BDA0003174055240000101
) Is prepared into 100X 10-6mixing the solution of mol/L.
3. Adding 100 × 10 to 1 ‰ fetal calf serum solution-9HCR1 and 100X 10 in mol/L concentration-9HCR2 solution with mol/L concentration.
4. Adding 200X 10 to the mixed solution-9And mixing and standing the mol/L miR-205 solution, reacting for 2 hours at 25 ℃, and then adding graphene oxide solutions with the concentrations of 0, 30, 60, 90, 120, 150, 180, 210, 240, 270 and 300 mu g/mL.
5. Hitachi F-7000 spectrofluorometer readings were used. The excitation wavelength is 480nm, the excitation slit is 5nm, the emission slit is 2.5nm, and the fluorescence intensity of 520nm is detected.
As shown in FIG. 11, it can be seen that the decrease of fluorescence intensity is no longer significant when the graphene oxide concentration reaches 180. mu.g/mL. Therefore, the optimal concentration of graphene oxide is 180. mu.g/mL.
Example 10:
in 1% fetal calf serum, the graphene oxide sensor based on the hybrid chain reaction responds to miR-205 with different concentration gradients.
The experimental steps are as follows:
1. and (4) diluting the graphene oxide to 1mg/ml by DEPC water, and mixing uniformly.
2. The fluorescence-labeled hairpin nucleic acid probes HCR1 and HCR2 (sequences 5' -ATTCCACCGGAGTCTGCAAAGTC, respectively) were dissolved in DEPC waterAGACTCCGGTGGAATGAAGGA-FAM-3' and
Figure BDA0003174055240000102
) Is prepared into 100X 10-6mixing the solution of mol/L.
3. Adding 100 × 10 to 1 ‰ fetal calf serum solution-9HCR1 and 100X 10 in mol/L concentration-9HCR2 solution with mol/L concentration.
4. Adding the mixed solution into the solution at a concentration of 0, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1, 3, 5, 7, 10, 20, 30, 40, 50, 100, 150, 200 × 10-9mixing and standing the miR-205 solution at mol/L.
5. After 2 hours of reaction at 25 ℃, a graphene oxide solution with a concentration of 180 μ g/mL was added.
6. Hitachi F-7000 spectrofluorometer readings were used. The excitation wavelength is 480nm, the excitation slit is 5nm, the emission slit is 2.5nm, and the fluorescence intensity of 520nm is detected.
The experimental results are shown in FIG. 12, and it can be seen that, when the concentration of miR-205 is 0-1X 10-9When the concentration of the miR-205 is in a mol/L range, the fluorescence intensity is linearly related to the concentration of the miR-205, the linear equation is F-72.34X +272.82, and the correlation coefficient R20.994. According to the formula 3 sigma/k, the detection limit is calculated to be 214 multiplied by 10-12mol/L。
Example 11:
in 1% fetal calf serum, the graphene oxide sensor based on the hybrid chain reaction has specific response to miR-205.
The experimental steps are as follows:
1. and (4) diluting the graphene oxide to 1mg/ml by DEPC water, and mixing uniformly.
2. The fluorescence-labeled hairpin nucleic acid probes HCR1 and HCR2 (sequences 5' -ATTCCACCGGAGTCTGCAAAGTC, respectively) were dissolved in DEPC waterAGACTCCGGTGGAATGAAGGA-FAM-3' and
Figure BDA0003174055240000111
) Is prepared into 100X 10-6mixing the solution of mol/L.
3. Adding 100 × 10 to 1 ‰ fetal calf serum solution-9HCR1 and 100X 10 in mol/L concentration-9HCR2 solution with mol/L concentration.
4. Adding 200 × 10 of the mixed solution respectively-9mixing and standing NC, miRNA-21, Let-7a, miRNA-141, RM3(miR-205 mismatched 3-base sequence), RM2(miR-205 mismatched 2-base sequence), RM1(miR-205 mismatched 1-base sequence) and miR-205 solution at mol/L.
5. After 2 hours of reaction at 25 ℃, a graphene oxide solution with a concentration of 180 μ g/mL was added.
6. Hitachi F-7000 spectrofluorometer readings were used. The excitation wavelength is 480nm, the excitation slit is 5nm, the emission slit is 2.5nm, and the fluorescence intensity of 520nm is detected.
The experimental result is shown in fig. 13, and it can be seen that the non-complementary targets (NC, miRNA-21, Let-7a, and miRNA-141) do not cause significant fluorescence signal change, the fluorescence change rate gradually increases with the decrease of the number of mismatched bases, and the change of the fluorescence signal of the RNA with one base mismatch relative to the target RNA is less than half, which proves that the detection platform has excellent specificity for detecting miR-205 in 1% fetal calf serum.
Example 12:
and (3) carrying out fluorescence imaging on the graphene oxide sensor based on the hybridization chain reaction in different cells.
The experimental steps are as follows:
1. and (4) diluting the graphene oxide to 1mg/ml by DEPC water, and mixing uniformly.
2. The fluorescence-labeled hairpin nucleic acid probes HCR1 and HCR2 (sequences 5' -ATTCCACCGGAGTCTGCAAAGTC, respectively) were dissolved in DEPC waterAGACTCCGGTGGAATGAAGGA-FAM-3' and
Figure BDA0003174055240000121
) Is prepared into 100X 10-6mixing the solution of mol/L.
3. Respectively inoculating HepG2 (no-expression miR-205), KYSE-150 (low-expression miR-205) and KYSE-140 (high-expression miR-205) cells in a confocal culture dish, wherein the number of the inoculated cells is 3 multiplied by 104At 37 deg.C, 5% CO2Culturing in an incubator for 24 h.
4. The concentration is 100X 10 respectively-9mol/L of HCR1 and HCR2 were mixed with 180. mu.g/mL of graphene oxide for 2h to ensure complete adsorption of HCR1 and HCR2 on the GO surface.
5. The mixed system of graphene oxide containing HCR1 and HCR2 and 3 cells were co-cultured for 6h, respectively, the cells were washed 5 times with 1ml PBS, and the nuclei were stained with DAPI solution.
6. Laser confocal imaging was performed at 488nm excitation wavelength.
The experimental result is shown in FIG. 14, and it can be seen that the fluorescence intensity in KYSE-140 cells, KYSE-150 cells and HepG2 cells is from strong to weak, which proves that the hybrid chain reaction is triggered and imaged by miR-205 in KYSE-140 cells.
Example 13:
the graphene oxide sensor based on the hybridization chain reaction is used for recovering the detection condition in the labeling of 1 per thousand fetal calf serum.
The experimental steps are as follows:
1. and (4) diluting the graphene oxide to 1mg/ml by DEPC water, and mixing uniformly.
2. The fluorescence-labeled hairpin nucleic acid probes HCR1 and HCR2 (sequences 5' -ATTCCACCGGAGTCTGCAAAGTC, respectively) were dissolved in DEPC waterAGACTCCGGTGGAATGAAGGA-FAM-3' and
Figure BDA0003174055240000122
) Is prepared into 100X 10-6mixing the solution of mol/L.
3. Adding 100 × 10 to 1 ‰ fetal calf serum solution-9HCR1 and 100X 10 in mol/L concentration-9HCR2 solution with mol/L concentration.
4. Adding the above mixed solution into the solution at concentrations of 0.2, 0.4, 0.6, 0.8, and 1 × 10-9mixing and standing the miR-205 solution at mol/L.
5. After 2 hours of reaction at 25 ℃, a graphene oxide solution with a concentration of 180 μ g/mL was added.
6. Hitachi F-7000 spectrofluorometer readings were used. The excitation wavelength is 480nm, the excitation slit is 5nm, the emission slit is 2.5nm, and the fluorescence intensity of 520nm is detected.
7. Substituting into linear equation to calculate concentration, comparing with standard concentration, and calculating recovery rate and RSD value.
The experimental results are shown in table 1, and it can be seen that a good recovery rate is obtained in 1% fetal calf serum, and the RSD value is always lower than 2% between 96.74% and 122.17%, indicating that the graphene oxide biosensor based on the hybrid chain reaction can be successfully applied to the labeling detection of 1% fetal calf serum sample.
The method has simple operation, rapid detection and high sensitivity, and the detection limit of miR-205 in SPSC buffer solution reaches 21 multiplied by 10-12mol/L, the miR-205 detection method has very high specificity. The detection limit of miR-205 in 1 per mill fetal calf serum reaches 214 x 10-12mol/L, the method has very high specificity when detecting miR-205 in 1 per mill fetal calf serum.
TABLE 1 detection of the sensor in the spiking recovery of 1% fetal bovine serum
Figure BDA0003174055240000131
Although the present invention has been described with reference to the preferred embodiments, it should be understood that various changes and modifications can be made therein by those skilled in the art without departing from the spirit and scope of the invention as defined in the appended claims.

Claims (10)

1. A biosensor for detecting miR-205, which is characterized by comprising miR-205, a hairpin nucleic acid probe HCR1, a hairpin nucleic acid probe HCR2, graphene oxide and buffer;
the nucleotide sequence of miR-205 is shown in SEQ ID NO. 1;
the nucleotide sequence of hairpin nucleic acid probe HCR1 contained sequence a and sequence B; the nucleotide sequence of hairpin nucleic acid probe HCR2 contained sequence B and sequence C;
the nucleotide sequence of sequence A is complementary with that of miR-205, sequence B is complementary with sequence B, and sequence C is TCCTTCATTCCACCGGAGTCTG;
the 5' ends of the nucleotide sequences of the hairpin nucleic acid probes HCR1 and HCR2 are both linked to fluorescein.
2. The biosensor of claim 1, wherein sequence A is AGACTCCGGTGGAATGAAGGA and sequence B is ACTTTGCAGACTCCGGTGGAAT.
3. The biosensor for detecting miR-205 according to claim 2, wherein the nucleotide sequence of HCR1 is shown as SEQ ID No.1, and the nucleotide sequence of HCR2 is shown as SEQ ID No. 2.
4. The biosensor for detecting miR-205 according to claim 1, wherein said fluorescein label includes but is not limited to 5-carboxyfluorescein.
5. The use of the biosensor of any one of claims 1 to 4 for detecting miR-205 in non-disease diagnosis.
6. Use according to claim 5, wherein the detection is a qualitative or quantitative detection.
7. The method for carrying out non-disease diagnosis on miR-205 by using the biosensor as claimed in any one of claims 1-4 is characterized in that graphene oxide is added into a solution containing HCR1 and HCR2 for mixed incubation to obtain a graphene oxide solution loaded with a hairpin nucleic acid probe, and after the graphene oxide solution is co-cultured with cells, laser confocal imaging is carried out.
8. The use of claim 7, wherein the concentration of the hairpin nucleic acid probe solution is 90 to 120 x 10-9mol/L; the concentration of the graphene oxide is 180-200 mug/mL; the incubation time is at least 5 min; the co-culture time of the hairpin nucleic acid probe-loaded graphene oxide solution and cells is 4-8 h.
9. The method for carrying out non-disease diagnosis on miR-205 by using the biosensor as claimed in any one of claims 1-4 is characterized in that a solution to be detected is added into a solution containing HCR1 and HCR2, mixed incubation is carried out, graphene oxide is added for reaction, and fluorescence intensity is detected by using a fluorescence spectrophotometer.
10. The use of claim 9, wherein the concentration of the hairpin nucleic acid probe solution is 90 to 120 x 10-9mol/L; the concentration of the graphene oxide is 140-160 mu g/mL; the incubation time is at least 1h, and the incubation temperature is 22-27 ℃.
CN202110826871.9A 2021-07-21 2021-07-21 Method for detecting nasopharyngeal carcinoma anti-radiotherapy biomarker based on hybridization chain reaction Active CN113549692B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202110826871.9A CN113549692B (en) 2021-07-21 2021-07-21 Method for detecting nasopharyngeal carcinoma anti-radiotherapy biomarker based on hybridization chain reaction

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202110826871.9A CN113549692B (en) 2021-07-21 2021-07-21 Method for detecting nasopharyngeal carcinoma anti-radiotherapy biomarker based on hybridization chain reaction

Publications (2)

Publication Number Publication Date
CN113549692A true CN113549692A (en) 2021-10-26
CN113549692B CN113549692B (en) 2023-07-25

Family

ID=78132377

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202110826871.9A Active CN113549692B (en) 2021-07-21 2021-07-21 Method for detecting nasopharyngeal carcinoma anti-radiotherapy biomarker based on hybridization chain reaction

Country Status (1)

Country Link
CN (1) CN113549692B (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN114032339A (en) * 2021-12-22 2022-02-11 湖南工程学院 Hyperbranched hybridization chain reaction signal amplification system, kit and detection method for detecting nasopharyngeal carcinoma

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20090099034A1 (en) * 2007-06-07 2009-04-16 Wisconsin Alumni Research Foundation Reagents and Methods for miRNA Expression Analysis and Identification of Cancer Biomarkers
CN105112445A (en) * 2015-06-02 2015-12-02 广州辉园苑医药科技有限公司 MiR-205 gene knockout kit based on CRISPR-Cas9 gene knockout technology
CN109536612A (en) * 2018-12-24 2019-03-29 朱伟 One kind blood plasma miRNA marker relevant to nasopharyngeal carcinoma auxiliary diagnosis and its application
CN111549124A (en) * 2020-06-17 2020-08-18 黑龙江八一农垦大学 Molecular marker for detecting staphylococcus aureus mastitis of dairy cows and application thereof
CN112043837A (en) * 2020-08-25 2020-12-08 北京大学第一医院 Application of MiR-205-5p in preparation of angiogenesis agent

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20090099034A1 (en) * 2007-06-07 2009-04-16 Wisconsin Alumni Research Foundation Reagents and Methods for miRNA Expression Analysis and Identification of Cancer Biomarkers
CN105112445A (en) * 2015-06-02 2015-12-02 广州辉园苑医药科技有限公司 MiR-205 gene knockout kit based on CRISPR-Cas9 gene knockout technology
CN109536612A (en) * 2018-12-24 2019-03-29 朱伟 One kind blood plasma miRNA marker relevant to nasopharyngeal carcinoma auxiliary diagnosis and its application
CN111549124A (en) * 2020-06-17 2020-08-18 黑龙江八一农垦大学 Molecular marker for detecting staphylococcus aureus mastitis of dairy cows and application thereof
CN112043837A (en) * 2020-08-25 2020-12-08 北京大学第一医院 Application of MiR-205-5p in preparation of angiogenesis agent

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN114032339A (en) * 2021-12-22 2022-02-11 湖南工程学院 Hyperbranched hybridization chain reaction signal amplification system, kit and detection method for detecting nasopharyngeal carcinoma
CN114032339B (en) * 2021-12-22 2023-09-01 湖南工程学院 Hyperbranched hybridization chain reaction signal amplification system for detecting nasopharyngeal carcinoma, kit and detection method

Also Published As

Publication number Publication date
CN113549692B (en) 2023-07-25

Similar Documents

Publication Publication Date Title
Wu et al. Label-free and enzyme-free colorimetric detection of microRNA by catalyzed hairpin assembly coupled with hybridization chain reaction
Wang et al. A novel polydopamine-based chemiluminescence resonance energy transfer method for microRNA detection coupling duplex-specific nuclease-aided target recycling strategy
Zhang et al. Multiplexed detection of microRNAs by tuning DNA-scaffolded silver nanoclusters
Ma et al. Sensitive detection of microRNAs by duplex specific nuclease-assisted target recycling and pyrene excimer switching
Wang et al. Colorimetric detection of sequence-specific microRNA based on duplex-specific nuclease-assisted nanoparticle amplification
Chi et al. Direct fluorescence detection of microRNA based on enzymatically engineered primer extension poly-thymine (EPEPT) reaction using copper nanoparticles as nano-dye
CN109001167B (en) Method and kit for detecting Adenosine Triphosphate (ATP) by using strand displacement signal amplification fluorescent sensor based on aptamer and carbon dot
Wang et al. Target-assisted FRET signal amplification for ultrasensitive detection of microRNA
Zouari et al. Ultrasensitive determination of microribonucleic acids in cancer cells with nanostructured-disposable electrodes using the viral protein p19 for recognition of ribonucleic acid/microribonucleic acid homoduplexes
CN110218818B (en) Dengue virus gene fragment SERS detection kit and preparation method thereof
CN113388668A (en) Method for detecting exosome miRNA (micro ribonucleic acid) by local catalytic hairpin self-assembly technology based on DNA (deoxyribonucleic acid) nanowires
CN113201581A (en) Entropy-driven visible miRNA biosensor and application thereof
Li et al. Electrophoresis separation assisted G-quadruplex DNAzyme-based chemiluminescence signal amplification strategy on a microchip platform for highly sensitive detection of microRNA
Liu et al. Rapid and enzyme-free signal amplification for fluorescent detection of microRNA via localized catalytic hairpin assembly on gold nanoparticles
Qu et al. A fluorescence strategy for circRNA quantification in tumor cells based on T7 nuclease-assisted cycling enzymatic amplification
CN113549692B (en) Method for detecting nasopharyngeal carcinoma anti-radiotherapy biomarker based on hybridization chain reaction
Chen et al. A cancer cell membrane vesicle-packaged DNA nanomachine for intracellular microRNA imaging
CN109913534A (en) A method of two kinds of miRNA based on concatenated dna chain circular response and fluorescence resonance energy transfer effect are detected simultaneously
Ren et al. Fluorescence-enhanced p19 proteins-conjugated single quantum dot with multiplex antenna for one-step, specific and sensitive miRNAs detection
CN112961907A (en) Fluorescent biosensor for simultaneously detecting two RNAs and preparation and use methods thereof
US20230122281A1 (en) TNA-BASED PROBE FOR DETECTING AND IMAGING A TARGET miRNA IN LIVING CELLS
CN113462753B (en) Click chemistry mediated single quantum dot nano sensor, method for detecting miRNAs and application
Shuofeng et al. Sensitive detection of microRNA based on high-fidelity CRISPR/Cas13a trans cleavage activity coupled with template-free DNA extension-induced strongly emitting copper nanoparticles
CN113652473B (en) Fluorescent chemical sensor for detecting DNA damage site by single molecule, method and application
Lan et al. A photoluminescent biosensor based on long-range self-assembled DNA cascades and upconversion nanoparticles for the detection of breast cancer-associated circulating microRNA in serum samples

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant