CN114965984A - Preparation method of fluorescence sensor based on hairpin DNA chain cascade DNA assembly reaction - Google Patents

Abstract

The invention discloses a preparation method of a fluorescence sensor based on a hairpin DNA chain cascade DNA assembly reaction, which comprises the following steps: s1, preparing a first-stage catalysis hairpin self-assembly reaction system (CHA); s2, preparing a second-level hybridization chain reaction system (HCR); s3, an HP3 chain in a fluorescence labeling hybridization chain reaction; and S4, forming the fluorescence sensor. According to the preparation method of the fluorescence sensor based on the cascade DNA assembly reaction of the hairpin DNA chain, the Trigger chain is displaced out through HP2 by means of a toehold3 to form a stable HP1-HP2 chain, and the displaced Trigger chain triggers a new catalytic hairpin self-assembly reaction, so that a large number of HP1-HP2 chains are formed. The HP1-HP2 chain also has a Toehold end, and the free Toehold end can trigger the hybridization chain reaction of HP3 and HP4 to form HP2-HP1- [ HP3-HP4] n long-chain compound. At the moment, the hairpin structure of the molecular beacon HP3 chain is opened, the fluorescent group Cy3 and the quenching group BHQ2 are separated, a fluorescent signal is emitted, and the specific quantitative analysis of the helicobacter pylori is realized according to the intensity of the fluorescent signal.

Description

Preparation method of fluorescence sensor based on hairpin DNA chain cascade DNA assembly reaction

Technical Field

The invention relates to the technical field of biomedicine, in particular to a preparation method of a fluorescence sensor based on a hairpin DNA chain cascade DNA assembly reaction.

Background

Helicobacter pylori (H.p) is a gram-negative bacterium, which is colonized in the gastric mucosa of more than half of the population worldwide, has a strong infectivity, and can be transmitted through feces-mouth, mouth-mouth, stomach-mouth and medical instrument operation. Helicobacter pylori infection is closely related to diseases such as chronic gastritis, peptic ulcer, gastric cancer, gastric mucosa-associated lymphoid tissue lymphoma and the like, the infection is distributed worldwide, the infection is classified as a type I carcinogenic factor by the international cancer research institution, and the incidence rate of poor prognosis can be effectively reduced by early diagnosis and early treatment of the helicobacter pylori. Clinical detection methods for helicobacter pylori are classified into invasive and non-invasive. The invasive detection method comprises rapid urease test, tissue pathological biopsy, thallus separation culture and the like; the non-invasive examination mainly comprises an isotope-labeled urea breath test,Serum helicobacter pylori antibody, fecal helicobacter pylori antigen detection, molecular biology (such as PCR) detection and the like. Compared with an invasive detection method, the noninvasive detection has the advantages of rapidness, easy operation, convenient repeated detection and the like, and is suitable for epidemiological screening of helicobacter pylori. Wherein, urea ¹⁴ The C breath test is considered to be a gold standard for diagnosing helicobacter pylori infection except for bacterial culture, but the method has certain radioactivity, is not suitable for pregnant women, lactating women and children under 12 years old, and has the detection result easily influenced by factors such as medicines, upper gastrointestinal hemorrhage and the like, so that false negative easily occurs. Therefore, a sensitive, rapid, convenient and universal detection technology is urgently needed to be established, is used for rapidly and accurately screening helicobacter pylori infection, and provides technical support for early diagnosis and early treatment of helicobacter pylori.

The literature reports that helicobacter pylori can be detected in samples such as gastric tissue, gastric juice, feces, dental plaque and the like, and helicobacter pylori antibodies also exist in serum. Wherein the content of helicobacter pylori in gastric tissue and gastric juice is relatively high, but some patients are difficult to receive gastroscopic sampling; the fecal specimen is easy to obtain and can be used as a potential object for detecting the helicobacter pylori, but the conventional detection method has difficulty in meeting the requirements of detection specificity and sensitivity due to the complex fecal matrix and low concentration of the fecal matrix.

A biosensor is an instrument which is sensitive to biological substances and converts the concentration of the biological substances into detectable signals such as light, electricity and the like, and consists of three parts, namely an identification element, a transducer and a signal amplification device. The biosensor has the advantages of high sensitivity, good selectivity, real-time detection and the like, and is developed and widely applied in the field of life science. With the advent of aptamers, DNA-based biosensors have been used not only for the detection of nucleic acids, but also for the detection of other biomarkers of proteins, bacteria, viruses, etc. Meanwhile, in order to meet the requirement of trace detection, various nucleic acid amplification strategies such as Polymerase Chain Reaction (PCR), loop-mediated isothermal amplification (LAMP), and the like have been proposed. PCR has high sensitivity, but the amplification process requires precise temperature control, so that the PCR is difficult to be used for on-site rapid detection. LAMP has complicated primer design and limits its wide application. Recently, new isothermal enzyme-free amplification technologies, including Catalytic Hairpin Assembly (CHA) and Hybrid Chain Reaction (HCR), have advantages of simple operation, no need of enzymatic catalysis, high signal amplification efficiency, and the like, and are widely used for sensor construction. However, due to the complex matrix of the fecal sample and the low abundance of helicobacter pylori, a single signal amplification strategy is difficult to meet the detection requirements, and the combination of multiple signal amplification strategies is a trend of future research.

Disclosure of Invention

Aiming at the problems, the invention discloses a preparation method of a fluorescence sensor based on the cascade DNA assembly reaction of a hairpin DNA chain, and the prior literature reports that helicobacter pylori can be detected in samples such as gastric tissue, gastric juice, feces, dental plaque and the like, and helicobacter pylori antibodies also exist in serum. Wherein the content of helicobacter pylori in gastric tissue and gastric juice is relatively high, but some patients are difficult to receive gastroscopic sampling; the fecal specimen is easy to obtain and can be used as a potential object for detecting the helicobacter pylori, but the conventional detection method has difficulty in meeting the requirements of detection specificity and sensitivity due to the complex fecal matrix and low concentration of the fecal matrix.

The technical scheme of the invention is as follows: a preparation method of a fluorescence sensor based on a cascade DNA assembly reaction of a hairpin DNA chain comprises the following steps:

s1, preparing a first-stage catalysis hairpin self-assembly reaction system (CHA);

s2, preparing a second-level hybridization chain reaction system (HCR);

s3, an HP3 chain in a fluorescence labeling hybridization chain reaction;

and S4, forming the fluorescence sensor.

In a further technical scheme, the first-stage catalysis hairpin self-assembly reaction in the S1 is prepared by the following steps: mixing the Trigger chain, the HP1 chain and the HP2 chain, wherein the concentration ratio of the Trigger chain to the HP1 to the HP2 chain is 1-2:1: 1.

In a further embodiment, the second-stage hybridization chain reaction in S2 is prepared by the following steps: the reaction product in the S1, the HP3 chain and the HP4 chain are mixed, wherein the concentration ratio of the HP3 chain to the HP4 chain is 1: 1-2: 1.

In a further embodiment, in S3, the arm of HP3 chain is labeled with a fluorophore and a quencher.

In a further embodiment, the fluorescence sensor formed in S3 is: the Aptamer chain Aptamer, Trigger chain, HP1 chain, HP2 chain, HP3 chain and HP4 chain of H.pylori form a fluorescence sensor in a selection buffer.

In a further technical scheme, the preparation method of the fluorescence sensor based on the cascade DNA assembly reaction of the hairpin DNA chain comprises the following steps of (1) preparing the aptamer DNA sequences (5 '-3') of the helicobacter pylori;

the gene sequence of the Trigger chain is as follows:

GTAGCTGGATCTCGTCGATACACG；

the gene sequence of HP1 chain is:

CGTGTATCGACGAGATCCAGCTACTACACCAACGACGCTGGATCTCGTCGAGCCGAAAC；

the gene sequence of HP2 chain is:

ATCCAGCGTCGTTGGTGTAGTAGCTGGATCTCGTCGACTACACCAACGACG；

the gene sequence of HP3 chain is:

GCCG/Cy3/AAACGAGTCACTGTTT/BHQ2/CGGCTCGACGAG；

the gene sequence of HP4 chain is:

AGTGACTCGTTTCGGCCTCGTCGAGCCGAAAC。

in a further technical scheme, the fluorescent sensor is based on the cascade DNA assembly reaction of the hairpin DNA chain and is prepared by the method.

In a further technical scheme, the method for detecting the helicobacter pylori by the fluorescent aptamer sensor based on the cascade DNA assembly reaction of the hairpin DNA chain is characterized in that the fluorescent aptamer sensor prepared by the method is used for detecting the helicobacter pylori thallus.

In a further aspect, in one or more specific embodiments of the present application, the method comprises the steps of:

firstly, preparing a fluorescent sensor based on the cascade DNA assembly reaction of the hairpin DNA chain according to the method;

then, helicobacter pylori of different concentrations are respectively reacted in the fluorescent sensor of S4, the fluorescence intensity of the fluorescent sensor is respectively tested, a standard curve is constructed, and a linear equation is obtained;

and finally, reacting the sample solution of the helicobacter pylori thallus to be detected in a fluorescence sensor prepared in S4, determining the fluorescence emission spectrum of the sample solution by using a fluorescence spectrometer, calculating the content of the helicobacter pylori according to a standard curve or a linear equation, and judging whether the helicobacter pylori is contained.

The beneficial effects of the invention are:

the principle of detecting helicobacter pylori bacteria by a fluorescence aptamer sensor based on the cascade DNA assembly reaction of hairpin DNA chains is shown in figure 1, the opening of the hairpin structure can be used as a driving force for catalyzing the self-assembly of the hairpin and the hybrid chain reaction, and the catalysis of the self-assembly reaction of the hairpin and the hybrid chain reaction can be carried out according to a set direction with the assistance of the Trigger chain. In the system, the Aptamer can be complementarily paired with a Trigger chain in a selection buffer system, and when helicobacter pylori exists in the system, the Aptamer can be specifically combined with the helicobacter pylori, so that the Trigger chain complementarily paired with partial bases of the Aptamer still exists in the reaction system in a single-chain structure. The Trigger chain can be linked with the toehold of the HP1 chain

Binding, thereby opening the hairpin structure of HP1, exposing a new toehold

HP2 by toehold

The Trigger chain is displaced out to form a stable HP1-HP2 chain, and the displaced Trigger chain triggers a new catalytic hairpin self-assembly reaction, so that a large number of HP1-HP2 chains are formed. The HP1-HP2 chain also has a Toehold end, and the free Toehold end can trigger the hybridization chain reaction of HP3 and HP4 to form HP2-HP1- [ HP3-HP4]n long chain complex. Hairpin of molecular beacon HP3 chain at this timeThe structure is opened, the fluorescent group Cy3 and the quenching group BHQ2 are separated, a fluorescent signal is emitted, and the specific quantitative analysis of the helicobacter pylori is realized according to the intensity of the fluorescent signal.

The invention utilizes high-specificity aptamer as a recognizer, combines the catalysis hairpin self-assembly reaction and the hybrid chain reaction to carry out double signal amplification, and establishes a fluorescent aptamer sensor for rapidly and enzymatically detecting helicobacter pylori in excrement. In the presence of H.pylori, the catalytic hairpin self-assembly reaction is triggered and further initiates the subsequent hybridization chain reaction process, a series of long-chain complexes are generated, the hairpin structure of the molecular beacon HP3 chain is opened, the fluorescent group Cy3 and the quenching group BHQ2 are separated, and a fluorescent signal is emitted. By utilizing the high amplification capacity of the amplification of the dual reaction signals, the fluorescent adaptive sensor can carry out ultra-sensitive detection on the helicobacter pylori within 30min, and the detection limit is as low as 5 cfu/mL. In addition, the method has the advantages of high selectivity, good stability, simple and convenient operation, high accuracy and the like, and is suitable for detecting trace helicobacter pylori in a complex biological matrix. The invention can be applied to the detection of other small molecules, nucleic acids or microorganisms only by changing the sequence of the aptamer part, so that the aptamer has certain development potential in biomedical application.

Drawings

FIG. 1 is a schematic diagram of the principle of rapid and sensitive detection of helicobacter pylori in a fecal sample by a fluorescence aptamer sensor based on cascade strand displacement reaction according to the present invention;

FIG. 2 is a schematic diagram of a fluorescent aptamer sensor DNA sequence according to the invention;

FIG. 3 is a DNA sequence diagram of the CHA reaction system of the present invention;

FIG. 4 is a schematic diagram of the sequence optimization of the CHA reaction systems HP1 and HP 2;

FIG. 5 is a DNA sequence diagram of the HCR reaction system of the present invention;

FIG. 6 is a schematic diagram of the sequence optimization of the HCR reaction systems HP3 and HP 4;

FIG. 7 is a view showing (A) the CHA-CHR electrophoretogram of the present invention; (B) comparison of HCR reaction system alone with CHA-HCR combination reaction system; (C) a schematic diagram for optimizing the proportion of the fluorescent probe in the CHA-HCR reaction system;

FIG. 8 shows the change of fluorescence intensity of the CHA-HCR reaction system with time under different concentrations of Trigger according to the present invention (A). (B) A fluorescence emission spectrogram (reaction time is 1 h) of a CHA-HCR reaction system under different concentrations of Trigger;

FIG. 9 shows fluorescence intensity Δ F (Δ F ═ F) of the CHA-HCR reaction system of the present invention (A) _Sample -F _Blank ) Fitted curve to helicobacter pylori concentration: a CHA-HCR reaction system fluorescence emission spectrum (excitation light wavelength is 540 nm);

FIG. 10 shows the CHA-HCR fluorescence sensor specificity of the present invention: delta F is the fluorescence difference between the sample reaction system and the blank control; the concentration of helicobacter pylori is 500cfu/mL, and the concentration of other non-target bacteria is 1.0 multiplied by 10 ⁴ Schematic representation of cfu/mL.

FIG. 11 is a schematic diagram of the fluorescence spectrum of a helicobacter pylori CHA-HCR sensor in a stool sample and a helicobacter pylori bacterial suspension according to the present invention

FIG. 12 is a diagram illustrating the detection of helicobacter pylori content in a fecal sample by the fluorescence aptamer sensor according to the present invention

Detailed Description

The embodiments of the present invention will be further described with reference to the accompanying drawings.

Example (b): referring to fig. 1-12, reagents and materials: helicobacter pylori (ATCC 43504, Helicobacter pylori), Escherichia coli (ATCC 8099, Escherichia coli), Staphylococcus aureus (ATCC 6538, Staphylococcus aureus), Salmonella (ATCC 14028, Salmonella), Pseudomonas aeruginosa (ATCC 27853, Pseudomonas aeruginosa), Listeria monocytogenes (ATCC 1040S, Listeria monocytogens) and Enterococcus faecalis (ATCC 33166, Enterococcus faecalis) were purchased from Beijing Arthromus Biotech, Inc. selection buffer (100mM NaCl,5mM KCl,50mM Tris-HCl, and 1mM MgCl2, pH 7.5).

After the ethical approval of the ethical committee of the fourth hospital in western China, Sichuan university (No. HXSY-EC-2021025), 102 fecal samples (35 of which are positive for 13C-UBT and have DOB not less than 4.0 and 67 of which are negative and have DOB less than 4.0) were collected. All samples were stored at-80 ℃. Exclusion criteria: there was a history of using H.pyri sensitive drugs such as antibacterial drugs, antacids within 4 weeks before sampling. All subjects fully understood and voluntarily signed an informed consent.

Pretreatment of the aptamer: the invention adopts NUPACK software to design six single-chain nucleotides, which comprise four hairpin structures (HP1, HP2, HP3 and HP4), an Aptamer (Aptamer) and a catalytic chain (Trigger), wherein a fluorescent dye Cy3 and a fluorescence quencher BHQ2 are respectively modified on a stem of the HP3 hairpin structure, all ssDNA sequences are synthesized and purified by Shanghai, and the specific sequence is shown in figure 2. The four chains of HP1-HP4 are respectively denatured at 95 ℃ for 10min before use and then slowly annealed to room temperature to form a stable hairpin structure, and the complementary regions are blocked by hairpin stems, so that spontaneous hybridization reaction between HP1-HP4 can be effectively prevented. Before use, the aptamer chain needs to be denatured at 95 ℃ for 10min and then slowly annealed to room temperature to form a stable secondary structure.

Construction of fluorescent aptamer sensor: a series of two-fold dilutions of H.pylori strains were performed using selection buffer, while counting by plating. 10 mu L of 10 mu mol/L aptamer and 10 mu L of 10 mu mol/L priming chain Trigger are added into 10 mu L of diluted serial bacterial suspension, and after shaking and uniform mixing, incubation is carried out for 10min at 37 ℃. Taking 10 mu L of the incubated bacterial suspension, putting the 10 mu L of the incubated bacterial suspension into a 1.0mL brown EP tube, sequentially adding 10 mu L of HP1, HP2, HP3 and HP4 solutions with the concentration of 10 mu mol/L, then supplementing the solution to 100 mu L by using a selection buffer, shaking and uniformly mixing the solution, incubating the solution at 37 ℃ for 20min, and detecting the fluorescence intensity of the solution by using a fluorescence spectrophotometer. The fluorescence spectrophotometer has an excitation wavelength of 540nm and an emission wavelength of 550nm-700nm, and the fluorescence intensity of Cy3 at the maximum emission wavelength of 565nm is quantified.

Measurement of actual samples: approximately 1g of fecal sample was taken with 200. mu.L selection buffer (100mM NaCl,5mM KCl,50mM Tris-HCl, and 1mM MgCl) ₂ pH 7.5), shaking and mixing, adding 10 mu L of 10 mu mol/L aptamer and 10 mu L of 10 mu mol/L priming strand T into 10 mu L of sample solution after instantaneous separation, incubating at 37 ℃ for 10min after shaking and mixing, and using 10 mu L selection buffer as a blank control. 10 μ L of the incubated sample was placed in a 1.0mL brown EP tube, 10 μ L of each 10 μmol/L solution of HP1, HP2, HP3, and HP4 were added in sequence,then, the solution was made up to 100. mu.L with a selection buffer, shaken and mixed, incubated at 37 ℃ for 20min, and then the fluorescence intensity of the solution was measured with a fluorescence spectrophotometer. The fluorescence spectrophotometer has an excitation wavelength of 540nm and an emission wavelength of 550nm-700nm, and the fluorescence intensity of Cy3 at the maximum emission wavelength of 565nm is quantified.

CHA reaction system optimization: the CHA reaction involves two hairpin-structured single-stranded DNA of HP1 and HP2, and a catalytic strand. When there is no primed strand, it is necessary to ensure that the hairpin strands HP1 and HP2 coexist stably and that complementary pairing does not occur, i.e. the stem, loop and free toehold end base length of both hairpin strands HP1 and HP2 need to be optimized to ensure that HP1 and HP2 can form stable hairpin structures (see fig. 1 in principle).

Experiments firstly optimize the number of bases on the ring of the HP1 and HP2 hairpin chains (the specific sequence is shown in figure 3), and when the number of bases on the ring is 16nt, the CHA reaction (HP1, HP2 and T system) is most complete, and a large amount of HP1-HP2 complexes are formed; and the background signal (HP1 and HP2 systems) was low at this point, the HP1, HP2 hairpin chains were essentially stable together (see FIG. 4), so the number of bases on the HP1, HP2 hairpin links in the CHA reaction was chosen to be 16 nt.

Optimizing an HCR reaction system: the HCR reaction involves single-stranded DNA with two hairpin structures of HP3 and HP4 and a free toehold end priming strand T on HP1 after the CHA reaction ₂ . When there is no initiating chain T ₂ In time, the hairpin chains of HP3 and HP4 need to be ensured to be stably coexisted and not subjected to complementary pairing; when the initiating chain T is present ₂ When necessary, the initiating chain T is ensured ₂ Can smoothly open the hairpin structure of HP3 to form a large amount of HP3-HP4]n complex.

The hairpin structures of HP3 and HP4 in the HCR reaction system are optimized through experiments (the specific sequences are shown in figure 5), and the results show that (shown in figure 6) T is increased along with the increase of the number of bases on the ring ₂ The reaction efficiency with HP3 is gradually increased, and when the bases on the ring are 8nt and 10nt, T is ₂ Reaction with HP3 to form a large amount of T ₂ + HP3 Complex, in this case T ₂ The HP3 and HP4 reaction systems formed large amounts [ HP3-HP4]]n complex, and long chain formed when base on ring is 8nt than 10nt [ HP3-HP4]]n complexes are more. At the same time, no initiating chain T is added ₂ HP3 and HP4 pairsAccording to the system, the catalyst is not [ HP3-HP4]]And (3) forming an n complex. When the number of bases on the loop is increased to 12nt, and the number of bases on the stem is only 4nt, the fitting of the NUPACK software shows that the hairpin structures of HP3 and HP4 are unstable. Therefore, the number of bases on hairpin chain rings of HP3 and HP4 in HCR reaction is selected to be 8nt, and the number of bases on stems is 8 nt;

and (3) verifying the signal amplification effect of the CHA-HCR reaction system: respectively modifying a fluorescent dye Cy3 and a fluorescence quencher BHQ2 (shown in a sequence chart 2) on an optimized stem of an HP3 hairpin structure, and comparing a CHA-HCR combined reaction pair initiated by Trigger with T ₂ Signal enhancement effect of initiated HCR response alone (T) ₂ See sequence in fig. 5). The results show (see FIG. 7A) that HP1-T complex is formed when HP1 is added to the priming strand Trigger solution; the compound HP1-HP2 is formed after the addition of the HP2, which indicates that the CHA reaction is carried out smoothly; the HP3 is continuously added to form a highly fluorescent HP1-HP2-HP3 complex (which is obviously stronger than the single HP3 hairpin structure), and the suggestion is that the free Toehold end of the CHA reaction product HP1-HP2 complex can better open the HP3 hairpin structure, so that the HCR reaction is initiated; after the HP4 is added, a series of long-chain HP2-HP1- [ HP3-HP4] are formed]n complex, indicating that the CHA-HCR reaction proceeded smoothly.

HCR is initiated by a series of T2 with different concentrations (1.00E-9-5.00E-08 mol/L), a CHA-HCR reaction system is initiated by a series of Trigger with different concentrations (1.00E-10-5.00E-09 mol/L), and the concentrations of HP1-HP4 are all 1.00E-6 mol/L. The results show (see FIG. 7B) that the sensitivity of the CHA-HCR combination reaction is at least one order of magnitude higher than that of the HCR reaction alone, indicating that the CHA-HCR combination reaction system has a better signal amplification effect.

Optimizing the proportion of the fluorescent probe: in the CHA reaction system, H1 and H2 are partially complementary paired, and theoretically, the CHA reaction is most complete when H1: H2 is 1: 1. Similarly, in the HCR reaction system, the reaction efficiency was highest when H3: H4 was 1: 1. Therefore, experiments were conducted to fix the concentrations of H1 and H2 at 1.00E-6mol/L and adjust the concentrations of H3 and H4 (5.00E-7mol/L, 1.00E-6mol/L and 2.00E-6mol/L) to achieve ratios of H1: H2: H3: H4 of 2:2:1:1, 1:1:2:2, respectively, and to measure the fluorescence intensities of the CHA-HCR system under different conditions. The results (see fig. 7C) show that the fluorescence intensity of the reaction system (T chain concentration of 5.00E-10mol/L) and the blank is lower when H1: H2: H3: H4 is 2:2:1: 1; when H1: H2: H3: H4 is 1:1:1:1, the fluorescence intensity of the reaction system is obviously enhanced, and the blank is not obviously changed. When H1, H2, H3, H4 and H352 are in the ratio of 1:1:2:2, the blank fluorescence intensity is obviously enhanced along with the increase of HP3 and HP4, and the fluorescence intensity of the reaction system is slightly increased. Thus, the H ratio of H1: H2: H3: H4 was chosen to be 1:1:1:1 in the CHA-HCR system.

Optimization of reaction time: since the present experiment is based on the amplification of the detection signal achieved by the CHA-HCR reaction system at room temperature, the incubation time will affect the fluorescence intensity. Experiment the fluorescence signal intensity of the CHA-HCR reaction system is measured every 2min within 1 hour after a series of chain-initiating Triggers are added into the mixed reaction system of HP1-HP 4. The results show (FIG. 8A) that the CHA-HCR reaction system gradually increased in fluorescence intensity with the increase of the incubation time; when the incubation time reaches 10min, the fluorescence intensity tends to be stable. Meanwhile, the larger the concentration of the Trigger chain Trigger is, the stronger the fluorescence intensity of the system after stabilization is. The fluorescence emission spectrum (see fig. 8B) also shows that the fluorescence intensity of the reaction system increases with the increase of the concentration of the Trigger strand Trigger. To ensure more complete reaction, incubation at room temperature for 20min was chosen for this experiment.

Method sensitivity and linear range: a series of dilutions of H.pylori (20-1000 cfu/mL) were incubated with Aptamer and T strands for 10min before being added to the CHA-HCR system (final concentrations of HP1, HP2, HP3 and HP4 were 1.00E-6mol/L, respectively) and the fluorescence intensity of the CHA-HCR system was measured. As shown in FIG. 9, the fluorescence intensity of the CHA-HCR system increases with increasing helicobacter pylori concentration according to Δ F (Δ F ═ F) _Sample -F _Blank ) The linear range and detection limit of the method are calculated. The results show (FIG. 9A) that H.pylori is well linear in the concentration range of 20cfu/mL to 1000cfu/mL, the regression coefficient is 0.99, and the calibration equation is 1.194x +173.49(x is H.pylori concentration, y is. DELTA.F). The detection limit of the method is 5cfu/mL (S/N is 3), the detection limit is obviously improved compared with PCR, and the detection limit is equivalent to most reported sensors. The result shows that the established sensor can rapidly and sensitively detect the helicobacter pylori in the stool sample.

CHA-HCR fluorescentSpecificity and reproducibility of photoaptamer sensors: experiment in addition to the detection of the target bacterium, Helicobacter pylori (ATCC 43504), common bacteria of the digestive tract, such as escherichia coli (ATCC 8099), Staphylococcus aureus (ATCC 6538), Salmonella (ATCC 14028), pseudomonas aeruginosa (ATCC 27853), Listeria monocytogenes (1040S), and Enterococcus faecalis (ATCC 33166, Enterococcus faecalis), were measured respectively to examine the selectivity of the sensor. The concentration of helicobacter pylori is 500cfu/mL, and the concentration of other non-target bacteria is 1.0 multiplied by 10 ⁴ cfu/mL, and the fluorescence intensity of the reaction system is measured by adopting the established method. As shown in FIG. 10, the CHA-HCR fluorescence sensor showed a higher response to H.pylori, which is clearly distinguishable from other non-target bacteria. Therefore, the novel biosensor constructed in the present study has high selectivity in the detection of helicobacter pylori, and is not affected by the above-mentioned common bacteria in the digestive tract.

Determination of the actual sample: about 1g of fecal sample was shaken and mixed with 200. mu.L of selection buffer, and then helicobacter pylori was detected by the established CHA-HCR fluorescence sensor detection method. The results show (see FIGS. 11 and 12), 35 cases ¹³ C positive patients tested in the breath test all detected helicobacter pylori in the fecal samples, the concentration was between 140cfu/mL and 930 cfu/mL. 67 examples of ¹³ C, the content of helicobacter pylori in the excrement specimen of the negative person in the breath test is less than the detection limit. The result shows that the CHA-HCR-based fluorescence sensor established in the experiment has good detection performance in preliminary practical application, can be clinically popularized and applied, and is the characteristic of the preparation method of the fluorescence sensor based on the hairpin DNA chain cascade DNA assembly reaction.

The above examples only express the specific embodiments of the present invention, and the description thereof is more specific and detailed, but not to be construed as limiting the scope of the present invention. It should be noted that, for a person skilled in the art, several variations and modifications can be made without departing from the inventive concept, which falls within the scope of the present invention.

Claims (9)

1. A preparation method of a fluorescence sensor based on a cascade DNA assembly reaction of a hairpin DNA chain is characterized by comprising the following steps:

s1, preparing a first-stage catalysis hairpin self-assembly reaction system (CHA);

s2, preparing a second-level hybridization chain reaction system (HCR);

s3, an HP3 chain in a fluorescence labeling hybridization chain reaction;

and S4, forming the fluorescence sensor.

2. The method of claim 1, wherein the fluorescence sensor is prepared based on a hairpin DNA chain cascade DNA assembly reaction, and the method comprises the following steps: the first-stage catalysis hairpin self-assembly reaction in the S1 is prepared by the following steps: mixing the Trigger chain, the HP1 chain and the HP2 chain, wherein the concentration ratio of the Trigger chain to the HP1 to the HP2 chain is 1-2:1: 1.

3. The method of claim 1, wherein the fluorescence sensor is prepared based on a hairpin DNA chain cascade DNA assembly reaction, and the method comprises the following steps: the second level hybridization chain reaction in S2 was prepared by the following steps: the reaction product in the S1, the HP3 chain and the HP4 chain are mixed, wherein the concentration ratio of the HP3 chain to the HP4 chain is 1: 1-2: 1.

4. The method for preparing a fluorescence sensor based on the cascade DNA assembly reaction of hairpin DNA chain as claimed in claim 1, wherein: in the S3, the arm part of the HP3 chain is marked with a fluorescent group and a quenching group.

5. The method of any one of claims 1 to 4, wherein the fluorescence sensor is prepared based on a cascade DNA assembly reaction of hairpin DNA strands, and the method comprises: the fluorescence sensor formed in S3 is: the Aptamer chain Aptamer, Trigger chain, HP1 chain, HP2 chain, HP3 chain and HP4 chain of H.pylori form a fluorescence sensor in a selection buffer.

6. The method of any one of claims 1-5 for preparing a fluorescence sensor based on a cascade DNA assembly reaction of hairpin DNA strands, wherein: nucleic acid aptamer DNA sequences of helicobacter pylori (5 '-3');

the gene sequence of the Trigger chain is as follows:

GTAGCTGGATCTCGTCGATACACG；

the gene sequence of HP1 chain is:

CGTGTATCGACGAGATCCAGCTACTACACCAACGACGCTGGATCTCGTCGAGCCGAAAC；

the gene sequence of HP2 chain is:

ATCCAGCGTCGTTGGTGTAGTAGCTGGATCTCGTCGACTACACCAACGACG；

the gene sequence of HP3 chain is:

GCCG/Cy3/AAACGAGTCACTGTTT/BHQ2/CGGCTCGACGAG；

the gene sequence of HP4 chain is:

AGTGACTCGTTTCGGCCTCGTCGAGCCGAAAC。

7. a fluorescent sensor based on a cascade DNA assembly reaction of a hairpin DNA strand, characterized in that: the fluorescence sensor is prepared by the method of any one of claims 1 to 6.

8. A method for detecting helicobacter pylori based on a fluorescence sensor of a cascade DNA assembly reaction of hairpin DNA chains, which is characterized in that: the method uses the fluorescence sensor prepared by the method of any one of claims 1 to 7 for detecting helicobacter pylori bacteria.

9. The method for detecting helicobacter pylori based on the fluorescence sensor of the hairpin DNA chain cascade DNA assembly reaction of claim 8, wherein: the method comprises the following steps:

firstly, preparing a fluorescent sensor based on a cascade DNA assembly reaction of hairpin DNA strands according to the method of any one of claims 1 to 7;

then, helicobacter pylori of different concentrations are respectively reacted in the fluorescent sensor of S4, the fluorescence intensity of the fluorescent sensor is respectively tested, a standard curve is constructed, and a linear equation is obtained;

and finally, reacting the sample solution of the helicobacter pylori thallus to be detected in a fluorescence sensor prepared in S4, determining the fluorescence emission spectrum of the sample solution by using a fluorescence spectrometer, calculating the content of the helicobacter pylori according to a standard curve or a linear equation, and judging whether the helicobacter pylori is contained.

Images