CN111690722A - ATP detection nucleic acid sensor based on entropy driving and hybrid chain reaction and preparation method thereof - Google Patents
ATP detection nucleic acid sensor based on entropy driving and hybrid chain reaction and preparation method thereof Download PDFInfo
- Publication number
- CN111690722A CN111690722A CN202010602607.2A CN202010602607A CN111690722A CN 111690722 A CN111690722 A CN 111690722A CN 202010602607 A CN202010602607 A CN 202010602607A CN 111690722 A CN111690722 A CN 111690722A
- Authority
- CN
- China
- Prior art keywords
- probe
- atp
- solution
- hairpin
- nucleic acid
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6813—Hybridisation assays
- C12Q1/6816—Hybridisation assays characterised by the detection means
- C12Q1/6825—Nucleic acid detection involving sensors
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/008—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions for determining co-enzymes or co-factors, e.g. NAD, ATP
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6813—Hybridisation assays
- C12Q1/6816—Hybridisation assays characterised by the detection means
- C12Q1/682—Signal amplification
Abstract
The invention discloses an ATP detection nucleic acid sensor based on entropy driving and hybrid chain reaction and a preparation method thereof. The nucleic acid sensor comprises 5 probes, namely H, F, A/B/S, H1 and H2; the invention is based on ATP aptamer conformation transition, releases initiation chain, drives entropy to drive catalytic amplification primary circulation and hybridization chain reaction secondary circulation, and finally detects ATP molecules through fluorescence signal enhancement. The nucleic acid sensor has the advantages of rapid reaction, high sensitivity, strong anti-interference capability, mild reaction conditions and the like, can make up for the defects of the existing ATP detection method, and realizes the rapid and accurate quantitative detection of ATP.
Description
Technical Field
The invention belongs to the field of nucleic acid sensors, and particularly relates to an ATP detection nucleic acid sensor based on entropy driving and hybridization chain reaction and a preparation method thereof, in particular to an entropy driving circuit coupling hybridization chain reaction double amplification circuit based on nucleic acid aptamer regulation and a fluorescence biosensor for fluorescence detection of ATP.
Background
ATP has important reference significance in clinical medical diagnosis, the content of ATP is often related to the health degree of organisms, and the content of ATP in human serum is about 1 mu mol.L-1When the content is abnormal, various diseases such asCardiovascular and cerebrovascular diseases, Parkinson's syndrome, ischemia, hypoglycemia, malignant tumors and the like, and ATP has wide clinical application, and can provide important auxiliary treatment for diseases such as cerebral hemorrhage sequelae, myocardial diseases, chronic hepatitis and the like. Therefore, the rapid, accurate, sensitive and specific ATP detection method is designed, which is not only beneficial to promoting the exploration of the mysteries of life on the molecular level, but also has important significance for the analysis of the latest drugs, clinical diagnosis, overcoming of a plurality of difficult and complicated diseases and the like, and has potential application value in the fields of environmental science, biology, medicine and the like.
Disclosure of Invention
The invention aims to provide an ATP detection nucleic acid sensor based on entropy driving and hybrid chain reaction and a preparation method thereof.
The following technical scheme is adopted for achieving the purpose:
the invention provides a nucleic acid sensor for detecting ATP cascade method, an upstream soil moisture driving circuit comprises: reconstructing a probe H, pre-assembling a template probe A/B/S and a stimulating probe F; the downstream hybridization strand reaction circuit comprises: fluorescent dye-modified hairpin probe H1 and hairpin probe H2. The probe sequences are respectively as follows:
and (3) reconstructing a probe H: CAGGTTACCCTACGTCTCCATAGGGTAACCTGGGGGAGTATTGCGGAGGAAGGT, respectively;
pre-assembling a template probe A: TGGAGACGTAGGGTAACCTGAGGGCCG TAAGAGAGCTGTAGATTGGATCG, respectively;
pre-assembling a template probe B: CCACATACATCATATTCCCTCAGGTTACCCTACG, respectively;
pre-assembling a template probe S: GTCACTCGATCCAATCTACAGCTCTCTTACGG, respectively;
stimulation probe F: CGATCCAATCTACAGCTCTCTTACGGCCCTCATTC AATACCCTACG, respectively;
hairpin probe H1:
CGATCCAA(FAM)TCTACAGCAGATGTGTAGCTGTAGA(Dabcy 1)TTGGATCGAGTGAC；
hairpin probe H2: TACACATCTGCTGTAGATTGGATCGGTCACTCGATCCAATCTACAGC, respectively;
the preparation method of the nucleic acid sensor comprises the following steps:
(1) dissolving the probe A, B, S in Tris-HCl buffer solution, annealing for 8 minutes at 95 ℃ to ensure that the probe is completely hybridized to obtain a preassembled template probe A/B/S mixed solution;
(2) pre-dissolving a hairpin probe H1 in a Tris-HCl buffer solution, and annealing at 95 ℃ for 8 minutes to obtain a stable H1 hairpin solution;
(3) pre-dissolving a hairpin probe H2 in a Tris-HCl buffer solution, and annealing at 95 ℃ for 8 minutes to obtain a stable H2 hairpin solution;
(4) pre-dissolving the reconstructed hairpin probe H in Tris-HCl buffer solution, and annealing at 95 ℃ for 8 minutes to obtain stable H hairpin solution;
(5) and (3) mixing the solutions prepared in the steps (1), (2), (3) and (4), and adding a stimulation probe F to obtain a sensing solution.
The Tris-HCl buffer contained the following final concentration components: 5mM Tris-HCl, 40 mM sodium chloride, pH 7.4; in the sensing solution, the final concentration of each probe was 200 nM.
The working principle of the sensor is shown in figure 1:
in the presence of ATP, the recognition probe H undergoes conformational transition, a hidden HI region of an H chain is exposed, and the 3-terminal base of HI is not hybridized with the 5-terminal base of S; and then HI continues to be complementarily matched with the subsequent structure of S, the base at the position is the original hybridization part of B and A, and A is replaced to form an HI/B/S hybrid. In this case, the S-middle part of the hybrid T/B/S has a 4-base unhybridized portion. F in the solution can be hybridized with the 4 bases, and is gradually hybridized with S towards two ends by taking the F as a fulcrum, HI and B originally hybridized with S are gradually replaced, so that HI and B are released, and the first cycle process is completed. The HI released into the solution can be continuously repeated in the first cycle process to continuously release B, so that signal amplification is realized.
The 5-terminus of B released into solution can hybridize with the 3' -end of hairpin H1, followed by gradual hybridization with the neck of H1, opening hairpin H1, forming a hybrid of B/H1. The 5 'end of H1 of the formed B/H1 hybrid can be continuously hybridized with the 3' end base of H2, so that the hairpin structure of H2 is opened, the B/H1/H2 hybrid is formed, the 5 'end of H2 can be continuously opened to the 3' end of H1, and the cycle is repeated to realize signal amplification. The stem position of H1 of the hairpin structure is modified with a fluorescent group FAM, and a complementary site thereof is modified with a quenching group Dabcy 1. While H1 maintains the hairpin structure, the fluorescence of FAM is quenched, with no fluorescent signal. When B opens H1 and further opens H2, and B/H1/H2/H1/H2/H1/H2/H1/H2 … … hybrid is formed, FAM is far away from Dabcy1, FAM fluorescence is recovered, and fluorescence signals are enhanced. The concentration of ATP in the solution can be measured by measuring the increase in the fluorescent signal.
Further, the application of the nucleic acid sensor to ATP ions comprises the following steps:
(1) respectively adding ATP standard solution and solution to be detected with different concentrations into the sensing solution, uniformly mixing, and incubating for 1 hour at 37 ℃ in a constant-temperature metal bath;
(2) taking out each group of mixed solution from the constant-temperature metal bath, and measuring the fluorescence value of each mixed solution;
(3) and (3) making a standard curve of the ATP concentration to the fluorescence value according to the fluorescence values of the ATP standard solutions with different concentrations, calculating a regression equation, and finally calculating the ATP concentration according to the fluorescence value of the sample to be detected.
And (3) the fluorescence value is measured, the excitation wavelength is 488nm, and the emission wavelength is 520 nm.
The ATP detection concentration is 0.1-2. mu.M.
The invention has the beneficial effects that: the invention provides a nucleic acid sensor for detecting ATP cascade signal amplification and a preparation method thereof, which realizes high specificity identification of ATP by utilizing ATP aptamer conformation transformation; the entropy is utilized to drive the catalytic amplification primary circulation and the hybridization chain reaction secondary circulation, so that the fluorescence signal is amplified, and the ultra-sensitive detection of the target ATP is realized; the reaction condition is mild, the reaction speed is high, the anti-interference capability is strong, and the detection sensitivity is improved.
Drawings
FIG. 1 is a diagram showing the operation of a nucleic acid biosensor constructed according to the present invention.
FIG. 2 is a standard curve of ATP concentration-fluorescence intensity in the examples.
FIG. 3 is a bar graph of the selectivity of the sensor for different interfering analytes.
Detailed Description
In order to make the objects, technical solutions and advantages of the present invention more apparent, the present invention is further described in detail below with reference to the following embodiments, but the present invention is not limited by the following embodiments.
Seven DNA probes, namely, a pre-assembled template probe (hereinafter referred to as A, B and S), a reconstituted probe (hereinafter referred to as H), a stimulation probe (hereinafter referred to as F), a fluorescent dye Dabcy1, a FAM-modified hairpin probe 1 (hereinafter referred to as H1) and a hairpin probe 2 (hereinafter referred to as H2), were designed in the examples of the present invention.
Example 1
The sequence design of the preassembly template probe, the reconstruction probe (ATP recognition DNA probe), the stimulation probe, the fluorescent dye Dabcy1 and the FAM modified hairpin probe and the hairpin probe is shown in the table 1;
TABLE 1 complete sequence of sensors
The preparation method of the nucleic acid sensor comprises the following steps:
(1) dissolving the probe A, B, S in Tris-HCl buffer solution, annealing for 8 minutes at 95 ℃ to ensure that the probe is completely hybridized to obtain a preassembled template probe A/B/S mixed solution;
(2) pre-dissolving a hairpin probe H1 in a Tris-HCl buffer solution, and annealing at 95 ℃ for 8 minutes to obtain a stable H1 hairpin solution;
(3) pre-dissolving a hairpin probe H2 in a Tris-HCl buffer solution, and annealing at 95 ℃ for 8 minutes to obtain a stable H2 hairpin solution;
(4) pre-dissolving the reconstructed hairpin probe H in Tris-HCl buffer solution, and annealing at 95 ℃ for 8 minutes to obtain stable H hairpin solution;
(5) and (3) mixing the solutions prepared in the steps (1), (2), (3) and (4), and adding a stimulation probe F to obtain a sensing solution. The final concentration of each component was 200 nM.
EXAMPLE 2 annealing of hairpin probes
A hairpin probe solution at a concentration of 2. mu.M was prepared using Tris-HCl buffer, and 1. mu.L of hairpin probe (100. mu.M) and 49. mu.L of Tris-HCl buffer (5 mM Tris-HCl, 40 mM sodium chloride, pH7.4) were added to one 200. mu.L centrifuge tube. The centrifuge tubes were kept in a thermostatted metal bath at 95 ℃ for 8 minutes and then rapidly placed in ice water for 30 minutes to allow the formation of stable secondary structures.
EXAMPLE 3 detection Limit of sensor
The ATP standard solutions of different concentrations were detected by the sensor of example 3, and the detection range was determined. The method comprises the following specific steps:
(1) standard solutions of ATP were prepared at different concentrations.
(2) mu.L of the sensor solution was mixed with 5. mu.L of ATP standards of different concentrations, and then 35. mu.L of LTris-HCl buffer was added to 6 centrifuge tubes, respectively, to a final concentration of ATP of 0.1. mu.M, 0.2. mu.M, 0.5. mu.M, 1. mu.M and 2. mu.M, respectively, to give a solution volume of 50. mu.L. The solution was shaken for 10 seconds to homogenize the solution, and the mixture was placed in a constant temperature metal bath and reacted at 37 ℃ in the dark for 1 hour.
(3) The mixed solutions of each group were taken out from the constant temperature metal bath, and the fluorescence intensity value at 520 nm of the mixed solutions of each group was measured.
(4) And (3) according to the fluorescence intensity values of the ATP standard solutions with different concentrations, making a standard curve of the ATP concentration-fluorescence intensity values, and calculating a regression equation.
(5) The standard curve is shown in fig. 2: the linear range of the standard curve is 0.1-2. mu.M, and the detection limit is 38 nM.
Example 4 sensor interference rejection verification
(1) Control solutions (GTP, CTP, UTP) containing different analogues were prepared at a concentration of 20. mu.M.
(2) According to the procedure of example 3, 10. mu.L of the sensing solution was mixed with 5. mu.L of different analog solutions, and then 35. mu.L of Tris-HCl buffer was added to each of the 3 centrifugal tubes to a solution volume of 50. mu.L and an analog concentration of 20. mu.M. The solution was shaken for 10 seconds to homogenize the solution, and the mixture was placed in a constant temperature metal bath and reacted at 37 ℃ in the dark for 1 hour.
(3) The mixed solutions of each group were taken out from the constant temperature metal bath, and the fluorescence intensity value at 520 nm of the mixed solutions of each group was measured.
(4) Histogram of fluorescence value versus interfering analyte species is made
(5) The sensor interference rejection capability is shown in fig. 3: the sensor has no response ability to GTP, CTP, UTP and the like, and has selectivity to ATP.
The above-mentioned embodiments are intended to illustrate the objects, technical solutions and advantages of the present invention in further detail, and it should be understood that the above-mentioned embodiments are only exemplary embodiments of the present invention and are not intended to limit the present invention, and any modifications, equivalents, improvements and the like made within the spirit and principle of the present invention should be included in the protection scope of the present invention.
SEQUENCE LISTING
<110> Minjiang academy
<120> ATP detection nucleic acid sensor based on entropy driving and hybrid chain reaction and preparation method thereof
<130>7
<160>7
<170>PatentIn version 3.3
<210>1
<211>54
<212>DNA
<213> Artificial sequence
<400>1
caggttaccc tacgtctcca tagggtaacc tgggggagta ttgcggagga aggt 54
<210>2
<211>50
<212>DNA
<213> Artificial sequence
<400>2
tggagacgta gggtaacctg agggccgtaa gagagctgta gattggatcg 50
<210>3
<211>34
<212>DNA
<213> Artificial sequence
<400>3
ccacatacat catattccct caggttaccc tacg 34
<210>4
<211>32
<212>DNA
<213> Artificial sequence
<400>4
gtcactcgat ccaatctaca gctctcttac gg 32
<210>5
<211>46
<212>DNA
<213> Artificial sequence
<400>5
cgatccaatc tacagctctc ttacggccct cattcaatac cctacg 46
<210>6
<211>47
<212>DNA
<213> Artificial sequence
<400>6
cgatccaatc tacagcagat gtgtagctgt agattggatc gagtgac 47
<210>7
<211>47
<212>DNA
<213> Artificial sequence
<400>7
tacacatctg ctgtagattg gatcggtcac tcgatccaat ctacagc 47
Claims (5)
1. An ATP-detecting nucleic acid sensor based on entropy-driven and hybrid strand reactions, characterized in that an upstream moisture-driving circuit comprises: reconstructing a probe H, pre-assembling a template probe A/B/S and a stimulating probe F; the downstream hybridization strand reaction circuit comprises: fluorescent dye-modified hairpin probes H1 and H2; the probe sequences are respectively as follows:
and (3) reconstructing a probe H: CAGGTTACCCTACGTCTCCATAGGGTAACCTGGGGGAGTATTGCGGAGGAAGGT, respectively;
pre-assembling a template probe A: TGGAGACGTAGGGTAACCTGAGGGCCG TAAGAGAGCTGTAGATTGGATCG, respectively;
pre-assembling a template probe B: CCACATACATCATATTCCCTCAGGTTACCCTACG, respectively;
pre-assembling a template probe S: GTCACTCGATCCAATCTACAGCTCTCTTACGG, respectively;
stimulation probe F: CGATCCAATCTACAGCTCTCTTACGGCCCTCATTC AATACCCTACG, respectively;
hairpin probe H1:
CGATCCAA(FAM)TCTACAGCAGATGTGTAGCTGTAGA(Dabcy 1)TTGGATCGAGTGAC；
hairpin probe H2: TACACATCTGCTGTAGATTGGATCGGTCACTCGATCCAATCTACAGC are provided.
2. A method for producing the nucleic acid sensor according to claim 1, comprising the steps of:
(1) dissolving the pre-assembled template probe A, B, S in Tris-HCl buffer solution, annealing for 8 minutes at 95 ℃ to ensure that the pre-assembled template probe A/B/S mixed solution is obtained after complete hybridization;
(2) pre-dissolving a hairpin probe H1 in a Tris-HCl buffer solution, and annealing at 95 ℃ for 8 minutes to obtain a stable H1 hairpin solution;
(3) pre-dissolving a hairpin probe H2 in a Tris-HCl buffer solution, and annealing at 95 ℃ for 8 minutes to obtain a stable H2 hairpin solution;
(4) pre-dissolving the reconstructed hairpin probe H in Tris-HCl buffer solution, and annealing at 95 ℃ for 8 minutes to obtain stable H hairpin solution;
(5) and (3) mixing the solutions prepared in the steps (1), (2), (3) and (4), and adding a stimulation probe F to obtain a sensing solution.
3. The method of claim 2, wherein the Tris-HCl buffer is composed of: 5mM Tris-HCl, 40 mM sodium chloride, pH 7.4; in the sensing solution, the final concentration of each probe was 200 nM.
4. Use of a nucleic acid sensor according to claim 1 in the preparation of a reagent for the detection of ATP, comprising the steps of:
(1) respectively adding ATP standard solutions with different concentrations and a sample to be detected into the sensing solution, and incubating for 1h at 37 ℃ in a constant-temperature metal bath;
(2) taking out each group of standard sample solution, and measuring the fluorescence value of each standard solution by using a fluorescence spectrometer; and obtaining an ATP concentration-fluorescence intensity standard curve;
(3) and calculating the concentration of ATP to be detected according to the fluorescence value of the sample to be detected.
5. The use of claim 4, wherein said fluorescence measurement of step (2) has an excitation wavelength of 488nm and an emission wavelength of 520 nm.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010602607.2A CN111690722B (en) | 2020-06-29 | 2020-06-29 | ATP detection nucleic acid sensor based on entropy driving and hybrid chain reaction and preparation method thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010602607.2A CN111690722B (en) | 2020-06-29 | 2020-06-29 | ATP detection nucleic acid sensor based on entropy driving and hybrid chain reaction and preparation method thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN111690722A true CN111690722A (en) | 2020-09-22 |
| CN111690722B CN111690722B (en) | 2022-09-13 |
Family
ID=72484223
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202010602607.2A Active CN111690722B (en) | 2020-06-29 | 2020-06-29 | ATP detection nucleic acid sensor based on entropy driving and hybrid chain reaction and preparation method thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN111690722B (en) |
Citations (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2015095633A1 (en) * | 2013-12-20 | 2015-06-25 | Board Of Regents, The University Of Texas System | Methods and compositions related to nucleic acid circuits and signal transducers |
| CN107574227A (en) * | 2017-10-10 | 2018-01-12 | 武汉大学 | A kind of method for nucleic acid analysis based on cascade hybridization chain reaction |
| CN109001167A (en) * | 2018-05-21 | 2018-12-14 | 南京医科大学 | A kind of method and kit based on the strand displacement signal of aptamers and carbon dots amplification fluorescent optical sensor detection atriphos |
| CN109321635A (en) * | 2018-09-19 | 2019-02-12 | 嘉兴学院 | It is a kind of based on more hybridize chain reaction nucleic acid detection method and application |
| CN109439659A (en) * | 2018-11-13 | 2019-03-08 | 湖南工程学院 | A kind of aptamer ribozyme sequence |
| CN109762875A (en) * | 2019-03-19 | 2019-05-17 | 济南广音医疗科技有限公司 | Nucleic acid detection method based on the amplification of DNA molecular constant temperature non-enzymatic cascade signal |
| CN111175506A (en) * | 2020-02-05 | 2020-05-19 | 山西大同大学 | Sensor based on hybrid chain reaction and ribozyme and carcinoembryonic antigen detection method |
| CN111175268A (en) * | 2020-01-23 | 2020-05-19 | 闽江学院 | Fluorescent sensor for detecting dual signal amplification of mercury ions and preparation method thereof |
-
2020
- 2020-06-29 CN CN202010602607.2A patent/CN111690722B/en active Active
Patent Citations (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2015095633A1 (en) * | 2013-12-20 | 2015-06-25 | Board Of Regents, The University Of Texas System | Methods and compositions related to nucleic acid circuits and signal transducers |
| CN107574227A (en) * | 2017-10-10 | 2018-01-12 | 武汉大学 | A kind of method for nucleic acid analysis based on cascade hybridization chain reaction |
| CN109001167A (en) * | 2018-05-21 | 2018-12-14 | 南京医科大学 | A kind of method and kit based on the strand displacement signal of aptamers and carbon dots amplification fluorescent optical sensor detection atriphos |
| CN109321635A (en) * | 2018-09-19 | 2019-02-12 | 嘉兴学院 | It is a kind of based on more hybridize chain reaction nucleic acid detection method and application |
| CN109439659A (en) * | 2018-11-13 | 2019-03-08 | 湖南工程学院 | A kind of aptamer ribozyme sequence |
| CN109762875A (en) * | 2019-03-19 | 2019-05-17 | 济南广音医疗科技有限公司 | Nucleic acid detection method based on the amplification of DNA molecular constant temperature non-enzymatic cascade signal |
| CN111175268A (en) * | 2020-01-23 | 2020-05-19 | 闽江学院 | Fluorescent sensor for detecting dual signal amplification of mercury ions and preparation method thereof |
| CN111175506A (en) * | 2020-02-05 | 2020-05-19 | 山西大同大学 | Sensor based on hybrid chain reaction and ribozyme and carcinoembryonic antigen detection method |
Non-Patent Citations (2)
| Title |
|---|
| HUIMIN WANG等: "Construction of an enzyme-free concatenated DNA circuit for signal amplification and intracellular imaging", 《CHEMICAL SCIENCE》 * |
| ZHANG, Z 等: "Integrating DNA strand displacement circuitry to the nonlinear hybridization chain reaction", 《NANOSCALE》 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN111690722B (en) | 2022-09-13 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Wu et al. | Label-free and enzyme-free colorimetric detection of microRNA by catalyzed hairpin assembly coupled with hybridization chain reaction | |
| CN109001167B (en) | Method and kit for detecting Adenosine Triphosphate (ATP) by using strand displacement signal amplification fluorescent sensor based on aptamer and carbon dot | |
| CN105821132B (en) | A method of the specific Single stranded DNA concentration of Electrochemical Detection based on exonuclease and nucleic acid probe | |
| Qu et al. | Recent advances of fluorescent biosensors based on cyclic signal amplification technology in biomedical detection | |
| US20150197804A1 (en) | Compositions, kits, uses and methods for amplified detection of an analyte | |
| Pu et al. | One-step enzyme-free detection of the miRNA let-7a via twin-stage signal amplification | |
| Xue-tao et al. | Portable and sensitive quantitative detection of DNA based on personal glucose meters and isothermal circular strand-displacement polymerization reaction | |
| CN111175268A (en) | Fluorescent sensor for detecting dual signal amplification of mercury ions and preparation method thereof | |
| Liang et al. | Detection of microRNAs using toehold-initiated rolling circle amplification and fluorescence resonance energy transfer | |
| Ye et al. | Toehold-mediated enzyme-free cascade signal amplification for ratiometric fluorescent detection of kanamycin | |
| Song et al. | A novel assay strategy based on isothermal amplification and cascade signal amplified electrochemical DNA sensor for sensitive detection of Helicobacter pylori | |
| CN110607351B (en) | Chemiluminescence biosensor for detecting uracil glycosylase, and preparation method and application thereof | |
| US20230279504A1 (en) | A fluorescent quantitative PCR technology-based method for distinguishing human DNA | |
| Huang et al. | Dual signal amplification for microRNA-21 detection based on duplex-specific nuclease and invertase | |
| CN113640268A (en) | Tobramycin detection system and detection method based on CRISPR-Cas12a | |
| ZHANG et al. | Highly sensitive fluorescent aptasensor for thrombin detection based on competition triggered rolling circle amplification | |
| CN111690722B (en) | ATP detection nucleic acid sensor based on entropy driving and hybrid chain reaction and preparation method thereof | |
| Liu et al. | Hand-in-hand structured DNA monolayer for dual-mode analysis of circulating tumor DNA | |
| CN108982458B (en) | Fluorescence method for zinc ion detection based on magnetic bead particles modified by deoxyribozymes | |
| CN105838790B (en) | A kind of silver nanoclusters sensor and preparation method thereof and the application in detection viral gene | |
| Zhou et al. | An ultrasensitive fluorescence sensing strategy for detection and in situ imaging of chronic myeloid leukemia-related BCR-ABL1 mRNA | |
| CN110592186A (en) | AND molecular logic gate sensing system AND preparation method AND application thereof | |
| Xia et al. | Detection of single nucleotide Polymorphisms by fluorescence embedded Dye SYBR Green I based on graphene oxide | |
| CN114965984A (en) | Preparation method of fluorescence sensor based on hairpin DNA chain cascade DNA assembly reaction | |
| CN114507706A (en) | Biosensor based on enzyme DNA repair cascade drive fluorophore coding/de-coding and application thereof in telomerase detection |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |