KR102184574B1 - Composition for detecting DNA in real field using Universal Hybridization Chain Reaction - Google Patents

Abstract

The present invention relates to a composition, a method, and a kit for detecting a target nucleic acid in the field, and more particularly, amplification is possible at room temperature without special equipment, so that it is highly stable and versatile for a variety of targets, and provides sensitive and quantitative colorimetric signals. By generating it, it can be used to detect various pathogens in the field or diagnose diseases.

Description

Composition for detecting DNA in real field using Universal Hybridization Chain Reaction}

The present invention relates to a composition, a method, and a kit for detecting a target nucleic acid in the field, and more particularly, amplification is possible at room temperature without special equipment, so that it is highly stable and versatile for a variety of targets, and provides sensitive and quantitative colorimetric signals. By generating it, it can be used to detect various pathogens in the field or diagnose diseases.

Nucleic acid test (NAT) is a technology for diagnosing genotype by detecting the presence, amount, and variation of a nucleotide sequence using Watson-Click interaction and DNA replication, and detects single nucleotide polymorphism (SNP) or non-invasively samples. It can be collected and used to detect microRNA (miRNA), or to detect pathogens such as viruses to prevent infectious diseases.

Mainly, analysis methods based on PCR (polymerase chain reaction) have been most commonly used. This has various advantages such as high specificity and excellent sensitivity by using a primer set, but it requires special equipment, requires expensive experimental materials such as enzymes, and the analysis process is complicated, making it impossible to detect immediately in the field.

Therefore, the need for a signal amplification technology that does not require temperature cycling or a related control process has emerged to enable detection in the field. According to the developments to date, rolling circle amplification (RCA), nucleic acid sequence based amplification (NASBA), loop-mediated isothermal amplification (LAMP) and hybridization Hybridization chain reaction (HCR) techniques are known.

Among them, HCR technology has the advantage of obtaining a sensitivity similar to that of PCR without protein enzymes and strict temperature control. HCR is an enzyme-free amplification technique in which two stable hairpins are polymerized by an initiator to form a long-nicked dsDNA molecule. Although the principle of HCR has the advantage of being able to detect targets sensitively through signal amplification under mild conditions, the existing HCR technology has a fatal disadvantage that requires redesigning the sequence of the hairpin set every time according to the target. . Therefore, the present invention was to develop a new HCR-based gene biosensor that forms a G-quadruplex structure, and for this, first, a flexible configuration that can adapt to changes in the target sequence must be newly introduced. Since it is a structure that includes only a set of hairpins to be designed and included, there is a limit to the HCR technology development strategy that has been used.

The matters described as the above-described background art are only for enhancing understanding of the background of the present invention, and should not be taken as acknowledging that they correspond to the prior art already known to those of ordinary skill in the art.

Patent Document 1. Korean Patent Application Publication No. 10-2018-0082401

The present inventors made diligent efforts to discover a new method capable of specifically detecting a target nucleic acid. As a result, we devised a detection strategy that can detect various targets stably and sensitively through a simple design and can detect in the field without special equipment or complicated steps, and for this purpose, uHCR (universal hybridization) that forms a G-quadruplex structure. chain reaction), thereby completing the present invention by identifying a new gene biosensor.

Accordingly, it is an object of the present invention to specifically bind a target nucleic acid and a trigger monomer (Tr) when a specific target is present, and a target-binding trigger hairpin is applied to the first hairpin monomer and the second hairpin monomer. It is intended to provide a nucleic acid detection composition capable of generating a colorimetric signal that is amplified by and can be directly detected in the field without specific equipment through binding with hemin, a method of amplifying a nucleic acid through the same, and a method of detecting a target nucleic acid.

Another object of the present invention is to provide a nucleic acid detection kit comprising the nucleic acid detection composition, a hemin solution, and a color reaction substrate.

Other objects and advantages of the present invention will become more apparent by the following detailed description, claims and drawings.

According to one aspect of the present invention, the present invention specifically binds a target nucleic acid and a trigger monomer (Tr) when a specific target is present, and the target-binding trigger hairpin is the first hairpin monomer and the agent. 2 A nucleic acid detection composition capable of generating a colorimetric signal that is amplified by a hairpin monomer and can be detected directly in the field without specific equipment through binding with hemin, a method of amplifying a nucleic acid and a method of detecting a target nucleic acid. to provide.

As a result of trying to discover a new method that can specifically detect a target nucleic acid, the present inventors have tried to find a low concentration target in the field without special equipment or complicated steps based on uHCR (universal hybridization chain reaction) that forms a G-quadruplex structure. It has been confirmed that even nucleic acids can be detected and that various targets can be stably and sensitively detected through a simple design.

One aspect of the present invention includes (a) a first region complementary to a target nucleic acid, a second region complementary to the first region, and a second region forming a stem region, and a second region represented by SEQ ID NO: 1 forming a loop region. Trigger monomer (Tr) in the form of a hairpin formed by combining three regions;

(b) a first hairpin monomer (UH1) represented by any one selected from SEQ ID NOs: 7 to 9 capable of hybridizing with the trigger monomer; And

It relates to a nucleic acid detection composition comprising (c) a second hairpin monomer (UH2) represented by any one selected from SEQ ID NOs: 10 to 12 capable of hybridizing with the first hairpin monomer.

For detection of a target substance, the composition for detecting a uHCR-based nucleic acid forming a G-quadruplex of the present invention includes a hairpin type trigger monomer (Tr), a first hairpin monomer, and a second hairpin monomer. The trigger monomer binds to a target, and a signal is amplified by the first and second hairpin monomers. Since the first and second hairpin monomers form hybridization dependently on the triggering monomer bound to the target, a universal signal can be amplified regardless of the target.

The principle of detecting a target (T) through the composition for detecting a nucleic acid of the present invention is shown in FIG. 1.

Specifically, the three hairpins included in the nucleic acid detection composition are designed to have a toehold consisting of 6 nucleotides. Preferably, (a) the trigger monomer (Tr) is a toehold and a stem region. ) Has a first sequence (blue) capable of hybridizing with a target material, and a third sequence (bright blue) as a loop region complementary to the fourth sequence of the first hairpin monomer.

(b) The first hairpin monomer (UH1) includes a CatG4 sequence (sequence 5) (purple) forming a G-quadruplex structure at both ends of the stem region, wherein the catG4 sequence is 1 at both ends of the stem region. It is divided by the ratio of /3, 2/3.

When the target material is not present, (a) the trigger monomer, (b) the first hairpin monomer, and (c) the second hairpin monomer are closed in a stable state. In particular, (b) only 1/3 of the catG4 sequence, which forms the G-quadruplex structure divided in the stem region of the first hairpin monomer (UH1), also exists, so that the G-quadruplex structure cannot be formed.

In contrast, when the target material is present, the (a) trigger monomer (Tr) hybridizes with the target material to open the closed structure, and as a result, the first hairpin monomer (UH1) of the (a) trigger monomer (Tr)- The bonding site is exposed. As a result, (b) the first hairpin monomer (UH1) and (a) the trigger monomer (Tr) are hybridized, and (b) the second hairpin monomer (UH2) binding site present in the first hairpin monomer (UH1) is opened. . Accordingly, the first hairpin monomer (UH1) and the second hairpin monomer (UH2) are hybridized. The above process is repeated, and as a result, the first hairpin monomer (UH1) and the second hairpin monomer (UH2) continue to bind to each other to form a long linear DNA double strand (long chain). Reaction). At this time, the catG4 sequence closed in the stem region of the first hairpin monomer (UH1) is exposed, and a complete G-quadruplex structure is formed.Therefore, many G-quadruplexes in the long linear DNA strands formed by the nucleic acid detection composition The structure comes into existence.

Therefore, in this experiment, by treating hemin, the target can be detected using the peroxidase activity induced by the binding between the G-quadruplex structure and hemin.

The composition for detecting nucleic acids according to the present invention is a uHCR biosensor based on the formation of G-quadruplex that can be used in the field that can detect various target nucleic acids, and is a trigger monomer in the form of a hairpin having a base sequence complementary to the target nucleic acid (Tr ), each can be detected when targeting sequences modeled on four different tumor biomarkers (miR-21, miR-125b, KRAS-Q61K and BRAF-V600E) through simple design changes. Was confirmed. In addition, after the trigger monomer binds to the target nucleic acid, it is amplified through the first hairpin monomer and the second hairpin monomer, and by using the peroxidase activity formed through the binding process, the stability is achieved through hemin and TMB without any other equipment. It was confirmed that excellent, sensitive, and quantitative colorimetric signals can be generated. The composition for detecting nucleic acids according to the present invention can be used as a biosensor based on uHCR, has excellent specificity that can clearly distinguish even single nucleotide polymorphism (SNP), as well as target nucleic acids in a biological fluid in which FBS is mixed. It was confirmed that it can be accurately detected.

In other words, the nucleic acid detection composition according to the present invention can accurately and quickly detect various target nucleic acids through a simple design change (designed to match the first and second regions of the trigger monomer to the target nucleic acid), and through a colorimetric signal. Detection, evaluation, and analysis are all possible in the field without a device, and it has a very great advantage that no special equipment or complicated steps are required for the reaction. Therefore, the nucleic acid detection composition in the present invention, a kit including the same, is a uHCR biosensor, and it enables remote diagnosis because it can urgently detect various pathogens in the field or directly measure a patient, and the screening process in various studies This will be efficient and can be used for food or product monitoring.

In the trigger monomer (Tr), the first region is composed of a nucleotide sequence that specifically binds to a target nucleic acid in order to detect a target nucleic acid, and the length of the first region may be selected to match the length of the target nucleic acid. have. Preferably, the first region may include a complementary 10 to 50 base sequence.

In the trigger monomer (Tr), the second region includes a base sequence complementary to the first region to form a stem region in the form of a hairpin. In order to maintain the hairpin structure, it is preferable to further include 1 to 10 nucleotide sequence tails at the end of the nucleotide sequence complementary to the first region in the second region. More preferably, the tail portion may be the remaining sequence of the target nucleic acid not employed in the first region or a base sequence complementary thereto. If the above conditions are satisfied, the second region does not affect the physical or chemical properties of the trigger monomer (Tr), and thus can be properly designed and designed according to the sequence of the target nucleic acid.

More specifically, the composition for detecting a nucleic acid according to the present invention has high specificity, enabling quantification of a larger number of target nucleic acids, and different sequences of target nucleic acids enable quantitative and qualitative analysis for each target nucleic acid. The number of detectable target nucleic acids can vary with the use of triggering monomers.

The third region of the trigger monomer Tr is connected between the first region and the second region, forms a loop region in the form of a hairpin, and may be preferably represented by SEQ ID NO: 1.

The first hairpin monomer (UH1) is capable of hybridizing with the trigger monomer, and includes catG4 sequences at both ends, and may be represented by any one selected from SEQ ID NOs: 7 to 9.

The second hairpin monomer (UH2) consists of a sequence capable of hybridizing with the first hairpin monomer, and may be represented by any one selected from SEQ ID NOs: 10 to 12.

Most preferably, the first and second hairpin monomers are represented by SEQ ID NO: 9 and SEQ ID NO: 12 in order for the nucleic acid detection composition according to the present invention to have a stronger signal and smaller noise.

In one embodiment of the present invention, the trigger monomer was produced through a simple design change in order to detect four different tumor biomarkers (RNA and SNP), which is specifically a trigger monomer represented by SEQ ID NOs: 2 to 5 Was used. That is, if the first hairpin monomer and the second hairpin monomer are maintained as they are, and the first and second regions of the trigger monomer are designed with a sequence complementary to the target nucleic acid or single nucleotide polymorphism (SNP), the corresponding nucleic acid is not required. It was confirmed that it can be detected quickly and immediately in the field.

The nucleic acid detection composition is used in the process of forming HCR amplification by the first hairpin monomer and the second hairpin monomer when the trigger monomer specifically binds to the target nucleic acid, and the amplification product of the target nucleic acid is formed. In this case, nucleic acid amplification means amplifying a target nucleic acid in a sample by using a trigger monomer specific for an arbitrary arrangement of the target nucleic acid, a first hairpin monomer specific for the trigger monomer, and a second hairpin monomer.

Using such a nucleic acid detection composition, even when the target nucleic acid is present in only a trace amount in the sample, there is no loss of the extraction and purification process. Therefore, it becomes possible to detect a trace amount of target nucleic acid without causing a decrease in detection sensitivity. Accordingly, the work can be simplified and the working time can be shortened.

The above-described nucleic acid detection composition is added to nucleic acids recovered from a sample to perform a nucleic acid amplification reaction, and a method of extracting nucleic acids from a sample is not particularly limited as long as it is a method generally used in the art.

According to a preferred embodiment of the present invention, the trigger monomer of the present invention may be included in a concentration of 100 to 1000 nM, and when the concentration of the trigger monomer is changed in the experimental examples described later, the hybridization chain reaction process most proceeds at 500 nM. Therefore, it is most preferable to use the concentration of the trigger monomer at 500 nM.

According to a preferred embodiment of the present invention, the target nucleic acid is a nucleic acid derived from an infectious microorganism, human, mammal or plant, and may be RNA or DNA to be detected from a sample, or cDNA obtained by amplifying the RNA with reverse transcription polymerase. . For example, the target nucleic acid can be obtained from any cell, tissue or organism, in vitro, chemical synthesizer, and the like. The target nucleic acid can be obtained by any method approved in the art.

In the present invention, the nucleic acid refers to a polymer that may correspond to a DNA or RNA polymer, or an analog thereof. Nucleic acids are, for example, chromosomes or chromosomal segments, vectors (e.g., expression vectors), expression cassettes, naked DNA or RNA polymers, products of polymerase chain reaction (PCR), oligonucleotides, probes, and primers. May or may include it. Nucleic acids can be, for example, single-stranded, double-stranded, or triple-stranded, but are not limited to any particular length. Unless otherwise stated, a particular nucleic acid sequence includes or encodes a complementary sequence in addition to any sequence specified.

Nucleic acids can be extracted, isolated, or purified from a source or sample using methods and kits well known in the art.

In addition, since the present invention amplifies a specific nucleic acid, it is possible to directly analyze a target nucleic acid, and thus, a gene mutation-specific amplification is also possible in this regard, so that it can be used for SNP analysis. The SNP (Single Nucleotide Polymorphisms) refers to a genetic change or mutation showing a difference in one nucleotide sequence (A, T, G, or C) in a DNA sequence.

In the method of detecting a target nucleic acid, a mutation of a target nucleic acid or SNP of the present invention, the target nucleic acid may be present in a test sample, and includes DNA, cDNA or RNA, preferably genomic DNA.

Another aspect of the present invention relates to a nucleic acid amplification method comprising the step of amplifying a target nucleic acid sequence by contacting the nucleic acid detection composition with a sample.

The sample is not particularly limited as long as it is a conventionally known biological fluid, but may be preferably one that has undergone a process of extracting a nucleic acid. As for the nucleic acid extraction method, a conventionally known extraction method can be appropriately used depending on the sample.

The nucleic acid amplification step may be performed at 20 to 40°C. More preferably, in consideration of the practicality of the nucleic acid amplification process, the temperature condition of the nucleic acid amplification step may be room temperature.

In addition, the step of amplifying the nucleic acid may be performed for 0.5 to 10 hours. Since the nucleic acid amplification step tends to be gradually saturated as time increases, the nucleic acid amplification step is preferably performed for 2 hours in consideration of the practicality of the nucleic acid amplification process.

Another aspect of the present invention relates to a method for detecting a target nucleic acid comprising the following steps.

(I) adding the nucleic acid detection composition to a sample to amplify a sequence of a target nucleic acid;

(Ii) reacting by adding a hemin solution to the amplified product recovered from step (i);

(Iii) determining the presence of a target nucleic acid by adding a color reaction substrate to the reaction solution recovered from step (ii), and measuring the absorbance at 650 to 660 nm.

The sample is an object to be checked for the presence or absence of a target nucleic acid, and may be obtained from any cell, tissue or organism, in vitro, liquid or solid product, or a chemical synthesizer. As will be appreciated by those skilled in the art, the sample is a cell (including primary cells and cultured cell lines), cell lysates or extracts of virtually any organism (mammal samples are preferred, human samples are particularly preferred). (Including but not limited to RNA extract; purified mRNA), tissue and tissue extract (including but not limited to RNA extract; purified mRNA); Body fluids (including but not limited to blood, urine, serum, lymph, bile, cerebrospinal fluid, interstitial fluid, aqueous humor or vitreous fluid, colostrum, sputum, amniotic fluid, saliva, anal and vaginal secretions, sweat and semen), leaks, exudates (E.g., abscess, or liquid obtained from any other site of infection or inflammation), or joints (e.g., normal joints, or joints affected by diseases such as rheumatoid arthritis, osteoarthritis, gout or purulent arthritis) Amount of money; Environmental samples (including but not limited to air, agricultural, water and soil samples); Samples of biological warfare agents; It may include any number of samples including, but not limited to, extracellular fluid, extracellular supernatant from cell culture, bacterial inclusion bodies, cell compartments, cell periplasm, and mitochondrial compartments.

In addition, the sample may have been subjected to a step of extracting, isolating, or purifying a nucleic acid using a method and kit well known in the art.

In the nucleic acid detection method according to the present invention, as shown in FIG. 1, a target nucleic acid (T) and a trigger monomer (Tr) are combined and amplified by a first hairpin monomer and a second hairpin monomer to form long linear DNA strands (long chain). The characteristics of HCR (Hybridization Chain Reaction) are used. Specifically, in the long linear DNA strands formed through the HCR, a G-quadruplex structure is formed by the catG4 sequence present in the spam region of the first hairpin monomer, and the G-quadruplex structure and hemin interact, thereby To observe the Daze activity, a color-reactive substrate is used, and the absorbance is increased at its absorption wavelength. The presence or absence of a target nucleic acid can be detected using the color difference that occurs.

According to a preferred embodiment of the present invention, the concentration of hemin is not particularly limited since it may be appropriately selected according to the target nucleic acid or the surrounding environment, but it may be preferably included in the range of 100 to 1000 nM, and in the experimental examples described later When the concentration was less than 500 nM, the noise-to-signal ratio tended to increase significantly in proportion, so the hemin concentration is more preferably 500 to 1000 nM. In addition, since the signal is saturated at the highest concentration and does not increase any more, the hemin concentration is most preferably 500 nM.

Here, the color development reaction substrate is not particularly limited as long as it is a color development reaction substrate generally used in the art, but may be preferably TMB (3,3′,5,5′-tetramethyl benzidine). When the TMB is used as a color development reaction substrate, the absorbance at 650 to 660 nm (652 nm) generated therefrom is increased, and the presence or absence of the target nucleic acid can be detected through this optical difference. Confirmed through an example.

According to a preferred embodiment of the present invention, the target nucleic acid is a gene related to a disease, a gene related to infection (bacterial, viral, etc.), a gene related to genetically modified organisms (GMO), a gene for forensic investigation, or these And a mixture of one or more of them. Accordingly, the present invention not only provides a diagnostic method capable of detecting a nucleic acid quickly and conveniently, but also provides a possibility that it can be used as a biosensor for field diagnosis. In addition, by using the above phenomenon, it can be applied not only to the detection of nucleic acids, but also to the detection of biomaterials and chemicals.

As described above, the present invention not only detects the presence of the target nucleic acid, but also specifically binds to the target nucleic acid, so that the amount of the target nucleic acid contained in the sample can be accurately measured.

Specifically, for measuring the amount of target nucleic acid, a calibration curve for the target nucleic acid standard material is prepared using the fact that the absorbance value detected by the composition for detecting a nucleic acid of the present invention is proportional to the concentration of the target nucleic acid, and then the calibration curve is used as described above. It can be performed by analyzing the concentration of the target nucleic acid by substituting the absorbance obtained through step (iii).

In addition, the method of detecting a genetic variation can also be detected by proceeding in the same manner as the above-described detection process of the target nucleic acid, and specifically, by detecting a sequence complementary to a nucleic acid having a genetic variation, Existence can be confirmed.

In addition, the present invention is capable of discriminating one or more nucleotide variations occurring between sequences in a target nucleic acid, and can detect not only a target nucleic acid, but also a single nucleotide polymorphism (SNP).

In the nucleic acid detection method according to the present invention, only the first and second region sequences of the trigger monomer (Tr) need only be complementarily designed according to the target nucleic acid or single nucleotide polymorphism (SNP), thus simplifying the design and using a conventional DNA polymerase. Compared to the conventional detection method used, the target nucleic acid can be measured more sensitively and accurately. In addition, since the colorimetric signal can be checked with the naked eye without additional equipment, the presence or absence of a target nucleic acid and genetic variation (SNP) can be detected without a separate analysis device, thereby reducing analysis cost.

Another aspect of the present invention relates to a kit for detecting a target nucleic acid comprising the composition for detecting a nucleic acid, a hemin solution, and a color reaction substrate.

The nucleic acid detection kit may be provided as a solution in a well or microchannel on a substrate or on a biochip.

The substrate can be any solid support known in the art, such as a coated slide and microfluidic device capable of immobilizing a target nucleic acid. The substrate may be a surface, a membrane, a bead, a porous material, an electrode or an array.

The hemin concentration of the present invention may be included in the range of 100 to 1000 nM, and the noise-to-signal ratio showed a tendency to increase significantly in proportion when it was less than 500 nM in the experimental examples described later, so the hemin concentration was 500 to 1000 nM. It is desirable. In addition, since the signal is saturated at the highest concentration and does not increase any more, the hemin concentration is most preferably 500 nM.

Here, the color development reaction substrate is not particularly limited as long as it is a color development reaction substrate generally used in the art, but may be preferably TMB (3,3′,5,5′-tetramethyl benzidine). When the TMB is used as a color development reaction substrate, the absorbance at 650 to 660 nm (652 nm) generated therefrom is increased, and the presence or absence of the target nucleic acid can be detected through this optical difference. Confirmed through an example.

The features and advantages of the present invention are summarized as follows:

The composition, amplification method, and detection method capable of detecting a target nucleic acid according to the present invention accurately amplify a target nucleic acid to be detected, and a target nucleic acid using a trigger monomer having a hairpin structure, a first hairpin monomer, and a second hairpin monomer There is an advantage of being able to detect.

In addition, the detection method according to the present invention can analyze and confirm the target nucleic acid to be detected in the field, and can accurately detect the target nucleic acid in a biological fluid, thereby reducing analysis cost.

Therefore, the composition and detection method for detecting a target nucleic acid of the present invention can be usefully used for diagnosis and prognosis of various diseases.

1 shows a process of amplifying and detecting a target nucleic acid by the composition for detecting a nucleic acid according to the present invention.
2 is an image confirming the amplification product formed through a reaction with a target substance (miR-21) by gel electrophoresis when the composition for detecting a nucleic acid of Example 1 was treated.
3A shows different design structures (Examples 1, 2, and 3) of the first hairpin monomer and the second hairpin monomer.
3B is a graph showing measured signals and noise when a target substance is detected with the nucleic acid detection composition of Examples 1 to 3;
4A is a graph showing the experimental results when the concentration of the trigger monomer is changed. Statistical analysis was performed with t-distribution (n=4). ** and *** mean p values less than 0.01 and 0.001, respectively.
4B is a graph showing experimental results when the concentration of hemin (H) is changed. Statistical analysis was performed with t-distribution (n=4). ** and *** mean p values less than 0.01 and 0.001, respectively.
4C is a graph showing the experimental results when the reaction temperature of the HCR process is changed. Statistical analysis was performed with t-distribution (n=4). ** and *** mean p values less than 0.01 and 0.001, respectively.
4D is a graph showing the experimental results when the reaction time of the HCR process is changed. Statistical analysis was performed with t-distribution (n=4). ** and *** mean p values less than 0.01 and 0.001, respectively.
5A is an absorption spectrum for a case where the composition for detecting a nucleic acid of Example 3 was treated in the presence of various concentrations (0-200 nM) of a target substance. The error bar is the standard deviation of data obtained by repeating each of the three experiments three times.
5B is a calibration curve (652 nm) when the composition for detecting a nucleic acid of Example 3 was treated in the presence of various concentrations (0-200 nM) of a target substance. The error bar is the standard deviation of data obtained by repeating each of the three experiments three times.
6 is a result of signal/noise evaluation in the target substances when the compositions for detecting nucleic acids of Examples 3, 4, 5, and 6 were treated with respect to various target substances.
7 is a graph showing the measurement of the specificity evaluation of the method according to the detection of the target nucleic acid using the nucleic acid detection composition of Example 6. Each of M1, M2, and M3 has one, two, and three bases mutated in the target nucleic acid (T) sequence, and specific sequences are shown in Table 2. Experimental conditions were performed in the same manner as in FIG. 2, and statistical analysis was performed through t-distribution (n=4). *** means a p value less than 0.001.
8 shows the result of detecting a target substance from a biological fluid (including 5% FBS) using the composition for detecting a nucleic acid of Example 3 according to the present invention. The biological fluid was prepared by preparing an SPSC buffer (pH 7.5) containing 5% FBS (fetal bovine serum), and was tested by adding various concentrations of target nucleic acid (BRAF-V600E) to the biological fluid. Experimental conditions were a nucleic acid detection composition containing 500 nM Tr/UH1/UH2 (Example 6), 100 nM target nucleic acid (BRAF-V600E), 500 nM hemin, and HCR was performed at room temperature for 2 hours. The color development reaction was carried out for 1 hour using TMB as a substrate. Error bars represent standard deviations from at least three experiments. Statistical analysis was performed by t-distribution. *, ** and *** mean p values less than 0.05, 0.01 and 0.001, respectively.

Hereinafter, the present invention will be described in more detail through examples. These examples are only for describing the present invention in more detail, and it will be apparent to those of ordinary skill in the art that the scope of the present invention is not limited by these examples according to the gist of the present invention. .

Experimental materials and methods

<Experimental material>

All synthetic nucleotides used in the present invention were obtained from Cosmogenetech Co., Ltd (Seoul, Korea), and diluted with DEPC (diethylpyrocarbonate) treated water to prepare a stock solution of 20 μM.

The 20 bp DNA ladder was purchased from Takara Bio Inc (Kusatsu, Shinga, Japan). Hemin and hydrogen peroxide (30% w/w) were purchased from Sigma-Aldrich, Inc (Saint Louis, MO, USA). TMB (3,3',5,5'-Tetramethylbenzidine) was purchased from Alfa aesar (Ward Hill, MA, USA). DEPC (diethylpyrocarbonate) treated water was purchased from Biosesang Co., Ltd (Seongnam, Korea). Fetal bovine serum (FBS) was purchased from PAN-Biotech (Aidenbach, Germany).

All chemicals were used as analytical grades unless otherwise noted. SPSC buffer (50 mM Na ₂ HPO ₄ , 500 mM NaCl, pH 7.5) was used throughout the experiment, and the TMB solution (working solution) was used as a phosphate-citrate buffer (9 mL) for colorimetric detection. , pH 5.0), TMB stock solution (1 mL) and hydrogen peroxide (2 μL) were prepared by mixing. Hemin (5 mM) and TMB stock solution (1 mg/mL) were added to DMSO and then stored at -20°C where light was blocked. The sequence of nucleotides used in the present invention is summarized in Table 1 below.

Target gene division number Sequence (5'-3') Area 3 Tr One TTCT GGCTGCGCGTGGGTAG AGAAGA miR-21 Tr 2 ATCAGACTGATGTTGATGTTCT GGCTGCGCGTGGGTAG AGAAGA TCAACATCAGTCTGAT AAGCTA miR-125b Tr 3 AGACCCTAACTTGTGATGTTCT GGCTGCGCGTGGGTAG AGAAGA TCACAAGTTAGGGTCT CAGGGA KRAS Tr 4 AGGTCAAGAGGAGTATGTTCT GGCTGCGCGTGGGTAG AGAAGA TACTCCTCTTGACCT GCTGTG BRAF Tr 5 ACAGTGAAATCTCGATGTTCT GGCTGCGCGTGGGTAG AGAAGA TCGAGATTTCACTGT AGCTAG miR-21-mutation
(G->C)
(C->G) Tr 6 ATCAGACTGATGTTGATCTTGTCC GTGCGCGTGGGTAGGG AGAAGA TCAACATCAGTCTGAT AAGCTA conditon 1 UH1 7 TGGGAAA TCTTCT CTACCCACGCGCAGCC CAGACA GGCTGCGCGTGGGTAGGGCGGGT conditon 2 UH1 8 TGGGAAA TCTTCT CCCTACCCACGCGCACCG CAGACA CGGTGCGCGTGGGTAGGGCGGGT conditon 3 UH1 9 TGGGAAA TCTTCT CTACCCACGCGCAGCCAG CAGACA CTGGCTGCGCGTGGGTAGGGCGGGT conditon 1 UH2 10 GGCTGCGCGT GGGTAG AGAAGA ACGCGCAGCC TGTCTG conditon 2 UH2 11 CGGTGCGCGT GGGTAGGG AGAAGA ACGCGCACCG TGTCTG conditon 3 UH2 12 CTGGCTGCGCGT GGGTAG AGAAGA ACGCGCAGCCAG TGTCTG miR-21 Target 13 TAGCTT ATCAGACTGATGTTGA ^a miR-125b Target 14 TCCCTG AGACCCTAACTTGTGA ^a KRAS Target 15 CACAGC AGGTCAAGAGGAGTA M1 16 CACAGC AGGTAAAGAGGAGTA M2 17 CACAGC AGGTAAAGACGAGTA M3 18 CAGAGC AGGTAAAGACGAGTA BRAF Target 19 CTAGCT ACAGTGAAATCTCGA

In Table 1, the bold letters indicate the end of the target sequence and the end of the trigger nucleotide, italics indicate the loop region, blue indicates the sequence forming the G-quadruplex (catG4), and red indicates the target and the trigger nucleotide mismatch. Part. The nucleic acid used as a target was constructed from DNA of the same sequence.

<Experimental equipment>

Absorbance measurements were performed on an EPOCH2 microplate spectrophotometer (BioTek Instruments, Inc., Winooski, VT, USA) using a 96-well plate (Nest biotechnology Co., Ltd, Jiangsu, China). Agarose gel analysis was performed using a Mupid-2plus electrophoresis system (Optima Inc., Tokyo, Japan). Gel electrophoresis images were obtained using the Gel Documentation system LSG1000 (iNtRON Biotechnology, Seongnam, Korea).

<Example 1> Preparation of a composition for detecting nucleic acids based on uHCR forming G-quadruplex (condition 1)

In this experimental example, miRNAs (miR-21) (sequence 13) related to tumor development were used as target substances.

According to the target material, (a) the trigger monomer was designed and used in the second sequence, (b) the first hairpin monomer was used as the 6th sequence, and (c) the second hairpin monomer was used as the 9th sequence. The synthetic nucleotides of the above (a, b, c) were obtained from Cosmogenetech Co., Ltd (Seoul, Korea), and these were each diluted with DEPC (diethylpyrocarbonate) treated water and stored as a stock solution of 20 μM.

<Example 2> Preparation of a composition for detecting nucleic acids based on uHCR forming G-quadruplex (condition 2)

In this experimental example, miRNAs (miR-21) (sequence 13) related to tumor development were used as target substances.

According to the target material, (a) the trigger monomer was designed and used in the second sequence, (b) the first hairpin monomer was used as the 7th sequence, and (c) the second hairpin monomer was used as the 10th sequence. The synthetic nucleotides of the above (a, b, c) were obtained from Cosmogenetech Co., Ltd (Seoul, Korea), and these were each diluted with DEPC (diethylpyrocarbonate) treated water and stored as a stock solution of 20 μM.

<Example 3> Preparation of a composition for detecting nucleic acids based on uHCR forming G-quadruplex (condition 3)

In this experimental example, miRNAs (miR-21) (sequence 13) related to tumor development were used as target substances.

According to the target material, (a) the trigger monomer was designed and used in the second sequence, (b) the first hairpin monomer was used as the 8th sequence, and (c) the second hairpin monomer was used as the 11th sequence. The synthetic nucleotides of the above (a, b, c) were obtained from Cosmogenetech Co., Ltd (Seoul, Korea), and these were each diluted with DEPC (diethylpyrocarbonate) treated water and stored as a stock solution of 20 μM.

<Examples 4 to 6> Preparation of a composition for detecting nucleic acids based on uHCR forming G-quadruplex (various target nucleic acids)

This example relates to a composition for detecting a nucleic acid prepared according to a target nucleic acid. All were prepared in the same manner as in Example 3, except that the sequence of the trigger monomer was designed and used as follows according to the target nucleic acid.

When miR-125b of sequence 14 is used as the target material (a) the trigger monomer is designed and used in sequence 3 (Example 4), and when KRAS of sequence 15 is used as the target material (a) the triggering monomer is 4 The sequence was designed and used (Example 5), and when BRAF of sequence 19 was used as a target material (a) as the triggering monomer, sequence 5 was designed and used (Example 6). The synthetic nucleotides of the above (a) were obtained from Cosmogenetech Co., Ltd (Seoul, Korea), and these were each diluted with DEPC (diethylpyrocarbonate) treated water and stored as a 20 μM stock solution.

<Experimental Example 1> Validation of Example 1

In order to verify the validity of the composition for detecting nucleic acids constructed from Example 1, target substances of various concentrations were treated, and amplification was confirmed through 3% agarose gel electrophoresis.

First, the nucleic acid detection composition (trigger monomer, first hairpin monomer, and second hairpin monomer) constructed from Example 1 dissolved in DEPC-treated water and stored as a stock solution was diluted 1/10 times with SPSC buffer, respectively. The diluted trigger monomer, the first hairpin monomer, and the second hairpin monomer solution were heated at 95° C. for 2 minutes and gradually cooled at room temperature (25° C.) for 1 hour or more. Through the pretreatment process as described above, the trigger monomer, the first hairpin monomer, and the second hairpin monomer (Example 1) form a hairpin shape.

Each of the pretreated trigger monomer, the first hairpin monomer, and the second hairpin monomer 25 μl each at a concentration of 500 nM were mixed with various concentrations (1, 25, 50, 100, 200, 300 nM) of target material (miR-21) and SPSC buffer Was mixed with to prepare 100 µl of a reaction solution. The reaction solution was incubated at room temperature for 2 hours. At this time, the target material (miR-21) was diluted 2X and used, and the reaction solution was prepared by serial dilution with SPSC buffer.

The diluted solution was subjected to 3% agarose gel electrophoresis. This is to check whether a long chain is formed through the binding of the nucleic acid detection composition of Example 1 and the target material (miR-21), and by adding 4 µl of a 6X loading buffer to 20 µl of the reaction solution. Electrophoresis was performed. 40% glycerol was used as a 6X loading solution, and a 3% agarose gel was prepared using 1X TAE buffer (40 mM tris, 20 mM Acetic acid, 1 mM EDTA, pH 8.6). The gel was electrophoresed for 30 minutes at 100 V in 1X TAE buffer, and images were obtained therefrom.

2 is an image confirming the amplification product formed through a reaction with a target substance (miR-21) by gel electrophoresis when the composition for detecting a nucleic acid of Example 1 was treated. From the left, the results are shown for the 20 bp ladder, the control group (blank), the one treated with only the trigger monomer (Tr), and the target substances of various concentrations (0, 300, 200, 100, 50, 25 nM). The composition for detecting a nucleic acid of Example 1 contains 500 nM trigger monomer (Tr)/first hairpin monomer (UH1)/second hairpin monomer (UH2), and this with the target substance (miR-21) at room temperature for 4 hours Performed during.

As shown in FIG. 2, when the target substance (miR-21) was present, hybridization chain reaction (HCR) was performed by the nucleic acid detection composition of Example 1, and bands of various molecular weights were identified. It can be seen that as the concentration of the target substance increases, the intensity of the band gradually increases. However, when the target material was not present (control, Tr, 0 nM), no band corresponding to the amplification product of the hybridization chain reaction (HCR) was observed. That is, it can be seen that the composition for nucleic acid detection of Example 1 exists in a stable state when the target material does not exist, but when the target material is present, the binding site is exposed to perform hybridization chain reaction (HCR), and an amplification product is generated. have.

<Experimental Example 2> Optimization of the composition for detecting nucleic acids of Example 1

It is preferable that the trigger monomer, the first hairpin monomer, and the second hairpin monomer constituting the nucleic acid detection composition of Example 1 are designed in a structure capable of minimizing a background signal and maximizing an amplified signal. The sequences of the trigger monomer, the first hairpin monomer, and the second hairpin monomer constituting the nucleic acid detection composition of Example 1 were designed in consideration of the G-quadruplex structure having high signal-to-noise, and some modified structures (Example 2, A comparative experiment was also conducted for 3).

3A shows different design structures (Examples 1, 2, and 3) of the first hairpin monomer and the second hairpin monomer. The leftmost part contains the first hairpin monomer present in 1/3 of the catG4 sequence forming a G-quadruplex structure in the stem region (Example 1; Condition 1). The middle contains a first hairpin monomer with an increase of more than 1/3 of the catG4 sequence forming a G-quadruplex structure in the stem region (Example 2; Condition 2). On the right, the stem length of the second hairpin monomer was increased (Example 3; Condition 3).

An experiment was performed to detect the target substance (miR-21) using the nucleic acid detection composition constructed from Examples 1 to 3 above. Each experiment was carried out using the nucleic acid detection compositions of Examples 1 to 3, and the experimental method was conducted in the same manner, and therefore, in the following description, it is referred to as'nucleic acid detection composition'.

First, a composition for detecting nucleic acids (trigger monomer, first hairpin monomer, and second hairpin monomer) dissolved in DEPC-treated water and stored as a stock solution was diluted 1/10 times with SPSC buffer, respectively. The diluted trigger monomer, the first hairpin monomer, and the second hairpin monomer solution were heated at 95° C. for 2 minutes and gradually cooled at room temperature (25° C.) for 1 hour or more. Through the pretreatment process as described above, the trigger monomer, the first hairpin monomer, and the second hairpin monomer form a hairpin shape.

Each of the pretreated trigger monomer, the first hairpin monomer, and the second hairpin monomer, each having a concentration of 500 nM, were mixed with each of 25 µl of 100 nM of the target material (miR-21) and the SPSC buffer to prepare 100 µl of a reaction solution. The reaction solution was incubated at room temperature for 2 hours. At this time, the target material was diluted 2X and used, and the reaction solution was prepared by serial dilution with SPSC buffer (referred to as HCR process).

After the HCR process, hemin (500 nM) was added to the reaction solution or the diluted reaction solution to prepare a mixture, and the mixture was reacted at room temperature for 30 minutes. A final reaction solution was prepared by adding 100 µl TMB solution to the reaction mixture to induce a color development reaction. The final reaction solution was incubated at room temperature for 1 hour to induce substrate oxidation by DNAzyme catalyst, and the resulting signal was measured for absorbance at a wavelength of 652 nm.

3B is a graph showing measured signals and noise when a target substance is detected with the nucleic acid detection composition of Examples 1 to 3; The composition for detecting a nucleic acid of Example 1 comprises 500 nM trigger monomer (Tr)/first hairpin monomer (UH1)/second hairpin monomer (UH2), and the target material (100 nM) and hemin (500 nM) and Together, it was carried out at room temperature for 2 hours. After that, TMB was added as a substrate to perform a color reaction for 1 hour. The error bar is the standard deviation of the data obtained by repeating each experiment four times, and the statistical analysis was performed by t-distribution, and ** and *** mean p values less than 0.01 and 0.001, respectively.

As shown in FIG. 3B, the composition for detecting a nucleic acid of Example 1 contains a first hairpin monomer designed so that the catG4 sequence forming the G-quadruplex structure is separated at both ends. In particular, the first hairpin monomer of Example 1 is designed such that 1/3 of the entire catG4 sequence is blocked in the stem region. The second hairpin monomer was designed to be relatively short in length so as not to significantly affect other monomers.

Based on this, in the present invention, a hairpin set in which the ratio of the G-quadruplex sequence blocked in the stem region of the first hairpin monomer was increased (Example 2) or the stem region length of the second hairpin monomer was increased (Example 3). Was designed.

As a result, it was confirmed that the nucleic acid detection composition of Example 3 (p=0.000016) had a stronger signal and small noise than the nucleic acid detection composition of Example 1 (p=.0011). It is believed that the noise reduction in the nucleic acid detection composition of Example 3 is due to the fact that the second hairpin monomer contains a stable and long stem structure. In addition, the increase in the signal in the nucleic acid detection composition of Example 3 is believed to be because the second hairpin monomer has a positive effect on increasing the stability of the amplification product.

On the other hand, if the ratio of the G-quadruplex sequence in the stem region of the first hairpin monomer in the composition for nucleic acid detection of Example 2 is increased, the portion where the GC content is blocked increases, so that the HCR process is adversely affected, and relatively weak It is believed that the signal is generated. In conclusion, the nucleic acid detection compositions of Examples 1, 2, and 3 all exhibit a color reaction according to the presence of the target material, but the signal-to-noise ratio is significantly remarkable in the nucleic acid detection compositions of Examples 1 and 3, and Examples It was confirmed that the composition for detecting nucleic acids of 3 is most suitable.

<Experimental Example 3> HCR process optimization

In order to find the best performance conditions for detection of a target substance using the composition for detecting a nucleic acid according to the present invention, parameters such as trigger monomer concentration, hemin concentration, reaction temperature and reaction time were changed to confirm optimized conditions.

1) Trigger monomer (a) concentration change

The composition for detecting a nucleic acid of Example 3 was used, and at this time, an experiment was performed with the concentration of the trigger monomer being 500, 300, and 100 nM. HCR experimental conditions were all performed in the same manner as in Experimental Example 2 except for changing the concentration of the trigger monomer.

4A is a graph showing the experimental results when the concentration of the trigger monomer is changed. Statistical analysis was performed with t-distribution (n=4). ** and *** mean p values less than 0.01 and 0.001, respectively.

As shown in FIG. 4A, it was confirmed that the hybridization chain reaction (HCR) process proceeded the most when the trigger monomer was 500 nM. In particular, the p values for signal and noise at 500, 300, and 100 nM of the trigger monomers were 0.00015, 0.00118, and 0.0077, respectively. Based on these results, it can be seen that the trigger monomer is most preferred when 500 nM is used.

2) Hemin concentration change

The composition for detecting nucleic acids of Example 3 was used, and at this time, an experiment was performed with the concentration of hemin being 100, 250, 500, and 1000 nM. HCR experimental conditions were all performed in the same manner as in Experimental Example 2, except that the trigger monomer concentration was 500 nM and the concentration of hemin was changed.

4B is a graph showing experimental results when the concentration of hemin (H) is changed. Statistical analysis was performed with t-distribution (n=4). ** and *** mean p values less than 0.01 and 0.001, respectively.

As shown in FIG. 4B, when the hemin concentration was less than 500 nM, the noise-to-signal ratio was proportionally and significantly increased. However, since it was saturated at the highest concentration, it was confirmed that the hemin concentration was most preferably 500 nM. In the subsequent experiment, the hemin concentration was fixed to 500 nM.

3) HCR reaction temperature change

The composition for detecting nucleic acids of Example 3 was used, and at this time, the experiment was performed with the reaction temperatures of 25°C and 37°C in the HCR process. HCR experimental conditions were all performed in the same manner as in Experimental Example 2, except that the trigger monomer concentration and the hemin concentration were fixed to 500 nM, and only the HCR reaction temperature was changed.

4C is a graph showing the experimental results when the reaction temperature of the HCR process is changed. Statistical analysis was performed with t-distribution (n=4). ** and *** mean p values less than 0.01 and 0.001, respectively.

As shown in FIG. 4C, similar results were shown at both room temperature (25°C) and 37°C. Therefore, in consideration of the practicality of the detection process, the reaction temperature was set to room temperature, and in subsequent experiments, the reaction temperature was fixed to room temperature (25 °C) and used.

3) HCR reaction time change

The composition for detecting nucleic acids of Example 3 was used, and at this time, an experiment was performed with the reaction time of the HCR process being 0.5, 1, 1.5, 2, 2.5 hours. HCR experimental conditions were all performed in the same manner as in Experimental Example 2, except that the trigger monomer concentration and hemin concentration were fixed at 500 nM and the HCR reaction temperature was set at 25° C., and only the HCR reaction time was changed.

4D is a graph showing the experimental results when the reaction time of the HCR process is changed. Statistical analysis was performed with t-distribution (n=4). ** and *** mean p values less than 0.01 and 0.001, respectively.

As shown in Fig. 4d, as the time increases, the saturation tends to occur gradually. Therefore, when considering the practicality of the detection process, the reaction time was set to 2 hours, and in subsequent experiments, the reaction time was fixed to 2 hours.

HCR reaction conditions optimized through the experimental example are as follows. Trigger monomer concentration 500 nM, hemin concentration 500 nM, reaction temperature at room temperature (25 ℃; RT), reaction time is 2 hours.

<Experimental Example 4> Quantification and sensitivity evaluation

Under the optimized experimental conditions of uHCR (Universal Hybridization Chain Reaction) through the composition for detecting a nucleic acid according to the present invention, the sensitivity was evaluated by deriving a detection limit (LOD) and whether a target substance can be quantitatively detected.

The composition for detecting a nucleic acid of Example 3 was used, and at this time, the concentration of the target substance was changed to 0, 6.25, 12.5, 25, 50, 100, 200 nM, and all of the same as in Experimental Example 2 were performed. Absorbance was measured at a wavelength of 652 nm from the final reaction solution (FIG. 5B), and absorbance at 500 to 750 nm was measured at 5 nm intervals to obtain an absorption spectrum (FIG. 5A). The results were recorded with a microplate reader and are shown in Figs. 5A and 5B.

5A is an absorption spectrum for a case where the composition for detecting a nucleic acid of Example 3 was treated in the presence of various concentrations (0-200 nM) of a target substance. 5B is a calibration curve (652 nm) when the composition for detecting a nucleic acid of Example 3 was treated in the presence of various concentrations (0-200 nM) of a target substance. The error bar is the standard deviation of data obtained by repeating each of the three experiments three times.

As shown in FIGS. 5A and 5B, it was confirmed that the maximum value of the absorbance increases as the concentration of the target substance increases in the composition for detecting nucleic acids of Example 3. A calibration curve was prepared to confirm the correlation between the maximum value of absorbance and the concentration of the target substance. As a result, it was confirmed that the concentration of the target material and the absorbance had an excellent linear relationship. The regression equation was y=0.0059x+0.43 with a correlation coefficient of 0.9954, where x and y denote the concentration and absorbance of the target substance, respectively. That is, it can be seen that the composition for detecting a nucleic acid of the present invention can be quantitatively detected from a low concentration target substance to a high concentration target substance.

The LOD evaluated from the signal-to-noise ratio of 3σ was 5.67 nM. In other words, it was confirmed that the nucleic acid detection composition of the present invention and the method of detecting a target material through it can not only quantitatively analyze the target material, but also have excellent sensitivity, so that it can be effectively used for detection of a target material in the field without special equipment. I can.

<Experimental Example 5> Evaluation of versatility

It was intended to evaluate whether detection of various target substances is possible under the optimized experimental conditions of uHCR (Universal Hybridization Chain Reaction) through the composition for detecting nucleic acids according to the present invention.

Depending on the target material, the compositions for detecting nucleic acids of Examples 3, 4, 5, and 6 were used, and at this time, including SNPs (KRAS-Q61K (sequence 14) and BRAF-V600E (sequence 18)) related to tumor development. A portion of the DNA sense-strand sequence and the entire sequence of miRNAs (miR-21, miR125b) (SEQ ID NOs: 12 and 13) were used as target substances.

When the above different target substances are added, all signals for this are amplified and each of them is to be checked, except that in each case, a separate experiment is performed for each target using a trigger specific to the target to be detected. And it was carried out in the same manner as in Experimental Example 2.

6 is a result of signal/noise evaluation in the target substances when the compositions for detecting nucleic acids of Examples 3, 4, 5, and 6 were treated with respect to various target substances. Four types of cancer-related miR-21, miR-125b, KRAS and BRAF were used as target substances. The miR-21 and miR125b targets were prepared using the entire sequence as a model, and KRAS and BRAF targets were prepared with a sequence including KRAS-Q61K and BRAF-V600E. The experimental conditions were performed as shown in Fig. 2 (n=4).

In the detection of multiple targets, it is a very strong advantage that efficient design for various target nucleic acids is possible. In the composition for detecting a nucleic acid according to the present invention, the universality of the triggering monomer is an important factor in the originality of the strategy. In order to prove the versatility of the nucleic acid detection composition according to the present invention, miRNAs and multiple SNPs were used. As briefly described above, the following target nucleic acids known to be involved in cancer development were used for this experiment. Part of the DNA sense-strand sequence including SNPs (KRAS-Q61K (SEQ ID NO: 14) and BRAF-V600E (SEQ ID NO: 18)) and the whole of miRNAs (miR-21, miR125b) (SEQ ID NO: 12, SEQ ID NO: 13) The sequence was used as the target material.

As shown in Figure 6, the composition for detecting a nucleic acid according to the present invention is based on the uHCR system, except for the sequence of the triggering monomer (sequence 2, 3, 4, 5), all of the same Examples 3, 4, It was confirmed that all the signals of the target nucleic acids having different sequences were amplified by using the composition for detecting 5 and 6 nucleic acids.

That is, as each target nucleic acid was present, it was confirmed that signals were also detected. It is believed that a trigger monomer complementary to various target nucleic acids binds to make it open, and a signal amplifies by binding the trigger monomer in the open state to the signal amplification first hairpin monomer and the second hairpin monomer.

As a result, it can be seen that the nucleic acid detection composition (uHCR) according to the present invention works successfully even if the target nucleic acid is varied and the sequence to be targeted is varied.

<Experimental Example 6> Specificity evaluation (specificity test)

7 is a graph showing the measurement of the specificity evaluation of the method according to the detection of the target nucleic acid using the nucleic acid detection composition of Example 6. Each of M1, M2, and M3 has one, two, and three bases mutated in the target nucleic acid (T) sequence, and specific sequences are shown in Table 2. Experimental conditions were performed in the same manner as in FIG. 2, and statistical analysis was performed through t-distribution (n=4). *** means a p value less than 0.001.

name number Sequence(5'-3') T 15 CACAGCAGGTCAAGAGGAGTA M1 16 CACAGCAGGT A AAGAGGAGTA M2 17 CACAGCAGGT A AAGA C GAGTA M3 18 CA G AGCAGGT A AAGA C GAGTA

In detecting target nucleic acids such as SNPs and miRNAs, specificity relates to the ability to clearly distinguish base differences, and refers to whether or not base differences can be distinguished through signals. In order to confirm the specificity of the target nucleic acid detection composition (uHCR system) according to the present invention, a nucleic acid having a mutation in one base (M1), a nucleic acid having a mutation in two bases (M2), and a nucleic acid having a mutation in three bases ( M3) was checked for amplification/signal generation.

Specifically, the composition for detecting a nucleic acid constructed from Example 6 (trigger monomer targeting sequence 15, first hairpin monomer, and second hairpin monomer) was used as a nucleic acid of BRAF (sequence 15) and 1, 2, 3 bases. After mixing each of the mutated nucleic acids (M1, M2, M3), HCR reaction was performed, hemin and TMB solutions were added (refer to Experimental Example 2), and the reacting signals from each were measured. The specificity of the nucleic acid detection composition of the present invention was evaluated through the colorimetric signal.

As shown in FIG. 7, when BRAF (sequence 15; T) was used as the target substance, the signal/noise value was very high as 2.5, whereas the nucleic acids in which 1-3 bases were mutated (M1, M2, M3) In the case of using as the target substance, a significantly low value of less than 1.5 was confirmed.

That is, a high signal is observed in the target material having a complete sequence, whereas when any one of the target material is modified, the signal is significantly lowered.The composition for nucleic acid detection according to the present invention (Example 6) is the target material It can be seen that variants of can also be clearly distinguished.

In particular, the signal generated from BRAF (sequence 15; T) showed a statistically significant difference than that of M1 (p value=0.00047). The signal generated from M1 showed a statistically significant difference compared to that of M2 and M3 (p value = 0.00075, 0.00049, respectively). Therefore, it was confirmed that the composition for nucleic acid detection based on the uHCR system according to the present invention has excellent specificity to distinguish one or more base mismatches, and it can be seen that miRNA or SNP with high homology can be sufficiently detected. have.

<Experimental Example 7> Target detection in biological fluid

8 shows the result of detecting a target substance from a biological fluid (including 5% FBS) using the composition for detecting a nucleic acid of Example 3 according to the present invention. The biological fluid was prepared by preparing an SPSC buffer (pH 7.5) containing 5% FBS (fetal bovine serum), and was tested by adding various concentrations of target nucleic acid (miR-21) to the biological fluid. Experimental conditions were a nucleic acid detection composition containing 500 nM Tr/UH1/UH2 (Example 6), 100 nM target nucleic acid (miR-21), and 500 nM hemin, and HCR was performed at room temperature for 2 hours. The color development reaction was carried out for 1 hour using TMB as a substrate. Error bars represent standard deviations from at least three experiments. Statistical analysis was performed by t-distribution. *, ** and *** mean p values less than 0.05, 0.01 and 0.001, respectively.

An attempt was made to evaluate whether the composition for nucleic acid detection of the present invention and the method for detecting a target nucleic acid using the composition for detecting a nucleic acid of the present invention, which was completed based on uHCR, were affected by impurities and could be applied to a biological fluid. To this end, prepare a sample in which a target nucleic acid (BRAF-V600E) of various concentrations (100, 50, 25, 0 nM) was added to the biological fluid of SPSC buffer (pH 7.5) mixed with 5% FBS (fetal bovine serum). do. Here, the nucleic acid detection composition of Example 3 (trigger monomer targeting SEQ ID NO: 13, first hairpin monomer, and second hairpin monomer) was mixed, followed by HCR reaction, and hemin and TMB solution were added thereto. (Refer to Experimental Example 2), the signals reacted from each were measured. The specificity of the nucleic acid detection composition of the present invention was evaluated through the colorimetric signal.

As shown in FIG. 7, a composition for detecting a nucleic acid of the present invention (Example 3) was treated in a biological fluid to which various concentrations of a target nucleic acid were added, and a colorimetric signal for the target nucleic acid was measured. As a result, it was confirmed that when the concentration of the target nucleic acid (BRAF-V600E) was lowered, the signal level gradually decreased. That is, it can be seen that even in a biological fluid mixed with FBS, the composition for detecting a nucleic acid according to the present invention accurately and specifically detects the target nucleic acid (BRAF-V600E).

Specifically, the p values of 100, 50, and 25 nM were 0.00095, 0.024 and 0.0053, and the signal also increased as the concentration of the target nucleic acid (BRAF-V600E) increased, so that the composition for detecting the nucleic acid of the present invention was accurately targeted even in a biological fluid. It can be seen that the nucleic acid can be detected and the concentration of the target nucleic acid can be qualitatively identified.

As the specific parts of the present invention have been described in detail above, it is obvious that these specific techniques are only preferred embodiments and are not limited to the scope of the present invention for those of ordinary skill in the art. Therefore, it will be said that the substantial scope of the present invention is defined by the appended claims and their equivalents.

<110> INCHEON UNIVERSITY INDUSTRY ACADEMIC COOPERATION FOUNDATION <120> Composition for detecting DNA using Universal Hybridization Chain Reaction <130> 8295 <160> 19 <170> KoPatentIn 3.0 <210> 1 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> trigger hairpin (The third region) <400> 1 ttctggctgc gcgtgggtag agaaga 26 <210> 2 <211> 66 <212> DNA <213> Artificial Sequence <220> <223> trigger hairpin (Target miR-21) <400> 2 atcagactga tgttgatgtt ctggctgcgc gtgggtagag aagatcaaca tcagtctgat 60 aagcta 66 <210> 3 <211> 66 <212> DNA <213> Artificial Sequence <220> <223> trigger hairpin (Target miR-125b) <400> 3 agaccctaac ttgtgatgtt ctggctgcgc gtgggtagag aagatcacaa gttagggtct 60 caggga 66 <210> 4 <211> 64 <212> DNA <213> Artificial Sequence <220> <223> trigger hairpin (Target KRAS) <400> 4 aggtcaagag gagtatgttc tggctgcgcg tgggtagaga agatactcct cttgacctgc 60 tgtg 64 <210> 5 <211> 64 <212> DNA <213> Artificial Sequence <220> <223> trigger hairpin (Target BRAF) <400> 5 acagtgaaat ctcgatgttc tggctgcgcg tgggtagaga agatcgagat ttcactgtag 60 ctag 64 <210> 6 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> trigger hairpin (Target miR-21 mutant) <400> 6 atcagactga tgttgatctt gtccgtgcgc gtgggtaggg agaagatcaa catcagtctg 60 ataagcta 68 <210> 7 <211> 58 <212> DNA <213> Artificial Sequence <220> <223> The first hairpin <400> 7 tgggaaatct tctctaccca cgcgcagccc agacaggctg cgcgtgggta gggcgggt 58 <210> 8 <211> 60 <212> DNA <213> Artificial Sequence <220> <223> The first hairpin <400> 8 tgggaaatct tctccctacc cacgcgcacc gcagacacgg tgcgcgtggg tagggcgggt 60 60 <210> 9 <211> 62 <212> DNA <213> Artificial Sequence <220> <223> The first hairpin <400> 9 tgggaaatct tctctaccca cgcgcagcca gcagacactg gctgcgcgtg ggtagggcgg 60 gt 62 <210> 10 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> The second hairpin <400> 10 ggctgcgcgt gggtagagaa gaacgcgcag cctgtctg 38 <210> 11 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> The second hairpin <400> 11 cggtgcgcgt gggtagggag aagaacgcgc accgtgtctg 40 <210> 12 <211> 42 <212> DNA <213> Artificial Sequence <220> <223> The second hairpin <400> 12 ctggctgcgc gtgggtagag aagaacgcgc agccagtgtc tg 42 <210> 13 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> miR-21 <400> 13 tagcttatca gactgatgtt ga 22 <210> 14 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> miR-125b <400> 14 tccctgagac cctaacttgt ga 22 <210> 15 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> KRAS;T <400> 15 cacagcaggt caagaggagt a 21 <210> 16 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> KRAS;M1 <400> 16 cacagcaggt aaagaggagt a 21 <210> 17 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> KRAS;M2 <400> 17 cacagcaggt aaagacgagt a 21 <210> 18 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> KRAS;M3 <400> 18 cagagcaggt aaagacgagt a 21 <210> 19 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> BRAF <400> 19 ctagctacag tgaaatctcg a 21

Claims (12)

(a) A hairpin formed by combining a first region complementary to a target nucleic acid, a second region complementary to the first region and forming a stem region, and a third region represented by SEQ ID NO: 1 forming a loop region Form of the triggering monomer (Tr);
(b) a first hairpin monomer (UH1) represented by any one selected from SEQ ID NOs: 7 to 9 capable of hybridizing with the trigger monomer; And
(c) a second hairpin monomer (UH2) represented by any one selected from SEQ ID NOs: 10 to 12 capable of hybridizing with the first hairpin monomer; and,
The first region is composed of 10 to 50 nucleotide sequences complementary to the target nucleic acid, and the second region further includes six nucleotide sequence tails in addition to the nucleotide sequence complementary to the first region, forming a stem region. A composition for detecting nucleic acids, characterized in that. delete The method of claim 1,
The triggering monomer is a nucleic acid detection composition, characterized in that contained in a concentration of 100 to 1000 nM. The method of claim 1,
The target nucleic acid is an RNA or DNA to be detected from a sample, or cDNA obtained by amplifying the RNA with reverse transcription polymerase. The method of claim 1,
The triggering monomer is a nucleic acid detection composition, characterized in that represented by any one of SEQ ID NO: 2 to 4. The method of claim 1,
The nucleic acid detection composition is characterized in that when the trigger monomer specifically binds to the target nucleic acid, an amplification product is produced by HCR amplification by the first hairpin monomer and the second hairpin monomer. A nucleic acid amplification method comprising the step of amplifying a target nucleic acid sequence by contacting the composition for detecting a nucleic acid according to claim 1 with a sample. The method of claim 7,
The nucleic acid amplification step is a nucleic acid amplification method, characterized in that carried out for 20 to 40 ℃, 0.5 to 10 hours. (I) amplifying a sequence of a target nucleic acid by adding the composition for detecting a nucleic acid according to claim 1 to a sample;
(Ii) reacting by adding a hemin solution to the amplified product recovered from step (i);
(Iii) adding a color-developing reaction substrate to the reaction solution recovered from step (ii), and determining the presence of the target nucleic acid by measuring absorbance at 650 to 660 nm. The method of claim 9,
The (i) method for detecting a target nucleic acid, characterized in that carried out for 20 to 40 ℃, 0.5 to 10 hours. The method of claim 9,
The (ii) concentration of the hemin solution is 400 to 500 nM, characterized in that the target nucleic acid detection method. A kit for detecting a target nucleic acid comprising the composition for detecting a nucleic acid according to claim 1, a hemin solution, and a color reaction substrate.

Images