ES2950346T3 - Improved detection of short homopolymeric repeats - Google Patents

Abstract

The present application relates to the detection of changes in the number of nucleotides in short repeats of homopolymeric nucleic acids, in particular in short homopolymeric microsatellites, for example in order to diagnose microsatellite instability (MSI) and/or deficiency of mismatch repair (MMR-) in tumors. Accordingly, methods are provided for detecting changes in the number of nucleotides present in short repeat sequences of homopolymeric nucleotides, as well as kits and cartridges for the automated detection of such changes. (Automatic translation with Google Translate, without legal value)

Description

DESCRIPTION

Improved detection of short homopolymeric repeats

Technical field

The present application relates to the detection of changes in the number of nucleotides in short homopolymeric nucleic acid repeats, in particular in short homopolymeric microsatellites, for example, in order to diagnose microsatellite instability (MSI) and/or alteration of the reparative pathway (MMR-) in tumors. Accordingly, methods are provided for detecting changes in the number of nucleotides present in short homopolymeric nucleotide repeat sequences, as well as kits and cartridges for the automated detection of such changes.

Background of the invention

The DNA repair (MMR) pathway is an evolutionarily conserved system of multiple factors for recognizing and repairing defective insertions or deletions ("indels") of bases in the genome, which may arise during replication or recombination, or during the repair of some forms of DNA damage. In line with the above, there is evidence that altered MMR correlates with genomic instability and, therefore, is also involved in cancer progression.

In fact, alteration of MMR has been described in several types of cancer, including leukemia, ovarian, pancreatic or gastric cancer, and is an established cause of Lynch cancer sensitivity syndrome that is responsible for 2-5% of all endometrial (EM) or colorectal (CRC) tumors ( Jiricny, 2006). Importantly, tumors with MMR alteration show different prognoses and therapeutic outcomes after conventional cancer treatments ( N g and Schrag, 2010). For example, MMR-altered tumors from CRC patients do not appear to respond to 5-fluorouracil-based chemotherapy ( Fischery al., 2007 ), which is the first-line chemotherapy for CRC. Furthermore, tumors with alteration in MMR also tend to be resistant to cisplatin and carboplatin, which are frequently used in the treatment of MS cancer ( Hewish et al., 2010). Finally, these tumors were also observed to relatively rapidly develop resistance to targeted therapies, possibly due to their increased mutability and therefore also the easier acquisition of secondary mutations that can potentially affect other anti-inflammatory defenses. cancer.

Due to the fact that alteration of MMR was shown to affect the response of patients to cancer treatments, its effective detection can potentially have serious consequences on the effective treatment of patients and their survival. Due to the complexity of mutations affecting the MMR pathway, in clinical practice it is more common to test for MMR alteration by screening for its direct consequence, which is errors in DNA replication, rather than performing a detailed screening for selected mutations in MMR genes such as MLH1, MSH2, MSH6 or PMS2 ( Peltomaki, 1997). These errors in DNA replication are best manifested in changes in length variation in short tandem repeat sequences called microsatellites, a phenomenon called microsatellite instability or MSI.

Microsatellites are conduits of adjacent DNA motifs typically repeated 5 to 50 times (i.e., tandemly repeated) of one to five nucleotides. They are widely distributed throughout the mammalian genome and are most frequently located in its non-coding parts. For this reason, many microsatellites are biologically silent, allowing them to accumulate harmless mutations over generations, which can be used for DNA fingerprinting or other identification purposes. However, clonal loss (deletion) or gain (insertion) of one or more microsatellite repeat units in multiple microsatellites in a tissue from a single individual, but not in the surrounding tissue, is a hallmark of defective replication and strongly suggests an altered MMR and a propensity to develop cancer ( P inoly al., 2005).

Currently, the established standard of MSI analysis involves a PCR-based test on the DNA of cancer patients to determine the length of at least 5 microsatellite markers that include 2 mono- or homopolymers (BAT25, BAT26) of 25 and 26 nucleotides in length, and 3 dinucleotide repeats (D2S123, D5S346, D17S250) ( Boland et al., 1998). The panel of these 5 MSI markers was first proposed by the National Cancer Institute Research Workshop in Bethesda, Maryland, and is therefore now widely known as the Bethesda panel. A sample tested with the Bethesda panel is designated as having a high frequency of MSI or an “MSI-H” phenotype if 30% or more of the markers (so that at least 2 in the 5-marker panel ) were tested as unstable. If one of the five markers (or <30% of the tumor markers) scores positive for MSI, a sample is designated MSI-low or “MSI-L”. Finally, if no altered marker is found, a sample is considered stable to MSI or “MSS” ( Bolandy et al., 1998).

Despite being the current MSI test standard, the Bethesda panel tends to show low sensitivity, especially for cancers other than colorectal cancer for which it was initially developed ( Bolandy al., 1998). Therefore, alternative markers have been extensively tested, including those mentioned in, for example, Murphy et al., 2006 and Garcia-Alfonso 2012, and WO2013153130.

Another drawback of currently known approaches is their level of complication, need for specialized instruments that extend beyond conventional laboratory thermal cyclers, as well as their limited feasibility for automation. Currently existing detection techniques for MSI apply one of these principles: (i) use of fluorescently labeled primers for the detection of Bethesda panel markers, followed by capillary electrophoresis; (ii) high-resolution melting curve analysis of the 5 markers from the Bethesda panel using a dsDNA intercalation dye; (iii) mass spectrometric detection of alleles of a different length; and (iv) next-generation sequencing of large regions of DNA (e.g., exome), followed by counting the number of mutations.

For example, (i) Bethesda's initial PCR-based screening strategy requires interpretation by an expert observer which makes efficient and simple automation difficult. Next, (ii) high-resolution melting curve analysis with dsDNA intercalation dyes also using the long Bethesda panel markers, although in principle adaptable to conventional PCR thermal cyclers, suffers from very limited multiplexing capabilities for screening for several different MSI markers in a series since the melting temperature for each marker amplicon needs to be different enough not to produce overlapping signals. Furthermore, as this strategy relies on the formation of heteroduplexes between normal-length and mutant alleles, it is also less sensitive compared to the other alternatives. Next, (iii) the method based on mass spectrometry ( Zhao et al., 2014 ) is in principle also susceptible to automation but requires specialized instrumentation and highly qualified personnel for the interpretation of the data. Finally, (iv) detecting MSI status using next-generation sequencing (NGS) and counting the number of mutations observed undoubtedly has the advantage of looking at a large number of positions in the genome or exome rather than just in selective markers with high sensitivity for MSI. However, although this method is also in principle at least partially automatable, it is currently very expensive, requires a specialized NGS instrument, and remains slow and complicated due to the generation of a large amount of data that still needs to be analyzed by a specialist.

Therefore, currently existing techniques for determining MSI status have certain drawbacks, either related to their limited detection capabilities, costs and response time, or require specialized equipment and highly trained expert interpretation of the results. The present invention as defined in the appended claims solves the problems listed above by providing a highly sensitive, well-multiplexed and fully automatable method for the detection of changes in the number of nucleotides in short homopolymeric microsatellites that can be used by any thermocycling instrument. by quantitative PCR. This and other advantages of the present invention are presented below.

Summary of the invention

The present invention is defined in the attached independent claims. Preferred embodiments are defined in the dependent claims. In particular, the present invention relates to a method for detecting changes in the number of nucleotides present in a homopolymeric nucleotide repeat sequence equal to or less than 15 bp in length, the method comprising the steps of:

- generating amplicons by amplifying a nucleic acid sequence comprising the target homopolymeric repeat sequence equal to or less than 15 bp in length and its specific flanking sequences;

- heating the generated amplicons in the presence of at least one signal-generating molecular beacon oligonucleotide probe comprising a sequence complementary to the target homopolymeric repeat sequence and capable of hybridizing with the target homopolymeric repeat sequence and its specific flanking sequences, and detecting changes in the resistance of the signal generated by said probe as a function of temperature to obtain at least one melting curve; and

- deducing the number of nucleotides present in the target homopolymeric repeat sequence from the at least one melting curve;

The method is characterized in that said at least one signal-generating molecular beacon oligonucleotide probe comprises a structural feature or modification that protects said probe from the 3'-5' exonuclease activity of the polymerase; and because the step of generating amplicons is carried out in a PCR that comprises a polymerase that has 3'-5' exonuclease activity.

In a preferred embodiment, the method of the present invention uses fluorescently labeled probes to detect length variations in short homopolymeric repeat regions in a conventional quantitative PCR thermocycling instrument without the need for any additional equipment for post-analysis analysis. PCR. Therefore, in a particularly advantageous embodiment, the signal generating reagent is at least one labeled (i.e. signal generating) oligonucleotide probe, preferably being a molecular beacon probe, which It comprises a sequence complementary to the target homopolymeric repeat sequence and capable of hybridizing with said target homopolymeric repeat sequence and its specific flanking sequence. Most preferably, the sequence capable of hybridizing with the target homopolymeric repeat sequence comprises a sequence identical or perfectly complementary to a mutant of said target homopolymeric repeat sequence, said mutant comprising a deletion of at least one homonucleotide in said homopolymeric repeat sequence. diana compared to its wild type form.

In a further aspect, the present invention provides a kit, preferably in cartridge form, for detecting changes in the number of nucleotides present in a target homopolymeric nucleotide repeat sequence equal to or shorter than 15 bp in length, said kit comprising at least one, preferably a plurality of oligonucleotide probes that are molecular beacons, each comprising a sequence capable of hybridizing with a sequence comprising a different specific homopolymeric repeat sequence equal to or less than 15 bp in length; said kit also preferably comprises a proofreading polymerase. Advantageously, each of said molecular beacon probes comprises a sequence capable of hybridizing with different target homopolymeric nucleotide repeat sequences and being identical to or complementary to at least individual homonucleotide deletion mutant sequences of each of said different homopolymeric repeat sequences. Diana.

Finally, the present invention also provides uses of the methods, kits and/or cartridges provided herein for the detection of microsatellite instability (MSI), in particular in a sample from a cancer patient.

Brief description of the figures

For a more complete understanding of the nature of the present invention, reference is made to the following detailed description taken together with the accompanying drawings, in which:

Figure 1: Shows the melting curves (panel A) and melting peaks (panel B) characterizing the hybridization kinetics as a function of temperature for the TMEM65-specific molecular beacon probe that hybridizes with three target sequences that have different numbers. of homonucleotides in the homopolymeric repeat sequence of TMEM65;

Figure 2: Shows melting peaks characterizing the microsatellite stability state of TMEM65 in 10 wild-type (WT) and microsatellite stable (MSS) samples (black curves, TMEM65 repeat length of 11) and in 10 samples of unstable microsatellites (MSI-high [MSI-H]) (gray curves, TMEM65 repeat length of 10);

Figure 3: shows TMEM65 probe melting peaks for two randomly selected MSS samples MSS 1 and MSS 2;

Figure 4: Shows TMEM65 probe melting peaks for three randomly selected MSI-H samples (MSI-H 1-3), each shown against a TMEM65 probe melting peak obtained for the stable MSS 1 sample. to MSI.

Figure 5 shows melting peaks for ABAT marker-specific molecular beacon probes comprising (panel A) a stem that is resistant to the exonuclease activity of Q5 polymerase, or (panel B) a stem that is degraded by Q5 polymerase.

Detailed description of the invention

The present invention relates to new methods, kits and cartridges, as well as uses thereof, for detecting even very small changes in the number of nucleotides (for example, /1 nt) present in a short one, that is, at least 10 nucleotides shorter than the homopolymeric nucleotide repeat sequences of the Bethesda BAT25 panel marker. In line with this, the present invention provides methods, kits and cartridges, as well as uses thereof, for the detection of instability of short homopolymeric microsatellite markers (<15 bp, preferably <12 bp), for example, such as those described in document WO2013153130.

In particular, the present invention relates to a method for detecting changes in the number of nucleotides present in a homopolymeric nucleotide repeat sequence equal to or less than 15 bp in length, preferably 12 bp, as defined by the appended claims.

The method provided herein has the advantage of being completely automatable and adaptable to any conventional quantitative PCR thermocycling instrument, allowing it to be performed by regular laboratory personnel without the need for specialized training. In addition to the above, the method is highly sensitive, adequately multiplexed, and can provide an estimate of the relative amounts of the detected homopolymeric nucleotide repeat sequences and variants thereof.

Currently existing methods for MSI detection have the following disadvantages:

(a) to determine the repeat length requiring additional specialized equipment to perform post-PCR analysis and/or this analysis should normally be interpreted by a highly trained expert; either

(b) in the case of a high resolution melting curve with dsDNA intercalation dyes, the disadvantage is a very limited multiplexing capacity in order to avoid overlapping melting signals from different amplicons and, furthermore, it does not provide capacity to quantify the relative amounts of unstable sequences (mutants) with respect to stable ones (wild type).

The present application overcomes these drawbacks by performing melting curve analysis using fluorescently labeled probes highly sensitive to mutants, where each label can be detected in a different fluorescent channel. In a particularly preferred aspect for its sensitivity embodiment, the sequence in the probe capable of hybridizing with the target homopolymeric repeat sequence comprises a sequence identical or complementary to a mutant sequence of the target homopolymeric repeat sequence, said mutant comprising a deletion of at least one homonucleotide in said target homopolymeric repeat sequence compared to the wild type (i.e., expected) form.

Along these lines, in a preferred embodiment, a method is provided for detecting changes in the number of nucleotides present in a homopolymeric nucleotide repeat sequence equal to or less than 15 bp in length, the method comprising the steps of:

- generating amplicons by amplifying a nucleic acid sequence comprising the target homopolymeric repeat sequence and its specific flanking sequences;

- the detection of a signal generated by a probe hybridizing specifically with the homopolymeric repeat sequence and its flanking sequences; and

- deduce the number of nucleotides present in the target homopolymeric repeat sequence;

said method being characterized in that the probe comprises a sequence identical or complementary to a mutant sequence of said target homopolymeric repeat sequence, wherein said mutant sequence comprises a deletion of at least one homonucleotide in said target homopolymeric repeat sequence compared to the form expected wild-type of the target homopolymeric repeat sequence.

As used herein, the term " nucleic acid" and its equivalent "polynucleotide", as used herein, refer to a polymer of ribonucleosides or deoxyribonucleosides comprising phosphodiester bonds between nucleotide subunits. Nucleic acids include, but are not limited to, DNA and RNA, for example, including genomic DNA, mitochondrial DNA or meDNA, cDNA, mRNA, rRNA, tRNA, hnRNA, microRNA, lncRNA and various modified versions thereof. They can most commonly be obtained from natural sources such as biological samples obtained from different types of organisms. On the other hand, nucleic acids can also be synthesized, recombined or otherwise produced in any of the methods devised by humans (for example, PCR). .

Of course, in a preferred embodiment, amplification is preferably performed by polymerase chain reaction or PCR using a means for performing PCR such as a thermocycler. Advantageously, for better automation purposes, the PCR is preferably performed using means for performing qPCR that provides easy monitoring of the signals generated from the signal generating reagent.

The term “quantitative PCR" or simply “qPCR" is provided herein to define a laboratory technique based on the polymerase chain reaction (PCR), which is used to simultaneously amplify and detect or quantify a molecule. of DNA selected as a target. Unlike conventional PCR where the reaction product is detected at its end, i.e. after thermocycling has finished, the key feature of qPCR is that the DNA product is being detected during thermocycling as it the reaction progresses in “real time”; Therefore, the alternative name for qPCR is “real-time PCR”. There are currently many different types of qPCR. For example, when started with a reverse transcription (RT) step, qPCR can be used to quantify the number of messenger RNA and is then called reverse transcriptase qPCR or an RT-qPCR. As used herein, the terms “quantitative PCR” or simply “qPCR” will be used in preference to the term “real-time PCR” or “RT-PCR" to avoid confusion with reverse transcription PCR, also frequently abbreviated as RT-PCR. Most qPCRs use one of the two most common methods to detect product amplification in real time; (a) intercalation of non-specific fluorescent dyes with any double-stranded DNA, or (2) sequence-specific DNA probes consisting of oligonucleotides that are labeled with a fluorescent reporter that allows detection only after hybridization of the probe with its sequence complementary target. Fluorescent signals generated during thermocycling are detected by an appropriate optical detection system and are followed from the time they pass the background threshold until the reaction reaches plateau. The number of Copies of the target sequences can be estimated using a relative or absolute quantification strategy, typically by analyzing the shape of the obtained amplification curve (calibration curve strategy) or by determining when the signal rises above a certain threshold value (often called Ct value, but sometimes also Cp value or Cq value). In relative quantification, target nucleic acid levels estimated in a given sample using Ct or calibration curve analysis are expressed relative to values obtained for the same target in another reference sample, for example, a sample of untreated control. In contrast, in absolute quantification, the qPCR signal is related to the input copy number using a calibration curve or can also be calculated based on a more recent digital PCR method. At the moment, the first strategy is even more predominant and bases the estimation of the amount of target DNA by comparing the values obtained with a previously prepared calibration curve. These and other qPCR quantification strategies are widely known in the art and their calculation may differ more or less depending on a given application and qPCR system.

As used herein, the term “means for performing quantitative PCR” will be understood as a minimum necessary arrangement of reagents and elements to perform a qPCR. It will typically include any reagent that allows detectable real-time PCR thermocycling of a nucleic acid template received from a nucleic acid source Such reagents include, but depending on the type of qPCR are not limited to a PCR grade polymerase, at least one set of primers, a detectable dye or a probe, dNTPs, buffer PCR, etc. In addition, the “means for performing quantitative PCR” will typically also include any minimum set of parts conventionally known in the art, which typically includes, but is not limited to, the following: (1) a suitable compartment (further referred to as “ a "thermocycling qPCR compartment" where detectable thermocycling can take place in real time. Such compartments may, for example, be formed by a chamber suitable for amplifying nucleic acids, i.e. made of appropriate material and providing sufficient temperature regulation internal, and which also comprise at least one wall that allows real-time detection of signals generated during such amplification, for example, a wall transparent to light. Furthermore, (2) means for varying the temperature in this chamber or other compartment, as is widely known from various existing thermocycling machines. Next, (3) means to detect the signals generated during qPCR thermocycling, such as an optical detector coupled to a computer, etc. In summary, such a minimum set will typically include any system or systems known in the art capable of initiating and maintaining the thermocycling reaction in the thermocycling qPCR compartment, adjusting and regulating the temperature to ensure stable thermocycling conditions therein, etc. ; In addition, it will also include any appropriate detection device or devices, means for data processing (for example, a computer alternatively connected to a database), and output systems that allow reading and monitoring the thermocycling of the qPCR reaction in real time (typically a computer screen showing the progress of the reaction in an appropriate graphical user interface); as well as any suitable software package to operate the machinery and/or display and possibly also assist in the interpretation of the results obtained.

In principle, in possible embodiments, any target-specific oligonucleotide probe suitable for performing melting curve analysis can be used in the method of the invention. Preferred known probes may comprise a pair consisting of a fluorophore and a quencher, and may also advantageously form secondary structures such as loops or hairpins.

In a preferred embodiment, the at least one labeled oligonucleotide probe is a molecular beacon oligonucleotide probe. Molecular beacon probes, or molecular beacons, are hairpin-shaped molecules with an internally quenched fluorophore whose fluorescence is restored when bound to a target nucleic acid sequence. For this reason, molecular beacons are not degraded by the action of the polymerase and can be used in the study of their hybridization kinetics to their target by calling the melting curve. A typical molecular beacon probe is approximately 25 nucleotides in length, but can be longer. Typically, at least the middle 15 nucleotides are complementary to its nucleic acid target while the five nucleotides at each terminal end are complementary to each other, allowing the beacon to assemble into a loop or hairpin structure. A molecular beacon that does not hybridize to its target can be divided into 4 structural parts: (1) the loop, which is a 18-30 bp region that is complementary to and hybridizes to the target sequence; (2) the stem which is formed by the terminal 5-7 nucleotides at both ends of the loop linked complementary to each other; (3) the fluorophore covalently attached to the 5' end of the molecular beacon; and (4) the quencher covalently attached to the 3' end of the molecular beacon. Such a structure ensures that when the beacon does not hybridize with its target and closes in the hairpin structure, the quencher quenches the fluorescent emission of the dye so that no signal is generated. But when hybridization occurs, a duplex is formed between the nucleic acid target and the molecular beacon loop that breaks the hairpin structure, removes the dye quencher, and ultimately results in the generation of the signal. fluorescent.

In a preferred embodiment of the above embodiment, the molecular beacon oligonucleotide probe comprises a sequence identical or complementary to a homopolymeric repeat sequence mutant comprising a deletion of at least one homonucleotide in the target homopolymeric repeat sequence. Such a molecular beacon design allows for specific detection with selected highly sensitive MSI markers where polymerase sliding errors have occurred, while at the same time remaining sufficiently sensitive to wild-type (i.e., expected) marker forms. that have at least one longest repetition of the repetitions. It should be noted that the term “target homopolymeric nucleotide repeat sequence” is intended to mean the wild-type or reference homopolymeric repeat sequence as expected under conditions where MSI is not present. In contrast, by “mutant homopolymeric nucleotide repeat sequence” is meant a homopolymeric nucleotide repeat sequence that comprises an insertion or deletion of at least one homonucleotide in the homopolymeric repeat sequence.

Due to the thus conveyed specificity of a given molecular beacon probe to a homopolymeric repeat marker and the unstable variants (mutants) thereof, it is also possible to design a multiplexing assay, where at least two molecular beacon probes are used. in a reaction tube or compartment.

Therefore, in a particularly advantageous embodiment, a method is provided where at least a second molecular beacon oligonucleotide probe is labeled differently than the first molecular beacon oligonucleotide probe, wherein said second molecular beacon oligonucleotide probe is used. Molecular beacon comprises a sequence capable of hybridizing with a second target homopolymeric nucleotide repeat sequence that is different from the first target homopolymeric nucleotide repeat sequence.

Preferably, particularly specific molecular beacon probes are used. Therefore, in an advantageous embodiment a method is provided wherein the second target homopolymeric nucleotide repeat sequence comprises a sequence identical or complementary to a mutant sequence comprising a deletion of at least one homonucleotide in said second target homopolymeric repeat sequence.

During amplification of homopolymeric repetitive regions, polymerase slippage is known to occur. This leads to errors in copying the original number of repeated nucleotides, causing the accumulation of artificial deletions or insertions in the amplified PCR product. Therefore, in another preferred embodiment of the method of the invention, the step of generating amplicons is performed in a PCR that comprises a proofreading polymerase, that is, a polymerase that has 3'-5' exonuclease activity. Many such PCR-grade polymerases are known and commercially available. Examples include, but are not limited to, polymerases such as Q5, Pfx, Pfu, Ex Taq, etc.

In a further development of the above embodiment, to protect the oligonucleotide probes from the potential threat that the 3'-5' exonuclease activity of the proofreading polymerase may arise, it is advantageous to structurally modify the beacons such that they cannot be digested. Therefore, in a particularly advantageous embodiment of the method of the invention, especially from the point of view of the stability of the assay, the at least one signal-generating labeled oligonucleotide probe comprises a characteristic or structural modification that protects said probe from the activity 3'-5' exonuclease of the polymerase, said characteristic or structural modification being selected from:

- inverted dT at the 3' end of the probe;

- at least one phosphorothioate bond located before any of the last three nucleotides at the 3' end of the probe.

It has been observed that, depending on the proofreading polymerase, some proofreading polymerases do not digest certain molecular beacons whose stem is made by certain sequences. This unexpected observation probably results from the fact that molecular beacon stems depending on their sequences have different 3D structures. Therefore, it could be hypothesized that certain proofreading polymerases are incapable of targeting molecular beacons whose stem structure is incompatible with the catalytic center of the proofreading polymerase. Regardless of the mechanism, we have observed that the provision of some types of molecular beacon stems can render them completely immune to the 3'-5' exonuclease activity of certain proofreading polymerases. In line with the above, in an alternative embodiment, a method is provided wherein the sequence-specific probe is a molecular beacon oligonucleotide probe and wherein the protective structural feature or modification is a stem resistant to 3'-5 activity. ' exonuclease. Such stems can be easily transplanted into a molecular beacon of interest by any nucleic acid cloning or recombination technique known in the art.

One of the main advantages of the method of the invention as defined in the appended claims is its simple automation and adaptation, especially in known conventional qPCR systems. Therefore, in a particularly preferred embodiment, the steps of the method are performed in an automated system. A system particularly suitable for such automation is a Biocartis Idylla platform, which further provides automation of sample processing.

Advantageously, the method is preceded by any of the following steps:

- providing a source of a nucleic acid potentially comprising the target homopolymeric repeat sequence, said source preferably being a biological sample;

- releasing and/or isolating the nucleic acid potentially comprising the target homopolymeric repeat sequence from the source of a nucleic acid;

- providing said released and/or purified nucleic acid potentially comprising the target homopolymeric repeat sequence to the step of generating amplicons;

where at least the stages of:

- releasing and/or isolating the nucleic acid potentially comprising the target homopolymeric repeat sequence from the source of a nucleic acid;

- providing said released and/or purified nucleic acid potentially comprising the target homopolymeric repeat sequence to the step of generating amplicons;

They are also done in an automated system.

Furthermore, particularly advantageous and requiring minimal manipulation and technical preparation of the above embodiment, a method may be provided wherein at least the steps of:

- releasing and/or isolating the nucleic acid potentially comprising the target homopolymeric repeat sequence from the source of a nucleic acid;

- providing said released and/or purified nucleic acid potentially comprising the target homopolymeric repeat sequence to the step of generating amplicons;

- generating amplicons by amplifying a nucleic acid sequence comprising the target homopolymeric repeat sequence; and

- heating the amplicons generated in the presence of a signal-generating oligonucleotide probe and detecting changes in the resistance of said signal as a function of temperature to obtain at least one melting curve;

They are made in a cartridge that can be coupled with said automated system.

As used herein, the term "cartridge" should be understood as a self-contained assembly of chambers and/or channels, which is formed as a single object that can be transferred or moved as an accessory into or out of a larger instrument. suitable to accept or connect to such cartridge. Some parts contained in the cartridge may be firmly connected, while others may be connected and moved flexibly with respect to other components of the cartridge. Similarly, as used herein, the term " fluid cartridge" shall be understood as a cartridge that includes at least one chamber or channel suitable for treating, processing, discharging or analyzing a fluid, preferably a liquid. An example of such a cartridge is provided in WO2007004103. Advantageously, a fluid cartridge may be a microfluidic cartridge. In the context of fluid cartridges, the terms "downstream" and "upstream" may be defined in relation to the direction in which fluids flow in such a cartridge. Specifically, a section of a fluid path in a cartridge from which a fluid flows to a second section in the same cartridge should be interpreted as positioned upstream of the latter. Similarly, the section to which a fluid arrives later is positioned downstream with respect to a section through which said fluid passed before.

In general, as used herein, the terms "fluid" or sometimes "microfluidics" refer to systems and arrangements that address the behavior, control and manipulation of fluids that are geometrically restricted to a small scale, typically submillimeter in size. at least one or two dimensions (e.g., width and height or a channel).Such small volume fluids are moved, mixed, separated or otherwise processed on a microscale requiring small size and low energy consumption. Microfluidic systems include structures such as micropneumatic systems (pressure sources, liquid pumps, microvalves, etc.) and microfluidic structures for the manipulation of micro, nano, or picoliter volumes (microfluidic channels, etc.). They were described exemplary fluid systems in EP1896180, EP1904234 and EP2419705 and, accordingly, may be applied in certain embodiments

In a particularly desired embodiment according to the embodiments listed above, to simplify and facilitate the interpretation of the results of the method according to the present invention, the melting curve analysis is also performed in an automated manner by means of computer-implemented software. Such software can be instructed to recognize the characteristic position of defined melting peaks (or inflection points) that characterize the hybridization of a particular probe to a particular target and is obtained by plotting the negative first derivative of a melting curve obtained for said pair of probe and target. Therefore, in another preferred embodiment, a method is provided wherein the step of deducing the number of nucleotides present in The target homopolymeric repeat sequence of the at least one melting curve is performed by evaluating the position or a relative position of at least one peak of the first derivative of said melting curve, and is more preferably performed in a fully automated manner.

In a further aspect, the present invention also provides kits for carrying out the method according to the invention. In particular, the present invention provides a kit for detecting changes in the number of nucleotides present in a target homopolymeric nucleotide repeat sequence equal to or shorter than 15 bp in length, said kit comprising at least one molecular beacon oligonucleotide probe, preferably a plurality of molecular beacon oligonucleotide probes, each molecular beacon comprising a sequence capable of hybridizing with a sequence comprising a different target homopolymeric repeat sequence equal to or less than 15 bp in length, and preferably said kit also comprises a polymerase of reading correction. Preferably, each of said plurality of molecular beacon probes comprises a sequence capable of hybridizing with a particular target homopolymeric nucleotide repeat sequence (preferably being different from the homopolymeric nucleotide repeat sequences targeted by other molecular beacons) and that is identical or complementary to a mutated form of said particular target repeat sequence such that said mutated form loses at least a single homonucleotide (i.e., is a deletion) in said target homopolymeric repeat sequence compared to the wild type form .

In a preferred embodiment, a kit is provided in cartridge form. Therefore, advantageously, the present invention provides a kit wherein said at least one, preferably a plurality of molecular beacon oligonucleotide probes, and preferably also a proofreading polymerase, are provided in a cartridge that can be coupled with a system. automated. As described above, a suitable example of a cartridge and an automated system that can be coupled therewith is the Biocartis Idylla platform. Additional details of this and similarly applicable to the present systems can be found in WO2007004103, EP1896180, EP1904234 and EP2419705. As can be seen from the documents cited herein, advantageous cartridges not only comprise means for performing PCR but can also be designed to directly accept a nucleic acid source or a sample, release nucleic acids from said acid source nucleic acid, and providing (e.g., pumping) the nucleic acid thus released for the subsequent PCR-based assay.

As used herein, the term "source of a nucleic acid" should be understood as any liquid or solid substance, which comprises or is expected to comprise a nucleic acid. A source of nucleic acid may be, for example, an artificially created solution comprising a synthetic or recombinant nucleic acid such as among many others a solution containing a ligation product, an electrophoresis marker (referred to as a "molecular weight marker"). , a reserve of primers, etc. However, more commonly, a source of nucleic acid will be a biological sample obtained from an organism or cells that are part of or derived from it, preferably a clinical sample obtained from a patient.

As used herein, the term “ biological sample,” or simply “sample,” is intended to include a variety of biological sources containing nucleic acid and/or cellular material, regardless of whether it is freshly obtained from an organism (i.e. i.e., freshly obtained tissue sample) or preserved by any method known in the art (for example, a FFPE sample). Examples of biological samples include: cell cultures such as mammalian cells but also eukaryotic microorganisms, liquids body fluid precipitates, lavage sample, fine needle aspirates, biopsy samples, tissue samples, cancer cells, other types of cells obtained from a patient, cells from a tissue or cells cultured in vitro from an individual are testing and/or treating for a disease or infection, or forensic samples. Non-limiting examples of body fluid samples include whole blood, bone marrow, cerebrospinal fluid (CSF), peritoneal fluid, pleural fluid, lymphatic fluid, serum , plasma, urine, chyle, feces, semen, sputum, nipple aspirate, saliva, swab sample, lavage or lavage fluid and/or brushing samples.

Once a biological sample is provided in the systems or during the performance of the methods, it will generally be contacted with a composition to provide a lysate where nucleic acid is released. As used herein, "contacting" means placing, exposing, incubating or mixing the sample and the composition. "Release" refers to releasing, obtaining and/or reversing cross-linking. To release nucleic acid from a sample, protease activity and pH buffering of the composition may be required. Release may require the potential precipitation activity of the composition of non-nucleic acid components present in the sample investigated and the removal/dissolution of the fixative. Release may require conditions such as heating or high-intensity focused ultrasound (HIFU). In one embodiment, a biological sample is introduced into a cartridge compatible with an automated system such as a diagnostic analyzer, wherein the sample processing steps involve contacting various solutions and releasing nucleic acids.

Furthermore, the term "means for releasing or purifying nucleic acid from the biological sample" should be understood as any plurality of chemical reagents and/or physical elements as known in the art that are known to be used to release nucleic acids from cells or other structures in a biological sample, and, in the case of purification, sufficiently separating said nucleic acids from unwanted sample residues in a manner acceptably pure (where the term “acceptably” depends on the further purpose of such purified nucleic acids), usually in an aqueous solution. Chemical reagents suitable for such purpose include, for example, any detergent and/or buffer known in the art comprising detergents, chaotropic agents, nuclease inhibitors, etc., which are used in the destruction and/or liquefying of tissues or cells. and, therefore, they release nucleic acids contained therein into the solution. Similarly, physical elements known in the art to be used in various sample processing methods for the purpose of nucleic acid release/purification include, for example, solid silica supports such as resins in spin columns, silica membranes, beads etc. additional mechanical disruptors or machines that generate disruptive energy such as sonicators, etc.

In line with the above, advantageously, the present description also provides a cartridge for the automated detection of changes in the number of nucleotides present in a homopolymeric nucleotide repeat sequence equal to or less than 15 bp in length, the cartridge comprising

- a sample compartment for receiving a biological sample;

- a means for releasing or purifying nucleic acid from the biological sample received in the sample compartment, said means being capable of entering into fluid communication with said sample compartment; - a PCR compartment located downstream of the sample compartment and the means for releasing or purifying nucleic acid, and configured to receive at least a portion of the released or purified nucleic acid or at least a portion of the nucleic acid library prepared in the library compartment, said thermocycling PCR compartment being suitable for amplifying nucleic acids and allowing the detection of signals generated during or after such amplification

the cartridge characterized in that it further comprises at least one, preferably a plurality of molecular beacon oligonucleotide probes as described above, and a proofreading polymerase, preferably in the PCR compartment.

In a preferred embodiment, the molecular beacon oligonucleotide probes, and/or the proofreading polymerase may be provided in said cartridge in a dotted format, which contributes to a longer useful life of such a cartridge according to the invention.

Finally, it is also an object of the invention to provide a use of methods, kits and cartridges according to the invention as defined in the appended claims for the detection of microsatellite instability (MSI), preferably in a sample obtained from a patient. diagnosed with or expected to have cancer.

EXAMPLES

1. Molecular beacon fusion curve for MSI marker in TMEM65

The ability of a preferred embodiment of the method presented herein to detect even very minor changes of 1 nt in length in a homopolymeric nucleotide repeat sequence will be demonstrated herein using a human TMEM65 marker, located at Chr8:125325217 , and containing a homopolymeric repeat of 11 adenines (A). The wild-type (WT) homopolymeric repeat sequence (in bold and underlined) and its TMEM65-specific surrounding sequence is provided below:

TAAATAAAATTCACTAAATAAGATATAATGAGATTAGGAGTATGAATATGGGGTATTCAGACTT

ATTCCATTCAGATGAGAAGATGACATCTTTGGAGGGAAAAAAAAAAACCTTACCAAATAATAATA

AATTGTATCTCATTAATCTTTCAAACATCACTTCAACTTCATCATTTATACCATAAACCTTCTT

GACAGTTC

To detect nucleotide changes in the repeat sequence of TMEM65, a molecular beacon detection probe having the sequence of CGCACGAGGGAAAAAAAAAACCTTACGTGCG was designed and labeled with FAM as a fluorescent labeling molecule, while dabcyl was used as a quencher ( the stem region of the molecular beacon probe is indicated in italics, the hybridization region of the probe is in bold where the repeat sequence is identical to the mutated TMEM65 marker comprising 10 adenine repeats instead of 11 is in bold and underlined).

To test the ability of the TMEM65-specific probe to bind and recognize both the TMEM65 w T marker sequence and its two different mutant homologues being a deletion or insertion of a homonucleotide, 3 synthetic TMEM65 targets were prepared representing the 3 different variants of the TMEM65 homopolymer repeat. The sequences of all three such variants are provided below as DNA strands that are complementary to the TMEM65-specific molecular beacon probe. (containing poly-A repeats) that hybridizes with said variant chains. The complementary TMEM65 variant chains (containing poly-T repeats) are as follows:

TMEM65_T10 (1 bp deletion):

AAATGATGAAGTTGAAGTGATGTTTGAAAGATTAATGAGATACAATTTATATTATTTGGTAAG

GTTTTTTTTTTCCCTCCAAAGATGTCATCTTCTCATCTGAATGGAATAAGTCTGAATAC

TMEM65_T11 (reference):

AAATGATGAAGTTGAAGTGATGTTTGAAAGATTAATGAGATACAATTTATATTATTTGGTAAG

GTTTTTTTTTTTCCCTCCAAAGATGTCATCTTCTCATCTGAATGGAATAAGTCTGAATAC

TMEM65_T12 (1 bp insert):

AAATGATGAAGTTGAAGTGATGTTTGAAAGATTAATGAGATACAATTTATATTATTTGGTAAG

GTTTTTTTTTTTTCCCTCCAAAGATGTCATCTTCTCATCTGAATGGAATAAGTCTGAATAC

The TMEM65-specific molecular beacon probe was added at a concentration of 200 nM to 3 independent PCR tubes, each containing one of the 3 variants described above at the concentration of 2500 nM in conventional PCR reaction buffer. The mixture was then denatured on a Bio-Rad CFX96 instrument for 2 min at 95°C and then cooled to 45°C for 15 min to allow sufficient time for the molecular beacon probe to hybridize to its target. Melting curve analysis was then performed by heating the mixture to 75 °C in steps of 0.3 °C (5 s per cycle) and fluorescence was measured after each 0.3 °C increase.

The results of the melting curve analysis are shown in Figure 1, where top panel A shows the melting curves (as fluorescence over time) of the TMEM65-specific probe with respect to the three targets, and where lower panel B shows melting peaks or negative first derivatives of the melting curves in A. The Tm values for the three melting peaks were: 54.9 °C for TMEM65_T10, 51.3 °C for TMEM65_T11, and 47.7 °C for TMEM65_T12. The delta Tm values of the melting peaks were:

TMEM65_T10 - TMEM65_T11 = 3.6°C

TMEM65_T11 - TMEM65_T12 = 3.6°C

TMEM65_T10 - TMEM65_T12 = 7.2°C

Based on these results, it can be concluded that the deletion or insertion of a single nucleotide compared to the reference sequence (i.e., the T10 or T12 repeat versus the T11 reference repeat) results in a difference of several °C ( degrees Celsius) in the melting peak Tm compared to the melting peak Tm for the reference sequence. Therefore, the length of this repeated sequence in the TMEM65 gene can be determined by analyzing the fusion peaks produced by hybridization of the described molecular beacon probe to its target region.

2. Evaluation of TMEM65 MSI Marker Status in Cancer Patient Samples

FFPE samples from colorectal cancer patients were provided in Biocartis Idylla fluid cartridges. Cartridges were closed and loaded onto the Biocartis Idylla platform for automated PCR-based genetic analyses, after which automated sample processing was initiated. First, patients' DNA was released from the FFPE samples and then pumped into the PCR compartments of the cartridges. Next, asymmetric PCR amplification of the region surrounding the homopolymeric repeat sequence of TMEM65 on each cartridge was performed using the following primers forward: 5'-CAGACTTATTCCATTCAGATGAGA-3' and reverse: 5'-GAAGTGATGTTTGAAAGATTAATGAGA-3'. PCR amplification was performed in the presence of the TMEM65-specific molecular beacon probe described above.

After PCR, the PCR products were denatured on the cartridges for 2 min at 95 °C and then cooled to 45 °C for 15 min to allow sufficient time for hybridization of the TMEM65-specific molecular beacon probe with their targets. A melting curve analysis was then performed still on the Idylla system by heating the mixture from 40 °C to 60 °C in steps of 0.3 °C (5 s per cycle) and at the same time time monitoring fluorescence signals after every 0.3 0C. The melting peaks were calculated as the negative values of the first derivatives of the melting curves obtained.

Figure 2 shows the results obtained from 10 wild-type samples (black curves, TMEM65 repeat length of 11) considered as microsatellite stable (MSS) and 10 mutant samples (gray curves, TMEM65 repeat length of 10) considered as unstable microsatellites (high MSI [MSI-H]). Note the consistent peak heights of the wild-type A11 peak (at ±49 0C) in the MSS samples, while in the MSI-H samples both the wild-type A11 peak and the mutant A10 peak (at ± 53 0C) have a variable height. This reflects the varying proportions of wild-type and mutant alleles present in each sample.

Figures 3 and 4 show representative examples of FFPE samples from MSS and MSI-H, respectively. In Figure 4, in each of the panels A-C representing three different MSI-H samples, MSS 1 is shown as a wild-type reference. Sample MSI-H 1 contains a lower content of the mutant allele than the wild-type allele, since the height of the mutant A10 peak (at ±53 0C) is lower than the height of the wild-type A11 peak (at ±49 0C ). Sample MSI-H 2 contains similar amounts of wild-type and mutant allele, as the height of the mutant A10 peak (at ±53 0C) is similar to the height of the wild-type A11 peak (at ±49 0C). Sample MSI-H 3 contains a greater amount of the mutant allele than the wild-type allele, since the height of the mutant A10 peak (at ±53 0C) is greater than the height of the wild-type A11 peak (at ±49 0C ).

The results presented herein demonstrate that the procedure of using a molecular beacon probe, as described here, allows the determination of the number of nucleotides present in the TMEM65 homopolymeric repeat sequence in DNA from biopsies of FFPE tissue from colorectal cancer. Additionally, this method allows an estimation of the relative amounts of wild-type and mutant TMEM65 repeat alleles present in tumor biopsy DNA.

3. Performance of different molecular beacon probes in the presence of a proofreading polymerase

To achieve greater sensitivity of the method described herein, it is advantageous to use in the PCR amplification mixture a proofreading polymerase (i.e., an error correction) that has 3'-5' exonuclease activity. However, for many molecular beacons in the mix it was observed that different proofreading polymerases tested can degrade different beacons, resulting in partial or complete loss of signal and thus also interfering with or preventing the reliable interpretation of data.

An example of the above is shown in Figure 5. Upper panel A shows melting peaks obtained in the DNA of 2 clinical FFPE samples with a proofreading Q5 polymerase and a molecular beacon probe of a sequence CGCAGGAAGCTAAAAAAAAAACCCTTCTGCG (which has a Texas Red marker and an Iowa Black FQ quencher) designed to detect possible homonucleotide losses in an MSI ABAT marker. The darkest continuous peak corresponds to an MSS (stable) sample where ABAT is wild type and comprises 11 adenine repeats. The circled line shows a double curve obtained on DNA from an MSI-H sample comprising a higher deletion peak on the right side of the curve and a smaller WT peak on the left side. The WT peak is usually observed in MSI-H tumor samples since there is almost always contamination of tumor tissue always with WT DNA from the surrounding tumor stroma.

Such stable results could be obtained repetitively with other samples when using the proofreading Q5 polymerase and the ABAT-specific molecular beacon described above without the need to additionally protect said beacon with any additional chemical modifications. It has been hypothesized that this likely results from the 3D structure of such a beacon stem which is incompatible for binding and digesting by the exonuclease active center of Q5 polymerase.

A completely different fusion profile, shown on the left side of the lower panel B of Figure 5, was obtained with the Q5 polymerase for another molecular beacon specific for ABAT and having the sequence of CCGTCCGAAGCTAAAAAAAAACCCTTGGACGG (same marker and quencher). This probe was able to be efficiently and repeatedly degraded by the exonuclease activity of Q5 polymerase during PCR. Because the beacon degraded over the course of PCR, no signal could be obtained during post-PCR melting curve analysis (graph is flat). The right side of panel B shows a qPCR profile for the same probe demonstrating that the beacon is functional and generates signal during PCR. Since the signal is no longer present in the post-PCR melt, this demonstrates that the signal generated during PCR was caused by beacon degradation.

It was observed that in PCRs performed using Q5 polymerase, but with other molecular beacon probes specific for different MSI markers, the same trend was observed depending on which of the stems previously described for the two ABAT-specific probes was present in the given beacon.

Claims (12)

1. A method for detecting changes in the number of nucleotides present in a homopolymeric nucleotide repeat sequence equal to or less than 15 bp in length, the method comprising the steps of: - generating amplicons by amplifying a nucleic acid sequence comprising the target homopolymeric repeat sequence equal to or less than 15 bp in length and its specific flanking sequences; - heating the generated amplicons in the presence of at least one signal-generating molecular beacon oligonucleotide probe comprising a sequence complementary to the target homopolymeric repeat sequence and capable of hybridizing with the target homopolymeric repeat sequence and its specific flanking sequences, and detecting changes in the resistance of the signal generated by said probe as a function of temperature to obtain at least one melting curve; and - deducing the number of nucleotides present in the target homopolymeric repeat sequence from the at least one melting curve; the method characterized in that said at least one signal-generating molecular beacon oligonucleotide probe comprises a structural feature or modification that protects said probe from the 3'-5' exonuclease activity of the polymerase and because the step of generating amplicons is carried out in a PCR that comprises a polymerase that has 3'-5' exonuclease activity. 2. The method according to claim 1, wherein said signal generating molecular beacon oligonucleotide probe comprises 4 structural parts: (1) the loop, which is a 18-30 nt region that is complementary to and hybridizes to the target sequence; (2) the stem which is formed by the terminal 5-7 nucleotides at both ends of the loop linked complementary to each other; (3) the fluorophore covalently attached to the 5' end of the molecular beacon; and (4) the quencher covalently attached to the 3' end of the molecular beacon. 3. Method according to claim 1 or 2, wherein at least one second molecular beacon oligonucleotide probe labeled differently than the first molecular beacon oligonucleotide probe is used, wherein said second molecular beacon oligonucleotide probe comprises a sequence capable of hybridizing with a second target homopolymeric nucleotide repeat sequence that is different from the first target homopolymeric nucleotide repeat sequence, and wherein the sequence capable of hybridizing with the second target homopolymeric nucleotide repeat sequence comprises a sequence complementary to said second target homopolymeric repeat sequence and its specific flanking sequences. 4. Method according to any of the preceding claims, wherein said characteristic or structural modification protects the at least one signal-generating labeled molecular beacon oligonucleotide probe from the 3'-5' exonuclease activity of the polymerase is selected from: - inverted dT at the 3' end of the probe; - at least one phosphorothioate bond located before any of the last three nucleotides at the 3' end of the probe. 5. Method according to claim 4, wherein said characteristic or structural modification is a stem resistant to 3'-5' exonuclease activity. 6. Method according to any of the previous claims, wherein the steps of: - generating amplicons by amplifying a nucleic acid sequence comprising the target homopolymeric repeat sequence and its specific flanking sequences; - heating the amplicons generated in the presence of the at least one signal-generating oligonucleotide probe, and detecting changes in the resistance of said signal as a function of temperature to obtain at least one melting curve; and - deduce the number of nucleotides present in the target homopolymeric repeat sequence from the at least one melting curve are carried out in an automated system. 7. Method according to claim 6, said method preceded by any of the following steps of: - providing a source of a nucleic acid potentially comprising the target homopolymeric repeat sequence, said source preferably being a biological sample; - releasing and/or isolating the nucleic acid potentially comprising the target homopolymeric repeat sequence from the source of a nucleic acid; - providing said released and/or purified nucleic acid potentially comprising the target homopolymeric repeat sequence to the step of generating amplicons; where at least the stages of: - releasing and/or isolating the nucleic acid potentially comprising the target homopolymeric repeat sequence from the source of a nucleic acid; - providing said released and/or purified nucleic acid potentially comprising the target homopolymeric repeat sequence to the step of generating amplicons; They are also done in an automated system. 8. Method according to claim 7, wherein at least the steps of: - releasing and/or isolating the nucleic acid potentially comprising the target homopolymeric repeat sequence from the source of a nucleic acid; - providing said released and/or purified nucleic acid potentially comprising the target homopolymeric repeat sequence to the step of generating amplicons; - generating amplicons by amplifying a nucleic acid sequence comprising the target homopolymeric repeat sequence; and - heating the amplicons generated in the presence of a signal-generating oligonucleotide probe and detecting changes in the resistance of said signal as a function of temperature to obtain at least one melting curve; They are made in a cartridge that can be coupled with said automated system. 9. A method according to any of the preceding claims, wherein deducing the number of nucleotides present in the target homopolymeric repeat sequence from the at least one melting curve is performed by evaluating the position or a relative position of at least one peak of the first derivative of said melting curve, and is preferably carried out in an automated manner. 10. A kit for detecting changes in the number of nucleotides present in a target homopolymeric nucleotide repeat sequence equal to or less than 15 bp in length, said kit comprising a polymerase that has 3'-5' exonuclease activity and at least one, preferably a plurality of molecular beacon oligonucleotide probes, each molecular beacon oligonucleotide probe comprising a sequence capable of hybridizing with a different target homopolymeric repeat sequence equal to or less than 15 bp in length and its flanking sequences, in where each of the sequences capable of hybridizing with the different target homopolymeric repeat sequences comprises a sequence complementary to the target homopolymeric repeat sequence and its specific flanking sequence, and where each molecular beacon comprises a characteristic or structural modification that protects said probe of the 3'-5' exonuclease activity of the polymerase. 11. Kit according to claim 10, wherein said at least one, preferably a plurality of molecular beacon oligonucleotide probes, and preferably also the polymerase having 3'-5' exonuclease activity, are provided in a cartridge that can be coupled with an automated system. 12. Use of a method according to claims 1-9 and/or kits according to claims 10-11 for the detection of microsatellite instability (MSI), preferably in a sample obtained from a patient diagnosed with or expected to suffer from a cancer.