CN113502346A - Marker for controlling close linkage of soybean leaf color related genes and application - Google Patents
Marker for controlling close linkage of soybean leaf color related genes and application Download PDFInfo
- Publication number
- CN113502346A CN113502346A CN202110778379.9A CN202110778379A CN113502346A CN 113502346 A CN113502346 A CN 113502346A CN 202110778379 A CN202110778379 A CN 202110778379A CN 113502346 A CN113502346 A CN 113502346A
- Authority
- CN
- China
- Prior art keywords
- marker
- soybean
- leaf color
- seq
- controlling
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Immunology (AREA)
- Mycology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Botany (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a close linkage marker for controlling soybean leaf color related genes and application thereof. Belongs to the technical field of breeding and molecular genetics. The nucleotide sequence is shown as SEQ ID NO. 1. The molecular marker H745-5 closely linked with the gene related to controlling the soybean leaf color is positioned on chromosome 11. The invention uses EMS to mutate ZP661 screened soybean yellowing mutant H745 as material, carries out phenotype identification by chlorophyll content determination and chloroplast ultrastructure observation, uses ZP661 XH 745 (F)2) Sequencing the yellow and green individual structure pools in the separation population by BSA-seq, and carrying out linkage analysis and confirmation intervals by combining the separation population; dCAPS marker H745-5 is developed aiming at the mutation site of the candidate gene, and ZP661 XH 745(F2) population is identified by the developed dCAPS marker to obtain genotype data, and the accuracy and reliability of the marker are identified.
Description
Technical Field
The invention relates to the technical field of breeding and molecular genetics, in particular to a marker for controlling close linkage of genes related to soybean leaf color and application thereof.
Background
Soybean is one of the most important economic crops in the world, and provides abundant vegetable protein and fat for human beings. The completion of soybean whole genome sequencing will promote the rapid development of soybean subject functional genomics.
However, the development of soybean functional genomics research is limited by factors such as complex genome structure, low efficiency of genetic transformation system, and the like. The mutant is an important material for important gene excavation and function research. Because the low-efficiency genetic transformation system and genotype dependence prevent the application of T-DNA insertion based on a transgenic platform and transposon mutagenesis technology in the screening of soybean mutants, artificial mutagenesis screening of mutants becomes an important way for soybean to obtain abundant genome variation and develop gene function research; the physicochemical mutagenesis has the characteristics of simple operation, capability of generating abundant genetic variation, independence of genetic transformation technology and the like, and the soybean mutant is increasingly widely used in the aspects of soybean genomics research, breeding application and the like along with the appearance and the perfection of high-throughput variation detection technologies such as TILLING and the like.
Leaves are main organs of green plants for photosynthesis, yellowing often causes the growth of the plants to be thin and short, the yield is reduced, and severe plants can die; therefore, the soybean leaf color mutant is an important material for researching chlorophyll biosynthesis, chloroplast development and photosynthesis regulation related gene functions, has important significance for researching soybean photosynthesis, improving soybean photosynthesis efficiency and promoting soybean production, and is also important in the process of identifying the truth of the hybrid seeds in production. Mutations in chlorophyll biosynthesis or other related metabolic pathways can lead to chlorophyll-deficient mutants that help us to resolve chlorophyll biosynthesis, light system and chloroplast development.
Therefore, it is a problem to be solved by those skilled in the art to provide a marker for controlling the close linkage of genes related to soybean leaf color.
Disclosure of Invention
In view of the above, the invention provides a marker for controlling close linkage of soybean leaf color related genes and application thereof.
In order to achieve the purpose, the invention adopts the following technical scheme:
a marker for controlling the close linkage of soybean leaf color related genes is H745-5 located in chromosome 11; the H745-5 nucleotide sequence is shown in SEQ ID NO. 1.
The invention also provides an application of the close linkage marker for controlling the soybean leaf color related gene in identifying the yellowing of soybean plants, if the 179 th bp of the nucleotide sequence SEQ ID NO.1 is mutated from G to A, the yellowing phenotype of leaves is shown from the seedling stage, the plant height of the full-bloom stage is shorter than that of wild plants, the leaves are small, and the stems are thin; the chlorophyll content of the upper, middle and lower leaves of the plant is obviously lower than that of the wild type plant in the chlorophyll content determination; chloroplast ultrastructure significantly reduced chloroplast basal granule stacking compared to wild-type.
The invention also provides an amplification primer pair for controlling the close linkage marker of the soybean leaf color related gene, which is characterized in that: the sequence of the PCR amplification upstream primer of H745-5 is 5'-ATCTGGCGA GGGAGATTCTG-3', and is shown as SEQ ID NO. 2; the sequence of the PCR amplification downstream primer of H745-5 is 5'-ACTCGTTGGCACCACCGTCCAT-3', and is shown as SEQ ID NO. 3.
The invention also provides the application of the linkage marker or the primer pair in soybean breeding.
The invention also provides application of the primer pair in preparation of a detection kit for controlling soybean leaf color related genes.
According to the technical scheme, compared with the prior art, the invention discloses and provides the close linkage marker for controlling the soybean leaf color related gene and the application thereof, and the obtained technical effects are as follows: the invention uses EMS to mutate ZP661 to screen soybean yellowing mutant H745 as material, and carries out phenotype identification through chlorophyll content determination and chloroplast ultrastructure observation; using ZP661 XH 745(F2) to separate yellow and green individual structure pool in group to process BSA-seq sequence test, and combining with separated group to process linkage analysis confirm interval; dCAPS marker H745-5 is developed aiming at the mutation site of the candidate gene, and ZP661 XH 745(F2) population is identified by the developed dCAPS marker to obtain genotype data, and the accuracy and reliability of the marker are identified.
Drawings
In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the embodiments or the prior art will be briefly described below, it is obvious that the drawings in the following description are only embodiments of the present invention, and for those skilled in the art, other drawings can be obtained according to the provided drawings without creative efforts.
FIG. 1 is the phenotype diagram of ZP661, H745 flowering plant provided by the invention.
FIG. 2 is the upper phenotype diagram of ZP661, H745 flowering plant provided by the invention.
Fig. 3 is a schematic diagram of chlorophyll contents of upper, middle and lower leaves of plants in the flowering stages of ZP661 and H745 provided by the present invention from left to right.
FIG. 4 is the ultramicro structure diagram of the middle leaf chloroplast of ZP661, H745 flowering plant provided by the invention.
FIG. 5 is a diagram showing an agronomic trait analysis of a leaf yellowing mutant H745 provided by the invention.
FIG. 6 is a diagram of the ED method correlation analysis provided by the present invention, wherein the abscissa: chromosome name, colored dots represent ED value for each SNP site, black line is fitted ED value, red dashed line represents significance correlation threshold, ordinate: the ED value.
FIG. 7 is a diagram of the ED method correlation analysis provided by the present invention, in which the abscissa represents the chromosome name, the colored points represent the calculated SNP-index (or Δ SNP-index) values, and the black lines represent the fitted SNP-index (or Δ SNP-index) values. The distribution diagram of SNP-index values of the recessive mixed pool, the distribution diagram of SNP-index values of the dominant mixed pool and the distribution diagram of delta SNP-index values are sequentially arranged from top to bottom, wherein red lines represent threshold lines of 99 percentile.
FIG. 8 is a diagram showing the site identification and CAPS/dCAPS development provided by the present invention.
FIG. 9 is an electrophoretogram of ZP661 XH 745(F2:3) identified by the linkage marker H745-5 provided by the present invention, wherein lane 1: marker, lane 2: maternal ZP661(a), lane 3: male parent H745 (B); and others: yellow-green leaf individual (H) in ZP661 XH 745(F2:3) population.
Detailed Description
The technical solutions in the embodiments of the present invention will be clearly and completely described below with reference to the drawings in the embodiments of the present invention, and it is obvious that the described embodiments are only a part of the embodiments of the present invention, and not all of the embodiments. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.
The embodiment of the invention discloses a marker for controlling close linkage of genes related to soybean leaf color and application thereof.
In the examples, wild-type soybean germplasm ZP661(ZP661) was provided by the institute of crop science, academy of agricultural sciences, china. The leaf yellowing mutant H745 is derived from ZP661 mutant library constructed by soybean gene resource mining and utilization of subject group of the institute of crop science of Chinese academy of agricultural sciences.
Example 1
1. The phenotype identification of wild type and mutant materials is described in Soybean germplasm description Specification and data Standard, edited by Jujuan et al. In 2016-2018, leaf yellowing mutant H745 and wild soybean variety ZP661 are respectively subjected to whole growth period, particularly field phenotype observation and identification in full-bloom stage and mature stage, chlorophyll content identification is performed with full-bloom stage, 10 ZP661 and H745 strains are respectively selected in mature stage for seed test, and main agronomic characters such as plant height, bottom pod height, node number, branch number, single plant pod number, hundred grain weight and the like are determined and photographed.
2. Determination of photosynthetic pigment content
In the full-bloom stage (R2), wild type ZP661 and leaf yellowing mutant H745 with identical growth vigor are selected, and the pigment content of the upper, middle and lower leaves of the plant is determined. The operation method comprises the following steps: weighing about 0.1g of leaves, shearing into pieces, placing the pieces into 5mL of 95% ethanol, uniformly mixing, sealing, and carrying out light-resistant treatment for 24-48 h, oscillating and uniformly mixing for multiple times during the period until the leaves are completely green and become white, and repeating for 10 times. The absorbance at 665nm, 649nm and 470nm was determined using a DU800UV/Vis UV spectrophotometer (Beckman Cloulter).
The concentration of chlorophyll a is 13.95 XD 665-6.88 XD 649
The concentration Cb of chlorophyll b is 24.96 XD 649-7.32 XD 665
Carotenoid concentration Cx (1000 XD 470-2.05 XCA-114 XCB)/245
Chloroplast pigment content (mg/g) ═ pigment concentration (C) × extract volume (mL)/fresh or dry weight (g) of sample
3. Chloroplast ultrathin section preparation and transmission electron microscope observation
Fixing: taking fresh soybean leaves, cutting with an ultrathin blade, and taking 0.5-1 mm3And placing the square blocks into 1.5mL of glutaraldehyde stationary liquid, vacuumizing by using a vacuum pump until the square blocks of the blades settle to the bottom of the centrifugal tube, and placing the square blocks in a refrigerator at 4 ℃ for fixation. And (3) dehydrating: washing 3 times with 0.1mol PBS (pH 7.2) at room temperature for 15min each time; then treating with osmic acid for 1.5h, washing with 0.1mol PBS (pH 7.2) for 3 times, 15min each time; and then dehydrating with 30%, 40%, 50%, 60%, 70%, 85%, and 95% ethanol for 15min each time. Dehydration was finally completed with absolute ethanol (100%), repeated twice, each for 15 min. And (3) infiltration: the dehydrated leaves were placed in 100% acetone for infiltration, repeated 2 times, each for 15 min. The leaves were then placed in a resin mixture (acetone: resin 1:1) and allowed to permeate for 2.5 h. The sample was then placed in a resin mixture (acetone: resin: 1: 3) and allowed to permeate for 3 h. Finally, the resin was placed in neat resin overnight at 4 ℃. Embedding: adding resin into the blade sample for embedding, moving the processed blade to an embedding block by using a toothpick, sinking the blade to the bottom, adjusting the direction of the blade so as to be cut by a knife, and fixing the blade in a 65 ℃ constant temperature box for 24 hours after the blade is finished. Tabletting: fixing the prepared resin embedding block on an LEICA EM UC7 type ultrathin slicer, and directly fishing out the resin embedding block by using a copper net after slicing; firstly, staining the ultrathin slice with lead citrate (prepared at present) for 15min, and then cleaning with carbon dioxide-removed double distilled water for 3 times; dyeing with uranyl acetate for 30min, cleaning with carbon dioxide-removed double distilled water for 3 times, and drying. And (4) observation: after the sample sections were dried, they were observed under an analytical transmission electron microscope (Hitachi HT7700) and stored by photographing.
The results show that:
the phenotype of the yellowing mutant H745 is leaf yellowing, the plant can show the leaf yellowing phenotype from the seedling stage, the plant height of the full-bloom stage (R2) is shorter than that of the wild plant, the leaves are small, and the stems are thin (figure 1 and figure 2); the chlorophyll content measurement result shows that the chlorophyll content of the upper, middle and lower leaves of the H745 plant is obviously lower than that of the wild type ZP661 (figure 3); chloroplast ultrastructural observations found that H745 chloroplast basal granule stacking was significantly lower than ZP661 (fig. 4) compared to wild type, probably responsible for this yellowing phenotype.
Example 2
1. Genetic population construction
In the Beijing cisoid test base of the Chinese agricultural science institute, ZP661 as a female parent and a yellowing mutant H745 as a male parent are used for configuring a hybrid combination and obtaining hybrid grains. And (3) carrying out F1 generation plant propagation and grain harvesting in the same place in summer in 2017, planting an F2 generation population in the same place in 2018, continuing planting an F3 generation population in 2019, and carrying out phenotype identification to verify the genotype of the F2 population.
2. Genomic DNA extraction
Sample preparation: weighing 0.1-0.5 g of soybean young leaf, placing the soybean young leaf in a 2mL centrifuge tube, marking sample numbers on a tube cover and a tube wall, adding a steel ball, quickly freezing in liquid nitrogen, and oscillating on an oscillator until the leaf is ground into powder. Cracking: adding 2% CTAB (added with 1/1000 volume of beta-mercaptoethanol) extract at 600 deg.C, shaking, mixing, removing steel ball with magnet, and placing in 65 deg.C water bath for 50 min. Extraction: adding 600 μ L phenol/chloroform (1:1) with the same volume, shaking gently, shaking, mixing, and centrifuging at 12000r/min for 10 min. Separation: taking the supernatant into a new 1.5mL centrifuge tube marked with a sample, adding 2 times of isopropanol into the centrifuge tube, standing at-20 ℃ for 5min to ensure that DNA is fully precipitated, taking out and centrifuging at 10000r/min for 8 min. Washing: discarding the supernatant, adding 500 μ L70% ethanol, cleaning, centrifuging at 10000r/min for 5 min; the washing was repeated. Dissolving: add 200. mu.L of ddH2Dissolving O completely, and storing at-20 deg.C.
BSA-seq analysis
The experimental process is executed by Beijing Baimaike biotechnology limited referring to the standard method of Illumina, and mainly comprises DNA sample detection, library construction, library quality detection and on-machine sequencing. And after the sample is detected to be qualified, randomly breaking the genome DNA into 350bp fragments by utilizing ultrasonic crushing, and completing construction of a sequencing library after terminal repair, 3' end adding A, sequencing joint addition, purification and PCR amplification. And sequencing by utilizing Illumina HiSeq after quality inspection is qualified. The content of the information analysis of the sequencing data includes: data quality control, comparison with a reference genome, variation detection and annotation.
4. Association analysis, candidate SNP and candidate gene annotation
And (4) summarizing the different variation sites existing among the samples according to the comparison of the sequencing material and the reference genome. The SNPs were filtered prior to association analysis. And analyzing by using an Euclidean Distance (ED) algorithm and an SNP-Index method to obtain the sites with significant differences among the mixed pools.
An ED method: genetic markers with significant differences between the two phenotype pools were searched from the sequencing data and regions associated with the target phenotype were evaluated and obtained. Theoretically, site markers associated with the target trait will vary between pools used for BSA-seq analysis, while other sites should tend to be consistent, as the ED value for non-target sites approaches 0. The equation for the calculation of ED is as follows, and a larger ED value indicates a larger difference between the two phenotypic pools for the genetic marker. During analysis, SNP with genotype difference between two phenotype pools is utilized, sequencing depth of each base in each phenotype mixed pool is counted, ED value of each site is calculated, original ED value is subjected to power processing, appropriate correlation value is selected according to data to achieve the effect of eliminating background noise, and then fitting of ED value is completed by utilizing a DISTANCE method. And fitting the ED value of the marker on the same chromosome by using the position of the marker on the genome so as to achieve the aim of eliminating false positive sites, and selecting a region above the correlation threshold value as a region associated with the target phenotype.
SNP-index method: performing marker association analysis through genotype frequency difference among phenotype mixed pools, mainly searching for a site with significant genotype frequency difference among the mixed pools, and counting by using delta (SNP-index). The stronger the association between a SNP and a target trait, the closer the value of its Δ (SNP-index) is to 1. To eliminate the effect of false positive loci, Δ SNP-index values of the same chromosomal marker are fitted using the marker position on the genome, then Δ SNP-index values are fitted using the DISTANCE method, and then regions above the association threshold are selected as regions associated with the target phenotype. Theoretically, the site linked to the target trait and its nearby association site should approach the threshold, so a higher peak appears at the interval of significant association.
The results show that:
in autumn of 2018, in Beijing, field seed test was performed on leaf yellowing mutant H745 and wild type ZP661 (FIG. 5) during the maturation period, compared with ZP661(CK), yellowing mutant H745 significantly reduced plant height, effective branch number, single plant pod number and hundred grain weight except for pod height and main stem node number.
Genetic analysis using constructed ZP661 XH 745(F2, 418) showed that the leaf yellowing phenotype is controlled by a recessive monogene.
TABLE 1 genetic analysis of the yellowing mutant H745
A ZP661 XH 745(F2) population is used for selecting 10 strains of yellowing mutant H745 plants to be mixed for constructing a mutant parent pool (R1), and a wild type offspring mixed pool (R2) and a mutant offspring mixed pool (R3) are respectively constructed by using 51 strains of wild type green individuals and yellowing individuals in an F2 population. And (3) determining the quality of the DNA through agarose gel electrophoresis, and performing library construction and sequencing on the qualified genome DNA.
During analysis, SNP loci with different genotypes between two mixing pools are utilized, sequencing depths of all bases in different mixing pools are counted, ED values of all the loci are calculated, power processing is carried out on original ED values for eliminating background noise, 5-power of the original ED values are taken as correlation values to achieve the function of eliminating the background noise, then a DISTANCE method is adopted to fit the ED values (figure 6), medium +3SD of all locus fitting values is taken as an analysis correlation threshold value [316], and 0.08 is calculated. Based on the correlation threshold determination, 2 intervals located on chromosome 11 were obtained in total, the total length was 6.65Mb, and 1,355 genes were included (Table 2).
TABLE 2 ED Association analysis, SNP-index association region
And fitting the Δ SNP-index by the DISTANCE method, and then selecting a region above the threshold as a region related to the trait according to the correlation threshold (fig. 7). Based on the theoretical separation ratio of the population of examples, a correlation threshold of 0.667 was calculated. Theoretically, the target site and its nearby linkage sites should approach the threshold, and therefore a higher peak should appear near the region of significant association. However, from the results, no area exceeding the theoretical threshold was found, indicating that no significant localization result was found in the present experiment. To take full advantage of the data, the threshold was lowered to find more likely localization regions, using 99 percentile of Δ SNP-index after fitting, i.e., 0.24, resulting in 3 regions with a total length of 9.56Mb, containing a total of 2,021 genes (Table 2).
And (3) performing association analysis on the results of association analysis by using ED and SNP-index methods, wherein the section of ED association analysis is contained in the section of SNP-index association analysis, so that the total length of the positioning section is 6.65 Mb. Statistics were made for the results of SNP annotation in candidate regions among ZP661(R4), H745(R1), wild type green leaf pool (R2), mutant yellow leaf pool (R3) samples, and the results are shown in table 3.
TABLE 3 SNP, Indel classification within association interval
Referring to BSA screening standard, carrying out screening identification on SNP sites during BSA-seq data candidate period, and screening 19 variation sites which accord with BSA variation rules in total, wherein the variation sites comprise 1 stop codon acquisition SNP, 4 non-synonymous coding SNPs, 4 gene upstream variation SNPs, one gene downstream SNP, 2 synonymous coding variation SNPs, 7 intron variation SNPs and 1 intergenic region variation SNP site.
Example 3
Based on sequencing data in the candidate interval, 9 sites on the gene are selected from 19 SNP sites which accord with the BSA pool forming rule in the associated interval (figure 8), and SNP verification and CAPS/dCAPS development are respectively carried out (according to variant sites obtained in resequencing data, SNP site attachment related sequences are obtained from a Phytozome website https:// Phytozome.jgi.doe.gov/pz/portal.html #, and primers are designed for identification). Identified, the SNP of the H745-1 site in 9 sites is false, the H745-4 amplified fragment is a homologous sequence, and the H745-8 amplified band has double peaks; the other 6 sites are all mutation SNPs (namely site variation is consistent with the sequencing result), and are successfully developed into CAPS/dCAPS markers for identifying the population.
Development of closely linked markers and primer sequences
And obtaining related sequences from a Phytozome website (https:// Phytozome.jgi.doe.gov/pz/portal.html #) according to the sequencing data and the sequence information of each gene. Marker development was performed using dCAPS Finder 2.0(http:// helix. wustl. edu/dCAPS. html). A molecular marker closely linked with the color of the soybean leaves in the research, wherein an upstream primer of H745-5 is 5'-ATCTGGCGAGGGAGATTCTG-3', and is shown as SEQ ID NO. 2; the downstream primer 5'-ACTCGTTGGCACCACCGTCCAT-3' is shown as SEQ ID NO.3, the amplification band size is 201bp (ATCTGGCGAGGGAGATTCTGAAGGTGACGCCGAAGGGGAATCCGATGCAGTTCGGACGCAGGATTGGACTGGAAGGTGTGATTAGGGTTTTGGAAGGGGCAGTGTTCGAGTACGCGGAGGTGCAGGAGATTCTGGAACGGAGAGGAAAGGGTGAGAATTTGGAGTATCTTGTGCGGTGG(A) ATGGACGGTGGTGCCAACGAGT is shown as SEQ ID NO. 1), the endonuclease is BccI (purchased from Beijing Bailingke Biotech Co., Ltd.), and the wild type reverse sequence CCATC is recognized. After the primers are generated, the specificity analysis is carried out on the primers by utilizing soybean Phytozome (https:// Phytozome.jgi.doe.gov/pz/portal.html #) and Soybase (https:// www.soybase.org /) databases, and at least one primer is ensured to exist specifically in the genome. After synthesis, the primer sequencer was dissolved in 100. mu.M of the mother solution and diluted to 10. mu.M of the working solution at the time of use. And (3) carrying out fragment PCR amplification by using Easy Taq, identifying the normal size of a band by agarose gel electrophoresis imaging, and detecting a target band sequence by using a Sanger method so as to identify the accuracy of an amplification product.
PCR amplification
The reaction system (20. mu.L) included: 1-2. mu.L DNA template (80-150 ng), upstream and downstream primers 0.6. mu.L each, 10 × Easy Taq Buffer (Mg)2+free) 2. mu.L, dNTPs (2.5mM) 2. mu.L, Easy Taq polymerase (all-gold, AP111) 0.2. mu.L, ddH2Make up to 20. mu.L of O. PCR reaction procedure: pre-denaturation at 95 ℃ for 5min, annealing at 95 ℃ for 30s, (Tm-5) ℃ for 30s, extension at 72 ℃ (1min/kb), 35 cycles, and extension at 72 ℃ for 8 min.
Wherein, the DNA template is genome DNA extracted from seedling leaves of parents and groups by a CTAB method.
Agarose gel electrophoresis
And identifying the PCR amplification product by adopting 0.8-2% agarose gel. Preparing glue: weighing 0.8-2g of agarose powder, putting into a triangular flask containing 100mL of electrophoresis buffer solution 1 XTAE, and heating in a microwave oven until agarose is completely dissolved; after the temperature of the liquid is reduced to 50-60 ℃, slowly pouring the liquid into a glue making plate which is placed in a glue groove and is inserted with a comb, and removing bubbles; after the gel is completely solidified, slowly and vertically pulling out the comb upwards, then gently taking out the gel making plate in which the gel is placed, placing the gel making plate and the gel making plate into an electrophoresis tank together, adding 1 XTAE electrophoresis buffer solution (adding 1/30 volumes of EB solution and then uniformly mixing) into the electrophoresis tank until the liquid level of the gel is over the gel. Electrophoresis: a sample of 6. mu.L of the PCR amplification product was sampled, and 1. mu.L of 6 XLoading Buffer (containing bromophenol blue indicator) was added thereto, mixed, and spotted. After the sample application, the voltage is adjusted to 120V, the current is adjusted to 400mA, the start of electrophoresis is confirmed after the electrophoresis is started (the electrode wire generates bubbles), and after about 30min of electrophoresis, the electrophoresis is observed in a gel imaging system and photographed for storage.
Non-denaturing polyacrylamide gel electrophoresis
mu.L of 10 × Loading Buffer was added to the PCR product, and after mixing well, 1.5. mu.L of the sample was taken and examined by Non-denaturing Polyacrylamide Gel Electrophoresis (Non-PAGE). Plate manufacturing: the flat plate and the concave plate glass are washed clean and vertically dried on a horizontal desktop, and are scrubbed by 70% ethanol, the plates are guaranteed to have no residual glue, the two plates are buckled together, the concave plate is arranged below the flat plate, a middle cavity is used for filling gel, and two sides are clamped by clamps, so that liquid leakage is avoided. Glue pouring: 30mL of the prepared gel at the early stage is prepared, added with 1% by volume of Ammonium Persulfate (APS) and 1 ‰ by volume of TMED, horizontally mixed and lightly poured between the two plates. Inserting a clean comb, wherein the comb teeth extend into the gel by about 1.0 cm; and (5) solidifying for 30 min-1 h at normal temperature, and observing at any time to prevent the gel from shrinking, cracking and deforming. And (3) upper plate: removing the clamp from the solidified gel, washing the gel (removing residual gel), and slightly pulling out the comb to ensure that the sample dispensing hole is complete and has no residual gel; the two plates are vertically placed and fixed on the electrophoresis tank by a clamp, and the buffer solution is ensured not to leak; 0.5 xTBE buffer solution is added into the upper electrophoresis tank and the lower electrophoresis tank respectively, so that the lower part of the electrophoresis tank is submerged in the clamping groove, and the upper part of the electrophoresis tank is submerged in the spot hole. Sample application: cleaning the sample application hole by using an injector, blowing impurities such as bubbles, broken glue and the like out of the sample application hole, injecting 1.0-1.5 mu L of a non-denatured PCR product added with a small amount of bromophenol blue indicator into the sample application hole by using a micropipette, and injecting D2000 DNA marker into the sample application hole at two ends of the sample application hole as a strip mark. Electrophoresis: and (3) operating at the voltage of 250V for 30-40 min, observing a bromophenol blue indicator strip at any time, wherein the glue running time is determined according to the strip size. Silver staining: and after electrophoresis is finished, taking down the electrophoresis tank clamp, detaching the gel plate, prying open the flat plate and the concave plate, taking out the gel, slowly putting the gel into a prepared 1% AgNO3 aqueous solution for silver dyeing, slightly shaking to ensure that the gel is completely contacted with a silver dyeing solution, taking out the gel after 3-5 min, and washing the gel with deionized water for 30 seconds. And (3) developing: and (3) placing the gel in a developing solution (1L of deionized water, adding 1.5g of NaOH and 5-10 mL of formaldehyde, uniformly mixing), developing, observing at any time until strips on the gel are clear, transferring the gel into the deionized water, cleaning, finishing developing and washing away the developing solution. Sealing glue: cleaning the table top, spreading a preservative film, spraying a little clear water, flatly placing the developed gel on the preservative film, spraying a little clear water, sealing with the preservative film, filtering out excessive water and air in the preservative film with a plastic plate, and placing the preservative film in a fume hood in parallel for a period of time to remove formaldehyde.
Reading a tape: the gel band corresponding to the wild type ZP661 was labeled as "a", the band corresponding to mutant H745 was labeled as "B", and the heterozygous comprising the wild type, mutant double parental band was labeled as "H".
The embodiments in the present description are described in a progressive manner, each embodiment focuses on differences from other embodiments, and the same and similar parts among the embodiments are referred to each other.
The previous description of the disclosed embodiments is provided to enable any person skilled in the art to make or use the present invention. Various modifications to these embodiments will be readily apparent to those skilled in the art, and the generic principles defined herein may be applied to other embodiments without departing from the spirit or scope of the invention. Thus, the present invention is not intended to be limited to the embodiments shown herein but is to be accorded the widest scope consistent with the principles and novel features disclosed herein.
Sequence listing
<110> institute of crop science of Chinese academy of agricultural sciences
<120> close linkage marker for controlling soybean leaf color related gene and application thereof
<160> 3
<170> SIPOSequenceListing 1.0
<210> 1
<211> 201
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<221> misc_feature
<222> (179)..(179)
<223> n can be G or A
<400> 1
atctggcgag ggagattctg aaggtgacgc cgaaggggaa tccgatgcag ttcggacgca 60
ggattggact ggaaggtgtg attagggttt tggaaggggc agtgttcgag tacgcggagg 120
tgcaggagat tctggaacgg agaggaaagg gtgagaattt ggagtatctt gtgcggtgna 180
tggacggtgg tgccaacgag t 201
<210> 2
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
<210> 3
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
actcgttggc accaccgtcc at 22
Claims (5)
1. A marker closely linked with genes related to controlling soybean leaf color is characterized in that the marker is H745-5 positioned on chromosome 11; the H745-5 nucleotide sequence is shown in SEQ ID NO. 1.
2. The application of the close linkage marker for controlling the soybean leaf color related gene in identifying the soybean plant yellowing is characterized in that if the 179 th bp of the nucleotide sequence SEQ ID NO.1 is mutated from G to A, the phenotype of leaf yellowing is shown from the seedling stage, the plant height in the full-bloom stage is shorter than that of a wild plant, the leaves are small, and the stems are thin; the chlorophyll content of the upper, middle and lower leaves of the plant is obviously lower than that of the wild type plant in the chlorophyll content determination; chloroplast ultrastructure significantly reduced chloroplast basal granule stacking compared to wild-type.
3. The amplification primer pair for controlling the close linkage marker of the soybean leaf color related gene as claimed in claim 1, wherein:
the sequence of the PCR amplification upstream primer of H745-5 is 5'-ATCTGGCGAGGGAGATTCTG-3', and is shown as SEQ ID NO. 2;
the sequence of the PCR amplification downstream primer of H745-5 is 5'-ACTCGTTGGCACCACCGTCCAT-3', and is shown as SEQ ID NO. 3.
4. The linked marker of claim 1 or the primer pair of claim 3 for use in soybean breeding.
5. The use of the primer pair of claim 3 in the preparation of a kit for detecting genes related to controlling soybean leaf color.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110778379.9A CN113502346A (en) | 2021-07-09 | 2021-07-09 | Marker for controlling close linkage of soybean leaf color related genes and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110778379.9A CN113502346A (en) | 2021-07-09 | 2021-07-09 | Marker for controlling close linkage of soybean leaf color related genes and application |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN113502346A true CN113502346A (en) | 2021-10-15 |
Family
ID=78012071
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202110778379.9A Pending CN113502346A (en) | 2021-07-09 | 2021-07-09 | Marker for controlling close linkage of soybean leaf color related genes and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN113502346A (en) |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20040031072A1 (en) * | 1999-05-06 | 2004-02-12 | La Rosa Thomas J. | Soy nucleic acid molecules and other molecules associated with transcription plants and uses thereof for plant improvement |
| CN104004853A (en) * | 2014-06-18 | 2014-08-27 | 吉林省农业科学院 | Method for identifying soybean male sterile cytoplasm through SNP marks of chloroplast DNA |
| WO2017205834A1 (en) * | 2016-05-27 | 2017-11-30 | The Board Of Trustees Of The University Of Illinois | Transgenic plants with increased photosynthesis efficiency and growth |
-
2021
- 2021-07-09 CN CN202110778379.9A patent/CN113502346A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20040031072A1 (en) * | 1999-05-06 | 2004-02-12 | La Rosa Thomas J. | Soy nucleic acid molecules and other molecules associated with transcription plants and uses thereof for plant improvement |
| CN104004853A (en) * | 2014-06-18 | 2014-08-27 | 吉林省农业科学院 | Method for identifying soybean male sterile cytoplasm through SNP marks of chloroplast DNA |
| WO2017205834A1 (en) * | 2016-05-27 | 2017-11-30 | The Board Of Trustees Of The University Of Illinois | Transgenic plants with increased photosynthesis efficiency and growth |
Non-Patent Citations (5)
| Title |
|---|
| HAO等: "Genome-wide association analysis detecting significant single nucleotide polymorphisms for chlorophyll and chlorophyll fluorescence parameters in soybean (Glycine max) landraces", 《EUPHYTICA》 * |
| HERRITT等: "Identification of genomic loci associated with 21 chlorophyll fluorescence phenotypes by genome-wide association analysis in soybean", 《BMC PLANT BIOLOGY》 * |
| LI等: "Development and utilization of a new chemically-induced soybean library with a high mutation density", 《JOURNAL OF INTEGRATIVE PLANT BIOLOGY》 * |
| YU等: "High-density QTL mapping of leaf-related traits and chlorophyll content in three soybean RIL populations", 《BMC PLANT BIOLOGY》 * |
| 吕孟华: "大豆叶黄化基因GmYLD1定位与克隆研究", 《山东大学硕士学位论文》 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| WO2017092110A1 (en) | Sesamum indicum inflorescence definite gene sidt1 and snp marker thereof | |
| CN110117673B (en) | Molecular marker of brassica napus dwarf trait locus and application thereof | |
| CN106939348A (en) | A kind of microsatellite marker primer and its authentication method for acipenser dabryanus Parentage determination | |
| CN112322769B (en) | SNP molecular marker related to cucumber multi-epidermal hair traits and application thereof | |
| CN112899247B (en) | Male sterile gene ZmTKPR1 and application thereof in creating male sterile line of corn | |
| CN112961231A (en) | Male sterile gene ZmbHLH122 and application thereof in creating male sterile line of corn | |
| CN109722486B (en) | Watermelon seed navel spot character major gene, molecular marker for detecting major gene and application | |
| CN110079629B (en) | SNP (Single nucleotide polymorphism) marker tightly linked with watermelon short vines, detection method and application | |
| CN112680459B (en) | Male sterile gene ZmTGA10 and application thereof in creating male sterile line of corn | |
| CN112176091B (en) | CAPS molecular marker closely linked with eggplant sepal color character gene and preparation method thereof | |
| CN113355447A (en) | Gene closely linked marker for controlling soybean chloroplast development and application thereof | |
| CN111057771B (en) | SNP molecular marker for distinguishing 'Zhongyang No. 1' from common fugu obscurus and application thereof | |
| CN110862444B (en) | Maize bm1 gene mutant and molecular marker and application thereof | |
| CN115948600B (en) | Grape powdery mildew resistance dCAPS molecular marker and application thereof | |
| CN110607384A (en) | Method for constructing bermuda grass core germplasm by using SSR markers | |
| CN113502346A (en) | Marker for controlling close linkage of soybean leaf color related genes and application | |
| CN113604587B (en) | Molecular marker T5198 for rapidly identifying low-temperature tolerant variety of penaeus japonicus and application thereof | |
| CN110004248B (en) | Sesame internode length gene Sidwf1 and SNP marker thereof | |
| CN110747281B (en) | Low-salt-resistant molecular marker C62 of portunus trituberculatus and application thereof | |
| CN111631174A (en) | Breeding method of Cyprinus carpiod | |
| CN110791511B (en) | Hypoxia-resistant megalobrama amblycephala growth character gene and positioning method and application thereof | |
| CN112680458B (en) | Male sterile gene ZmMYB33 and application thereof in creating male sterile line of corn | |
| CN114736979B (en) | Molecular marker closely linked with watermelon complete leaf shape gene ClLL and application thereof | |
| CN113151578B (en) | DNA barcode standard detection gene for distinguishing different elephant grass varieties and application thereof | |
| CN113981112B (en) | InDel marker C3082 for identifying ammonia nitrogen tolerance character of portunus trituberculatus, primers and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| AD01 | Patent right deemed abandoned | ||
| AD01 | Patent right deemed abandoned |
Effective date of abandoning: 20230228 |