CN113549646B

CN113549646B - Pea CRISPR/Cas9 gene editing vector, gene editing system and gene editing method

Info

Publication number: CN113549646B
Application number: CN202110816683.8A
Authority: CN
Inventors: 杨涛; 李冠; 宗绪晓; 刘荣; 魏鹏程
Original assignee: Institute of Crop Sciences of Chinese Academy of Agricultural Sciences
Current assignee: Institute of Crop Sciences of Chinese Academy of Agricultural Sciences
Priority date: 2021-07-20
Filing date: 2021-07-20
Publication date: 2023-06-13
Anticipated expiration: 2041-07-20
Also published as: CN113549646A

Abstract

The invention provides a pea CRISPR/Cas9 gene editing vector, a gene editing system and a gene editing method, and relates to the technical field of gene editing. The present invention modifies the existing vector pHUC411 for editing rice genes, and replaces the original ZmUBI, osCas9 and OsU on pHUC411 with en35s promoter, psCas9 encoding gene and PsU6.3 respectively. The CRISPR/Cas9 gene editing vector is utilized to construct a CRISPR/Cas9 gene editing system, and the gene editing is carried out on peas, so that the gene editing efficiency in peas can be up to 8.32%, and up to 7 mutation types are generated, thereby improving the gene editing efficiency of peas and laying a good foundation for the gene function research and genetic breeding of peas.

Description

Pea CRISPR/Cas9 gene editing vector, gene editing system and gene editing method

Technical Field

The invention belongs to the technical field of gene editing, and particularly relates to a pea CRISPR/Cas9 gene editing vector, a gene editing system and a gene editing method.

Background

Pea (Pisum sativum l.) is one of four world-wide edible legume crops, and more than 90 countries have been planted. The dietary protein source in temperate and subtropical regions is mainly peas. Despite the large planting area of peas, the overall yield is still low and has remained elusive for the last decades. Some biotic and abiotic stresses severely affect pea yield; furthermore, peas are self-pollinated, have a narrow genetic base, and have limited genetic variation in some traits, thus requiring biotechnology to achieve improvement of pea traits.

Genome editing techniques refer to the creation of DNA Double Strand Breaks (DSBs) at specific locations in the genome by endonucleases, inducing organisms to repair broken double strand DNA by non-homologous end joining (NHEJ) or Homologous Recombination (HR), as this repair process is prone to error, leading to targeted mutations. Therefore, the gene editing technology can regulate and control the expression of genes through the site-directed modification of genome, and is an important tool for researching gene functions.

The CRISPR/Cas system is an acquired immune system present in bacteria and archaea and is responsible for combating exogenous genetic material invasion caused by phage infection, plasmid conjugation and transformation, etc. CRISPR/Cas systems can specifically recognize foreign DNA, cleave and silence expression of foreign genes. Genetic modification of crops using CRISPR/Cas9 gene editing techniques has many advantages and has been successfully applied to genetic modification of a variety of crops such as rice, wheat, corn, cotton, etc. However, no CRISPR/Cas9 gene editing technique has been reported in peas to date.

Disclosure of Invention

In view of the above, the invention aims to provide a pea CRISPR/Cas9 gene editing vector, a gene editing system and a gene editing method, wherein the gene editing vector and the gene editing system are suitable for peas, have high editing efficiency and lay a good foundation for the gene function research and genetic breeding of peas.

In order to achieve the above object, the present invention provides the following technical solutions:

the invention provides a pea CRISPR/Cas9 gene editing vector, which takes pHUC411 as a skeleton vector, and also comprises a coding gene of pea preferential codon optimized Cas9 protein, an enhanced TM2-pd35s-dMac promoter and a pea endogenous U6 promoter.

Preferably, the nucleotide sequence of the coding gene of the pea-preferred codon optimized Cas9 protein is shown in SEQ ID No. 1.

Preferably, the nucleotide sequence of the enhanced TM2-pd35s-dMac promoter is shown as SEQ ID NO. 2.

Preferably, the nucleotide sequence of the pea endogenous U6 promoter is shown as SEQ ID NO. 3.

The invention also provides a construction method of the CRISPR/Cas9 gene editing vector, which comprises the following steps: the original zmebi promoter on pHUC411, osCas9 and OsU3 promoters were replaced with the enhanced TM2-pd35s-dMac promoter, the pea-preferred codon optimized Cas9 protein coding gene, and the pea endogenous U6 promoter, respectively.

The invention also provides a pea CRISPR/Cas9 gene editing system, and a primer pair of a pea gene target is connected to the CRISPR/Cas9 gene editing carrier.

Preferably, the pea gene target comprises an exon region of a pea phytoene dehydrogenase gene, and the identified PAM sequence is NGG.

Preferably, the pea gene targets comprise PsPDS1, psPDS2 or PsPDS3.

The invention also provides an application of the CRISPR/Cas9 gene editing vector or the CRISPR/Cas9 gene editing system in improving the editing efficiency of pea genes.

The invention also provides a pea gene editing method, which comprises the following steps: and (3) annealing a primer pair designed based on a pea gene target, connecting the primer pair with the CRISPR/Cas9 gene editing vector, converting the primer pair into agrobacterium rhizogenes competent cells, and carrying out genetic transformation to obtain pea gene editing plants.

The beneficial effects are that: the invention provides a pea CRISPR/Cas9 gene editing vector, which is used for modifying the existing rice gene editing vector pHUC411, respectively replacing the original corn Ubiquintin promoter (ZmUBI) on the pHUC411, rice preference codon optimized Cas9 protein (OsCas 9) and rice endogenous U3 promoter (OsU 3) by using an enhanced TM2-pd35s-dMac (abbreviated as en35 s) promoter, a coding gene of pea preference codon optimized Cas9 protein (abbreviated as PsCas 9) and a pea endogenous U6 promoter (abbreviated as PsU 6.3), so that PsU6.3 drives the expression of sgRNA and en35s drives the expression of PsCas 9.

The CRISPR/Cas9 gene editing vector is utilized to construct a CRISPR/Cas9 gene editing system, and the gene editing efficiency of peas is 8.32% higher than that of the traditional rice and arabidopsis gene editing tools, and up to 7 mutation types are generated, so that the gene editing efficiency of peas is improved, and a good foundation is laid for the gene function research and genetic breeding of peas.

Drawings

FIG. 1 shows the plasmid structure of pHUC 411;

fig. 2 is a target design drawing of the pea CRISPR/Cas9 gene editing system of the present invention.

Detailed Description

The plasmid structure of the skeleton vector is preferably shown in a figure 1 (pHUC 411-gttt; from a institute of biotechnology of the national institute of agricultural sciences, anhui institute of technology, wei Pengcheng institute of research, subject group), and comprises a maize Ubiquitin promoter (ZmUBI), a Cas9 protein (OsCas 9) optimized by rice preference codons and a rice endogenous U3 promoter (OsU 3), and the above structures are replaced by an enhanced TM2-pd35s-dMac (abbreviated as en35 s) promoter, a coding gene of a Cas9 protein optimized by pea preference codons (abbreviated as PsCas 9) and a pea endogenous U6 promoter (abbreviated as PsU 6.3) respectively, so that the pea CRISPR/Cas9 gene editing vector is obtained.

The 5 'end of the PsCas9 preferably comprises an enzyme cutting site Pst I and a Kozak sequence, the 3' end comprises an enzyme cutting site Sac I, and the nucleotide sequence of the PsCas9 is shown as SEQ ID NO. 1.

The 5 'and 3' ends of the en35s promoter according to the invention preferably comprise the cleavage sites HindIII and PstI, respectively, the nucleotide sequences of which are preferably as shown in SEQ ID NO. 2.

The 5 'end and the 3' end of the PsU6.3 promoter respectively comprise enzyme cutting sites HindIII and PstI, and the nucleotide sequence of the PsU6.3 promoter is preferably shown as SEQ ID NO. 3.

The method of the present invention is not particularly limited, and the conventional method of replacing a carrier structure in the art may be used.

The pea gene target of the present invention comprises an exon region of the pea phytoene dehydrogenase (PsPDS) gene, recognizing the PAM sequence NGG (fig. 2). In the invention, 3 targets are preferably selected on exon 1 and exon 2 of the PsPDS, which are respectively named as PsPDS1, psPDS2 and PsPDS3, and target index primer pairs are synthesized aiming at the targets: psPDS1 FP, psPDS1 RP, psPDS2 FP, psPDS2RP, or PsPDS3 FP, psPDS3 RP; the nucleotide sequence of the PsPDS1 FP is preferably shown as SEQ ID NO.4, and the nucleotide sequence of the PsPDS1 RP is preferably shown as SEQ ID NO. 5; the nucleotide sequence of the PsPDS2 FP is preferably shown as SEQ ID NO. 6; the nucleotide sequence of the PsPDS2RP is preferably shown in SEQ ID NO. 7; the nucleotide sequence of the PsPDS3 FP is preferably shown as SEQ ID NO. 8; the nucleotide sequence of the PsPDS3RP is preferably shown in SEQ ID NO. 9.

The gene editing efficiency of the CRISPR/Cas9 gene editing vector or the CRISPR/Cas9 gene editing system in peas can reach 8.32%, at most 7 gene mutation types are generated, and the gene editing efficiency is remarkably improved.

The primer pair of the pea gene target is annealed and then connected with the CRISPR/Cas9 gene editing carrier to construct a gene editing system, and the gene editing system is transformed into agrobacterium rhizogenes competent cells to carry out genetic transformation. The method of construction, transformation and genetic transformation is not particularly limited, and may be performed by a method conventional in the art.

The pea CRISPR/Cas9 gene editing vector, the gene editing system and the gene editing method provided by the present invention are described in detail below with reference to examples, but they should not be construed as limiting the scope of the present invention.

Example 1

1. Cloning of TM2-dp35s-dMac (en 35 s) gives T-en35s

1. The 5 'and 3' ends of the TM2-dp35s-dMac sequence were added with the cleavage sites HindIII and PstI to form HindIII-TM 2-dp35 s-dMac-PstI (SEQ ID NO. 2), which was synthesized on the vector PUC57-Simple (Amp) by the delivery Biometrics (Anhui) Inc.

2. HindIII-en 35s-Pst I was PCR amplified using the following primers:

35s-dMac Hind III FP(SEQ ID NO.10)：AAGCTTTCGATTAAAAATCCCAATTATT；

35s-dMac Pst I RP(SEQ IDNO.11)：CTGCAGATTGCGAGACAGTGCCGTGGGT。

system (50 μl): PCR system:

FastPfu Fly PCR SuperMix 25μL、ddH ₂ o20 μL, 35s-dMac HindIII FP 2 μL, 35s-dMac PstI RP 2 μL and TM2-pd35s-dMac inPUC57-Simple (Amp) 1 μL.

PCR procedure: pre-denaturation at 94℃for 5min; denaturation at 94℃for 30s, annealing at 60℃for 30s, extension at 72℃for 2min,35 cycles; and then the extension is carried out for 5min at 72 ℃.

The PCR amplification product HindIII-en 35s-Pst I was recovered and ligated to cloning vector pEASY-Blunt Simple Cloning Vector, transformed into X-Blue E.coli competent cells, ice-bath for 30min, heat-shocked at 42℃for 90s, ice-bath for 2min, added 1mL of LB liquid medium preheated at 37℃at 120rpm/min, and shake-cultured for 1h. Centrifugation at 12000rpm for 30s, collection, decanting of supernatant, leaving 100. Mu.L of the supernatant to be smeared on LB solid medium with kanamycin resistance, and inversion culture at 37℃overnight.

A single clone was picked and streaked onto LB solid medium with ampicillin resistance, and colony PCR identification was performed using SEQ ID No.10 and SEQ ID No. 11.

5. The colony PCR correct single colony was picked, propagated in LB liquid medium, plasmids were extracted and subjected to double restriction identification (HindIII/PstI).

6. And (3) delivering the plasmid with the correct double enzyme digestion to a general biological system (Anhui) limited company for sequencing and identification, wherein the plasmid with the correct sequencing is T-en35s connected with a T vector.

The primers used for sequencing are:

M13-F(SEQ ID NO.12)：GTTGTAAAACGACGGCCAG；

M13-R(SEQ ID NO.13)：CAGGAAACAGCTATGAC；

intermediate primer dMac-ZF (SEQ ID NO. 14): GGCGAACCTTCGATATTTCA.

2. The TM2-pd35s-dMac (en 35 s) promoter replaces the ZmUBI promoter

1. Double cleavage (HindIII/PstI) of T-en35s and PUC57-Simple (Amp) -SpR-T35sT, and recovery of the cleavage products.

2. The recovered product was ligated and transformed into X-Blue E.coli competent cells, which were subjected to ice bath for 30min, heat shock at 42℃for 90s, ice bath for 2min, 1mL of LB liquid medium preheated at 37℃was added, and shake cultured at 120rpm for 1h. Centrifugation at 12000rpm for 30s, collection, decanting of supernatant, leaving 100. Mu.L of the supernatant to be smeared on LB solid medium with resistance to ampicillin and spectinomycin, and inversion culture at 37℃overnight.

3. Selecting monoclonal, streaking on LB solid medium with resistance to ampicillin and spectinomycin, and performing colony PCR identification;

primers for colony PCR identification:

dMac check&Seq FP(SEQ ID NO.15)：TCCTCATTTTCTGAATCCTGGG；

SpR EcoR I RP(SEQ ID NO.16)：GAGCTCggcttattatgcac。

and (2) PCR: PCR procedure: pre-denaturation at 94℃for 5min; denaturation at 94℃for 30s, annealing at 60℃for 30s, extension at 72℃for 2min,35 cycles; further extending at 72deg.C for 5min

4. The colony PCR correct single colony was picked, propagated in LB liquid medium, plasmids were extracted and subjected to double restriction identification (HindIII/PstI).

5. The double digested plasmids were sent to the general biosystems (Anhui) Inc. for sequencing and identification (primers used for sequencing were M13-F and M13-R). The plasmid with correct sequencing is PUC57-Simple (Amp) -en35s-SpR-t35sT.

3. PsCas9 replaces OsCas9

1. Optimizing Cas9 protein by pea preference codons, naming the optimized Cas9 protein as PsCas9, simultaneously adding a cleavage site PstI and a Kozak sequence at the 5 'end of the PsCas9, adding a cleavage site SacI (PstI-Kozak-PsCas 9-Sac I, SEQ ID NO. 1) at the 3' end, and then delivering the obtained product to a company to synthesize the product on a carrier PUC57-Simple (Amp) to obtain PsCas9 in PUC57-Simple.

2. Double cleavage (PstI/SacI) plasmids PUC57-Simple (Amp) -en35s-SpR-t35sT and PsCas9 in PUC57-Simple, and the cleavage products were recovered.

3. The recovered product was ligated and transformed into X-Blue E.coli competent cells, which were subjected to ice bath for 30min, heat shock at 42℃for 90s, ice bath for 2min, 1mL of LB liquid medium preheated at 37℃was added, and shake cultured at 120rpm for 1h. Centrifugation at 12000rpm for 30s, collection, decanting of supernatant, leaving 100. Mu.L of the supernatant to be smeared on LB solid medium with ampicillin resistance, and inversion culture at 37℃overnight.

4. The monoclonal was picked, streaked onto LB solid medium with ampicillin/spectinomycin resistance, respectively, and cultured upside down at 37℃overnight.

5. The colonies growing on the spectinomycin-resistant LB solid medium without growing on the spectinomycin-resistant LB solid medium were picked up and identified by colony PCR.

The primers used were:

PsCas9 check 300bp to 3E FP(SEQ ID NO.17)：CAACAAGCATAGAGATAAGCCA；

PsCas9 check 300bp to 5E RP(SEQ ID NO.18)：AAAGAATCATCAACCTTAGCCA。

6. the colony PCR correct single colony is selected, amplified in LB liquid medium, plasmid is extracted, and double enzyme digestion identification (Pst I/Sac I) is carried out.

7. The double digested plasmids were sequenced and identified by the company (the primers used for sequencing were SEQ ID NO. 15). The plasmid with correct sequencing is PUC57-Simple (Amp) -en35s-PsCas9-t35sT.

4. en35s-PsCas9-t35sT ligation to vector PHNC-SPR vector

1. Double cleavage (HindIII and EcoRI) plasmids PUC57-Simple (Amp) -en35s-PsCas9-t35sT and PHNC SPR, and the cleavage products were recovered.

2. The recovered product was ligated and transformed into X-Blue E.coli competent cells, which were subjected to ice bath for 30min, heat shock at 42℃for 90s, ice bath for 2min, 1mL of LB liquid medium preheated at 37℃was added, and shake cultured at 120rpm for 1h. Centrifugation at 12000rpm for 30s, collection, decanting of supernatant, leaving 100. Mu.L of the supernatant to be smeared on LB solid medium with kanamycin resistance, and inversion culture at 37℃overnight.

3. The monoclonal was picked, streaked onto LB solid medium with kanamycin/spectinomycin resistance, respectively, and cultured upside down at 37℃overnight.

4. A colony PCR was identified by picking up a monoclonal which did not grow on the spectinomycin-resistant LB solid medium and growing on the kanamycin-resistant LB solid medium.

The primers used were:

PHUE Check FP(SEQ ID NO.19)：GGTGCGGGCCTCTTCGCTATTA；

35s-dMac Pst I RP(SEQ ID NO.11)。

5. the colony PCR correct single colony was picked, propagated in LB liquid medium, plasmids were extracted and subjected to double restriction identification (HindIII/EcoRI).

6. The double digested plasmids were sequenced and identified by the company (the primers used for sequencing were SEQ ID NO. 15). The plasmid with correct sequence is PHUC-en35s-PsCas9-t35sT.

5. PsU6.3 promoter replaces OsU3 promoter

1. Blast alignment is performed in pea genome through the sequence of U6 snRNA, 5 pea endogenous U6 promoters are obtained, sequence alignment is performed with an Arabidopsis U6.26 promoter, and conserved upstream sequence elements and TATABOX exist in a promoter region upstream of a transcription initiation site. The endogenous U6 promoter of pea No.3 (PsU 6.3) was selected, and cleavage sites HindIII and PstI (HindIII-PsU 6.3-PstI, SEQ ID NO. 3) were added to the 5 'and 3' ends of the PsU6.3 promoter sequence, which was synthesized by the delivery company on the vector PUC57-Simple (Amp) to give plasmid PsU6.3 in PUC57-Simple (Amp).

2. Respectively carrying out PCR amplification by taking plasmid PsU6.3 in PUC57-Simple (Amp) and pHUC 411-sg2.0 as templates, and recovering PCR products to obtain fragment 1 and fragment 2; meanwhile, the intermediate vector T-SpR is subjected to single digestion (EcoRI), and the digestion product is recovered to obtain a fragment 3.

The primers used were:

PsU6p3 FP(SEQ ID NO.20)：TTACGCCAAGCTGCCCTTGaagcttTGTTGCTATTTTTTGTTTATCCGA；

PsU6p3 RP(SEQ ID NO.21)：ggcttatgtccactgggttggtctctGAAGTAAGGGTGA；

SpR-sg2.0 FP(SEQ ID NO.22)：ACCCTTACTTCagagaccaacccagtggacataagcctg；

SpR-sg2.0 RP(SEQ ID NO.23)：GCGAATTGAAGCTGCCCTTGaagcttAAAAAAAAgcaccgactcggt。

PCR procedure: pre-denaturation at 94℃for 5min; denaturation at 94℃for 30s, annealing at 60℃for 30s, elongation at 72℃for 30s,35 cycles; and then the extension is carried out for 5min at 72 ℃.

The recovered products of the step 2, namely the

fragments

1, 2 and 3, are connected together by utilizing a homologous recombination method, transformed into competent cells of the X-Blue escherichia coli, subjected to ice bath for 30min, heat shock for 90s at 42 ℃ and ice bath for 2min, added into 1mL of LB liquid medium preheated at 37 ℃ and subjected to shaking culture for 1h at 120 rpm. Centrifugation at 12000rpm for 30s, collection, decanting of supernatant, leaving 100. Mu.L of the supernatant to be smeared on LB solid medium with kanamycin and spectinomycin resistance, and inversion culture at 37℃overnight.

4. The monoclonal was picked, streaked onto LB solid medium with kanamycin and spectinomycin/ampicillin resistance, respectively, and cultured upside down at 37℃overnight.

5. The colonies which did not grow on ampicillin-resistant LB solid medium and which grew on kanamycin-and spectinomycin-resistant LB solid medium were picked up for colony PCR identification (primers used: SEQ ID NO.20 and SEQ ID NO. 23).

6. The colony PCR correct single colony was picked, propagated in LB liquid medium, plasmids were extracted and single restriction identified (HindIII).

7. The double digested plasmids were sent to the general biosystems (Anhui) Inc. for sequencing and identification (primers used for sequencing were M13-F and M13-R). The plasmid with correct sequence is T-PsU6p3-SpR-sg2.0.

8. Single cleavage (Hind III) plasmids PHUC-en35s-PsCas9-T35sT and T-PsU p3-SpR-sg2.0, and the cleavage products were recovered.

9. The recovered product was ligated and transformed into X-Blue E.coli competent cells, which were subjected to ice bath for 30min, heat shock at 42℃for 90s, ice bath for 2min, 1mL of LB liquid medium preheated at 37℃was added, and shake cultured at 120rpm for 1h. Centrifugation at 12000rpm for 30s, collection, decanting of supernatant, leaving 100. Mu.L of the supernatant to be smeared on LB solid medium with kanamycin and spectinomycin resistance, and inversion culture at 37℃overnight.

10. The monoclonal was picked, streaked onto LB solid medium with kanamycin and spectinomycin resistance, and colony PCR identified.

The primers used were: PHUE checkFP and SpR EcoRI RP.

11. The colony PCR correct single colony was picked, propagated in LB liquid medium, plasmids were extracted and single restriction identified (HindII).

12. The single digested correct plasmid was sent to the general biosystems (Anhui) Inc. for sequencing and identification (primers used for sequencing were PHUE Check FP). The plasmid with correct sequence is PHUC-PsU p3-SpR-sg2.0-en35s PsCas9-t35sT.

6. Target ligation

1. Target design: 3 targets were selected on exon 1 and exon 2 of the pea phytoene dehydrogenase gene (PDS) (fig. 2), and the PAM sequence identified was NGG.

2. Synthesizing target index primer:

PsPDS1 FP, psPDS1 RP, psPDS2 FP, psPDS2RP, psPDS3 FP, and PsPDS3RP.

3. Primer phosphorylation

Formulation system (50 μl): FP/RP 1. Mu.L each, 10 XT 4 DNA Ligase Buffer. Mu. L, T4 PNK 1. Mu.L and ddH ₂ O42. Mu.L. Incubation was carried out at 37℃for 1h, and 2.5. Mu.L of 1M NaCl was added.

4. And (3) natural annealing: and (5) at 95 ℃ for 5 seconds, turning off the incubator, and naturally cooling to room temperature for later use.

5. Single cleavage (Bsa I) plasmid PHUC-PsU p3-SpR-sg2.0-en35s PsCas9-t35sT overnight, 65℃and 20min of inactivation.

6. Connecting the inactivated plasmid and the annealing target, transforming the inactivated plasmid and the annealing target into competent cells of the X-Blue escherichia coli, carrying out ice bath for 30min, carrying out heat shock for 90s at 42 ℃, carrying out ice bath for 2min, adding 1mL of LB liquid medium preheated at 37 ℃,120rpm/min, and carrying out shake culture for 1h. Centrifugation at 12000rpm for 30s, collection, decanting of supernatant, leaving 100. Mu.L of the supernatant smeared onto LB solid medium with kanamycin, and incubation at 37℃overnight with inversion.

7. The monoclonal was picked, streaked onto LB solid medium with kanamycin/spectinomycin resistance, respectively, and cultured upside down at 37℃overnight.

8. The method comprises the steps of selecting a monoclonal which does not grow on a spectinomycin-resistant LB solid medium, growing on a kanamycin-resistant LB solid medium, propagating in an LB liquid medium, extracting plasmids, and carrying out sequencing identification (the primer used for sequencing is PHUE CheckFP).

The plasmids with correct sequence are PHUC-PsU p3-PsPDS1-sg2.0-en35s PsCas9-t35sT, PHUC-PsU p3-PsPDS2-sg2.0-en35s PsCas9-t35sT and PHUC-PsU p3-PsPDS3-sg2.0-en35s PsCas9-t35sT.

Example 2

The PHUC-PsU p3-PsPDS1-sg2.0-en35s PsCas9-t35sT, PHUC-PsU p3-PsPDS2-sg2.0-en35s PsCas9-t35sT and PHUC-PsU p3-PsPDS3-sg2.0-en35s PsCas9-t35sT obtained in example 1 were transformed into Agrobacterium rhizogenes competent cells K599, genetic transformation was performed, hairy roots were grown after about 4w, DNA of hairy roots was extracted, target regions were amplified by PCR, and the amplified results were submitted to Hi-TOM sequencing by China paddy institute.

The statistical sequencing results are shown in tables 1-3, the average editing efficiency of PsPDS1 is 8.32% (the number of sequencing samples is 125, the number of mutations is 10), 7 mutation types are total, 6 mutation types are deletion, and 1 mutation type is insertion (table 1); the average editing efficiency of PsPDS2 was 0.68% (number of sequencing samples 32, number of mutation samples 2), with only 1 mutation type being inserted (table 2); the average editing efficiency of PsPDS3 was 3.90% (number of sequencing samples 55, number of mutation samples 12), and 3 mutation types were all deleted (Table 3)

TABLE 1 specific mutation cases of PsPDS1

WT	CTGGGAGTGTATCCATGGGTTTTAACTCGAGGTTGAATCTTGCTTC
			1	CTGGGAGTGTATCCATGG-TTTTAACTCGAGGTTGAATCTTGCTTC
2	CTGGGAGTGTATCCATGG---TTAACTCGAGGTTGAATCTTGCTTC
		3	CTGGGAGTGTATCCATGGGGTTTTAACTCGAGGTTGAATCTTGCTTC
4	CTGGGAGTGTATCCATGG------ACTCGAGGTTGAATCTTGCTTC
		5	CTGGGAGTGTATCCATGG-----AACTCGAGGTTGAATCTTGCTTC
6	CTGGGAGTGTATCCATA------AACTCGAGGTTGAATCTTGCTTC
		7	CTGGGAGTGTATCCA--------AACTCGAGGTTGAATCTTGCTTC

TABLE 2 specific mutation cases of PsPDS2

WT	GTAGTTTGCATTGATTATCCACGCCCGAGCTGGAAAGTACCG
			1	GTAGTTTGCATTGATTATCCACGCCCTGAGCTGGAAAGTACCG

TABLE 3 specific mutation cases of PsPDS2

WT	AAGCCTATATTGCTGGAGGCAAGAGACGTTCTAGGTGGAAAGGTTTT
			1	AAGCCTATATTGCTGGAGGCAAGAGACGT-CTAGGTGGAAAGGTTTT
2	AAGCCTATATTGCTGGAGGCAAGAGAC--TCTAGGTGGAAAGGTTTT
		3	AAGCCTATATTGCTGGAGGCAAGAG----TCTAGGTGGAAAGGTTTT

Comparative example 1

The PsPDS1, psPDS2, psPDS3 targets of example 1 were respectively ligated into the applicable CRISPR/Cas9 gene editing backbone vector PHUC 411-OsU3-SpR-sg2.0-ZmUBI-OsCas9-t35sT to obtain PHUC 411-OsU-PsPDS 1-sg2.0-ZmUBI-OsCas9-t35sT, PHUC 411-OsU3-PsPDS2-sg2.0-ZmUBI-OsCas9-t35sT and PHUC 411-OsU3-PsPDS3-sg2.0-ZmUBI-OsCas9-t35sT gene editing vector, respectively transformed into Agrobacterium rhizogenes competent cell K599, genetic transformation was performed, hairy roots were grown after about 4w, DNA of hairy roots was extracted, PCR amplified target regions, and the amplified results were submitted to Hi-TOM sequencing by China institute.

The statistical sequencing results are shown in Table 4, the PHUC-PsU p3-PsPDS1-sg2.0-en35s PsCas9-t35sT, PHUC-PsU p3-PsPDS2-sg2.0-en35s PsCas9-t35sT, PHUC-PsU p3-PsPDS3-sg2.0-en35s PsCas9-t35sT vectors, have few mutation types and low average editing efficiency.

Table 4 3 mutations at PsPDS targets

Target spot	Number of sequencing samples	Number of mutant samples	Total mutation type (deletion/insertion)	Average editing efficiency/%
					PsPDS1	54	9	5(4/1)	1.40
PsPDS2	110	1	1(1/0)	1.10
					PsPDS3	94	0	0(0/0)	0

Comparative example 2

OsU3, zmUBI and OsCas9 elements in the CRISPR/Cas9 gene editing framework vector PHUC 411-OsU3-SpR-sg2.0-ZmUBI-OsCas9-t35sT are replaced by AtU626, en35S and PsCas9 respectively, psPDS1, psPDS2 and PsPDS3 targets are connected into the modified vector, PHUC-AtU626-PsPDS1-sg2.0-en35S-OsCas9-t35sT, PHUC-AtU626-PsPDS2-sg2.0-en35S-OsCas9-t35sT and PHUC-AtU626-PsPDS3-sg2.0-en35S-OsCas9-t35sT are respectively transformed into Agrobacterium rhizogenes competent cell K599, hairy roots are grown after about 4w genetic transformation, DNA of hairy roots is extracted, and PCR amplified to give the Hi-DNA amplified results.

Statistical sequencing results are shown in Table 5, the PHUC-PsU p3-PsPDS1-sg2.0-en35s PsCas9-t35sT, PHUC-PsU p3-PsPDS2-sg2.0-en35s PsCas9-t35sT and PHUC-PsU p3-PsPDS3-sg2.0-en35s PsCas9-t35sT vectors, fewer mutation types and lower average editing efficiency.

Table 5 3 mutations at PsPDS targets

Target spot	Number of sequencing samples	Number of mutant samples	Total mutation type (deletion/insertion)	Average editing efficiency/%
					PsPDS1	65	1	1(1/0)	0.21
PsPDS2	17	0	0(0/0)	0
					PsPDS3	67	1	1(1/0)	0.62

The foregoing is merely a preferred embodiment of the present invention and it should be noted that modifications and adaptations to those skilled in the art may be made without departing from the principles of the present invention, which are intended to be comprehended within the scope of the present invention.

Sequence listing

<110> institute of crop science at national academy of agricultural sciences

<120> pea CRISPR/Cas9 gene editing vector, gene editing system and gene editing method

<160> 23

<170> SIPOSequenceListing 1.0

<210> 1

<211> 4248

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 1

ctgcaggcca ccatggcccc aaagaagaag cgcaaggtcg ataagaagta ctctattgga 60

cttgatattg gtacaaattc agttggatgg gcagttatta ctgatgaata caaggttcct 120

tctaagaaat tcaaggtttt gggtaacaca gatagacatt caattaagaa aaatcttatt 180

ggagctttgt tgttcgattc tggtgaaact gctgaagcaa caagacttaa gagaactgca 240

agaagaagat acacaagaag aaagaacaga atttgttatt tgcaagaaat ttttagtaat 300

gaaatggcta aggttgatga ttctttcttt catagattgg aagaatcatt tcttgttgaa 360

gaagataaga agcatgaaag acatccaatt ttcggaaaca ttgttgatga agttgcttac 420

catgaaaagt accctacaat ttaccatttg agaaagaaac ttgttgattc tactgataag 480

gcagatctta gattgattta ccttgctttg gcacatatga ttaagttcag aggacatttt 540

cttattgaag gtgatcttaa cccagataac tcagatgttg ataaattgtt cattcaactt 600

gttcaaacat ataatcaact ttttgaagaa aatcctatta atgcttctgg agttgatgct 660

aaggcaattt tgtcagcaag actttctaag tcaagaagac ttgaaaactt gattgctcaa 720

ttgccaggtg aaaagaaaaa tggattgttc ggtaacctta ttgcactttc tttgggtctt 780

acacctaact tcaagtcaaa cttcgatctt gctgaagatg caaagttgca actttctaag 840

gatacttacg atgatgattt ggataatctt ttggctcaaa ttggtgatca atatgcagat 900

ttgtttcttg ctgcaaagaa cttgtctgat gctattcttt tgtcagatat tcttagagtt 960

aacactgaaa ttacaaaggc tccactttct gcatcaatga ttaagagata cgatgaacat 1020

catcaagatt tgactctttt gaaggcattg gttagacaac aacttcctga aaagtacaag 1080

gaaattttct ttgatcaatc aaagaacgga tacgctggtt acattgatgg aggtgcatct 1140

caagaagaat tttacaagtt cattaagcca attttggaaa aaatggatgg aacagaagaa 1200

cttttggtta aacttaacag agaagatctt ttgagaaagc aaagaacttt cgataacgga 1260

tctattccac atcaaattca tcttggtgaa ttgcatgcta ttttgagaag acaagaagat 1320

ttctaccctt ttcttaagga taacagagaa aaaattgaaa agattttgac atttaggatt 1380

ccttattatg ttggaccact tgctagaggt aattctagat ttgcatggat gactagaaag 1440

tcagaagaaa ctattacacc atggaatttt gaagaagttg ttgataaggg tgcttctgca 1500

caatcattta ttgaaagaat gacaaacttc gataaaaatt tgcctaatga aaaggttctt 1560

ccaaaacatt ctcttttgta cgaatacttc actgtttaca atgaacttac aaaggttaag 1620

tacgttactg aaggaatgag aaaacctgct tttctttcag gtgaacaaaa gaaagcaatt 1680

gttgatcttt tgttcaagac taacagaaag gttacagtta aacaacttaa ggaagattac 1740

ttcaagaaaa ttgaatgttt cgattctgtt gaaatttcag gagttgaaga tagattcaat 1800

gcttctttgg gtacttatca tgatcttttg aagattatta aggataagga ttttcttgat 1860

aacgaagaaa atgaagatat tcttgaagat attgttttga ctcttacatt gttcgaagat 1920

agagaaatga ttgaagaaag attgaagaca tacgctcatc ttttcgatga taaggttatg 1980

aagcaactta aaagaagaag atatactgga tggggtagat tgtctagaaa acttattaac 2040

ggaattagag ataagcaatc aggaaagaca attcttgatt ttcttaagtc agatggattc 2100

gctaacagaa acttcatgca attgattcat gatgattctc ttactttcaa ggaagatatt 2160

caaaaggctc aagtttctgg acagggtgat tctttgcatg aacatattgc taatcttgca 2220

ggatcaccag caattaagaa aggtattttg caaactgtta aggttgttga tgaacttgtt 2280

aaggttatgg gaagacataa gcctgaaaac attgttattg aaatggctag agaaaaccaa 2340

actacacaaa agggtcagaa aaattctaga gaaagaatga agaggattga agaaggaatt 2400

aaggaattgg gttcacaaat tcttaaggaa catcctgttg aaaacacaca attgcaaaac 2460

gaaaaacttt acttgtacta tcttcaaaat ggaagagata tgtacgttga tcaagaattg 2520

gatattaata gactttctga ttacgatgtt gatcatattg ttccacaatc ttttcttaag 2580

gatgattcaa ttgataacaa agttcttact agatcagata agaacagagg aaagtctgat 2640

aacgttcctt ctgaagaagt tgttaagaaa atgaagaact actggagaca acttttgaac 2700

gctaagttga ttacacaaag aaagttcgat aatcttacta aggctgaaag aggtggactt 2760

tctgaattgg ataaggcagg attcattaag agacaattgg ttgaaactag acaaattact 2820

aagcatgttg cacaaattct tgattcaaga atgaacacaa aatatgatga aaatgataag 2880

ttgattagag aagttaaagt tattactttg aaatctaaac ttgtttctga ttttagaaag 2940

gattttcaat tctacaaagt tagagaaatt aacaactatc atcatgctca tgatgcatat 3000

ttgaatgctg ttgttggaac agcattgatt aagaaatacc caaaacttga atctgaattt 3060

gtttacggtg attacaaggt ttatgatgtt agaaagatga ttgctaagtc tgaacaagaa 3120

attggaaagg ctactgcaaa gtatttcttt tattcaaaca ttatgaattt ctttaagact 3180

gaaattacat tggctaacgg agaaattaga aaaagacctc ttattgaaac taatggagaa 3240

acaggtgaaa ttgtttggga taagggtaga gatttcgcaa cagttagaaa ggttctttct 3300

atgccacaag ttaacattgt taagaaaact gaagttcaaa ctggaggatt ctctaaggaa 3360

tcaattttgc ctaagagaaa ttcagataaa cttattgcta gaaagaaaga ttgggaccct 3420

aaaaaatatg gaggttttga ttctccaaca gttgcttatt cagttttggt tgttgcaaag 3480

gttgaaaagg gaaagtctaa gaaacttaag tcagttaagg aacttttggg tattactatt 3540

atggaaagat cttcatttga aaagaatcca attgattttc ttgaagctaa gggatacaaa 3600

gaagttaaga aagatttgat tattaaactt cctaaatatt cactttttga attggaaaat 3660

ggtagaaaaa gaatgttggc ttctgctgga gaacttcaaa agggtaatga acttgctttg 3720

ccatcaaagt acgttaattt tctttatttg gcatctcatt atgaaaaact taagggttca 3780

cctgaagata acgaacaaaa gcaattgttc gttgaacaac ataaacatta ccttgatgaa 3840

attattgaac aaatttctga attttcaaag agagttattt tggctgatgc aaacttggat 3900

aaggttcttt ctgcttacaa caagcataga gataagccaa ttagagaaca agcagaaaac 3960

attattcatc ttttcacttt gacaaatctt ggtgctcctg ctgctttcaa gtacttcgat 4020

actacaattg atagaaagag atacacttca actaaagaag ttttggatgc aactcttatt 4080

catcaatcta ttactggttt gtacgaaaca agaattgatt tgtcacaact tggaggtgat 4140

tctggaggtt cacctaagaa aaagagaaag gtttctggag gttcaccaaa aaagaaaaga 4200

aaagtttctg gaggttcacc taagaaaaag agaaaagttt gagagctc 4248

<210> 2

<211> 1952

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 2

aagctttcga ttaaaaatcc caattattgc gagtgaaagc tgctcaatat tgcttaatag 60

aagaaaattt gtatcgaaat gttcatggga cccttagcac ggtgccttgg tctatcacaa 120

actgaatatg tgatgcaaga agtacataaa gaacattgtt gcaatcacgt tggaggaagg 180

tcattttaaa gacgctaaaa ggggcggtat tatttgcaaa aaatagaaga caaagcgaaa 240

atttttatta gaaggtgtga taaatgtcaa cggggtgcaa acaatatgca tcaaccagca 300

gtgtttcttc attcaatcat agcaccgtgg ccgtttatga agtgggttat gtattgtagg 360

tcctctacct aaagcaccag gaaaggaacg acttttatta atcttaactg attatttttc 420

tatgtgggta gaagcatgtg cctttaaata gatcgagaga aagaggttgt tgatattatt 480

tggaggaaca taatatgtcg attttgtgtc ccaagaaaaa tagtacgcga taatgggcca 540

caattcgtag gttcaaaagt taccgatttt ctcaaaatct gggaaattaa acaaattatt 600

tcggcgcact gccatcccat agctaatggg aaaccataat cgacaaatac aattattgtc 660

aacaatataa agaaacggtt agaatcatca aaaggcaggt tccctgaagt actacttggg 720

ctagtatggg attacaggac aacgacgaag ataagcacaa gagaaacacc attctcactt 780

atttatggta ctgaggcctt aatttcggtg gaaataggag agccaagaac aagatacgta 840

catacaaatg aagtaacaaa tgagaaagaa cttttaacaa atttagattt gacaaaggag 900

ataagggaag caactttgat acagatggcg gcacaaaagt agaggattga gcaatattac 960

aacagaaagg cgaaccttcg atatttcaag attgggaact tcttcctatg gtggagcacg 1020

acactctcgt ctactccaag aatatcaaag atacagtctc agaagaccaa agggctattg 1080

agacttttca acaaagggta atatcgggaa acctcctcgg attccattgc ccagctatct 1140

gtcacttcat caaaaggaca gtagaaaagg aaggtggcac ctacaaatgc catcattgcg 1200

ataaaggaaa ggctatcgtt caagatgcct ctgccgacag tggtcccaaa gatggacccc 1260

cacccacgag gagcatcgtg gaaaaagaag acgttccaac cacgtcttca aagcaagtgg 1320

attgatgtga taacatggtg gagcacgaca ctctcgtcta ctccaagaat atcaaagata 1380

cagtctcaga agaccaaagg gctattgaga cttttcaaca aagggtaata tcgggaaacc 1440

tcctcggatt ccattgccca gctatctgtc acttcatcaa aaggacagta gaaaaggaag 1500

gtggcaccta caaatgccat cattgcgata aaggaaaggc tatcgttcaa gatgcctctg 1560

ccgacagtgg tcccaaagat ggacccccac ccacgaggag catcgtggaa aaagaagacg 1620

ttccaaccac gtcttcaaag caagtggatt gatgtgatat ctccactgac gtaagggatg 1680

acgcacaatc ccactatcct tcgcaagacc ttcctctata taaggaagtt catttcattt 1740

ggagaggaca cgctgaaatc accagtctct ctctacaaat ctatctctaa gactaaagag 1800

agctttttca taccaaagaa gtacaacaaa agatttgctc ctcattttct gaatcctggg 1860

actctctagc ctgtagaaga agaaaggcag gaatttcagc tcaagagaac agatcacaat 1920

atttacccac ggcactgtct cgcaatctgc ag 1952

<210> 3

<211> 612

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 3

aagctttgtt gctatttttt gtttatccga ctttaaggta tatgcaatta tttttatata 60

tttttcaaat gagtgatgtt ggaaaaaaaa agagtggata atcatataca aattaaaaat 120

aaaaggagaa ttttagaaat caattagcta aaaaaattag ataattcagt gagtgttaga 180

aaaatctata aatgaagagt atgaaattga ttatttaaag aaaaattgat taataagata 240

taattaattg attaatgagt aaagaataat ctggttagtg gatagtagta atgaattatt 300

gagtaattag tgaatgagta attatatata ggaataatta ataaagatga tagtaatgca 360

ttagttagta ttttttacag cacatataat actagttgaa gaattttgtt gactctggtg 420

tgtagaatta atgatgatac acatataatt aattactact aattaagtga agttgaggca 480

acataacaac tactaagcgg aaggagaagt aagtgtgtta tgtttgttta cttactttta 540

gttccacatc gactgtttag tttcattttg ttatgtttat ataatacagc tactcaccct 600

tacttcctgc ag 612

<210> 4

<211> 23

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 4

attgaacctc gagttaaaac cca 23

<210> 5

<211> 23

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 5

aaactgggtt ttaactcgag gtt 23

<210> 6

<211> 23

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 6

attggattat ccacgcccgg agc 23

<210> 7

<211> 23

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 7

aaacgctccg ggcgtggata atc 23

<210> 8

<211> 24

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 8

attgctggag gcaagagacg ttct 24

<210> 9

<211> 24

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 9

aaacagaacg tctcttgcct ccag 24

<210> 10

<211> 28

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 10

aagctttcga ttaaaaatcc caattatt 28

<210> 11

<211> 28

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 11

ctgcagattg cgagacagtg ccgtgggt 28

<210> 12

<211> 19

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 12

gttgtaaaac gacggccag 19

<210> 13

<211> 17

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 13

caggaaacag ctatgac 17

<210> 14

<211> 20

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 14

ggcgaacctt cgatatttca 20

<210> 15

<211> 22

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 15

tcctcatttt ctgaatcctg gg 22

<210> 16

<211> 20

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 16

gagctcggct tattatgcac 20

<210> 17

<211> 22

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 17

caacaagcat agagataagc ca 22

<210> 18

<211> 22

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 18

aaagaatcat caaccttagc ca 22

<210> 19

<211> 22

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 19

ggtgcgggcc tcttcgctat ta 22

<210> 20

<211> 49

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 20

ttacgccaag ctgcccttga agctttgttg ctattttttg tttatccga 49

<210> 21

<211> 39

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 21

ggcttatgtc cactgggttg gtctctgaag taagggtga 39

<210> 22

<211> 39

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 22

acccttactt cagagaccaa cccagtggac ataagcctg 39

<210> 23

<211> 47

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 23

gcgaattgaa gctgcccttg aagcttaaaa aaaagcaccg actcggt 47

Claims

1. The pea CRISPR/Cas9 gene editing vector takes pHUC411 as a skeleton vector, and also comprises a coding gene of pea preferential codon optimized Cas9 protein, an enhanced TM2-pd35s-dMac promoter and a pea endogenous U6 promoter;

the nucleotide sequence of the coding gene of the pea preferential codon optimized Cas9 protein is shown as SEQ ID NO. 1;

the nucleotide sequence of the enhanced TM2-pd35s-dMac promoter is shown as SEQ ID NO. 2;

the nucleotide sequence of the pea endogenous U6 promoter is shown as SEQ ID NO. 3;

the construction method of the CRISPR/Cas9 gene editing vector comprises the following steps: the original zmebi promoter on pHUC411, osCas9 and OsU3 promoters were replaced with the enhanced TM2-pd35s-dMac promoter, the pea-preferred codon optimized Cas9 protein coding gene, and the pea endogenous U6 promoter, respectively.

2. A pea CRISPR/Cas9 gene editing system, a primer pair of pea gene targets linked on the CRISPR/Cas9 gene editing vector of claim 1.

3. The CRISPR/Cas9 gene editing system according to claim 2, wherein said pea gene target comprises an exon region of a pea phytoene dehydrogenase gene, recognizing PAM sequence NGG; the pea gene targets comprise PsPDS1, psPDS2 or PsPDS3;

synthesizing a target index primer pair aiming at pea gene targets: psPDS1 FP, psPDS1 RP, psPDS2 FP, psPDS2RP, or PsPDS3 FP, psPDS3 RP; the nucleotide sequence of the PsPDS1 FP is shown as SEQ ID NO.4, and the nucleotide sequence of the PsPDS1 RP is shown as SEQ ID NO. 5; the nucleotide sequence of the PsPDS2 FP is shown as SEQ ID NO. 6; the nucleotide sequence of the PsPDS2RP is shown in SEQ ID NO. 7; the nucleotide sequence of the PsPDS3 FP is shown as SEQ ID NO. 8; the nucleotide sequence of the PsPDS3RP is shown as SEQ ID NO. 9.

4. Use of the CRISPR/Cas9 gene editing vector of claim 1 or the CRISPR/Cas9 gene editing system of claim 2 or 3 to increase the efficiency of editing pea genes.

5. A pea gene editing method comprising the steps of: annealing a primer pair designed based on a pea gene target, connecting the primer pair with the CRISPR/Cas9 gene editing vector of claim 1, and converting the primer pair into agrobacterium rhizogenes competent cells for genetic transformation to obtain pea gene editing plants.