CN113355447A - Gene closely linked marker for controlling soybean chloroplast development and application thereof - Google Patents
Gene closely linked marker for controlling soybean chloroplast development and application thereof Download PDFInfo
- Publication number
- CN113355447A CN113355447A CN202110777328.4A CN202110777328A CN113355447A CN 113355447 A CN113355447 A CN 113355447A CN 202110777328 A CN202110777328 A CN 202110777328A CN 113355447 A CN113355447 A CN 113355447A
- Authority
- CN
- China
- Prior art keywords
- soybean
- marker
- snp
- chloroplast
- yellowing
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Immunology (AREA)
- Mycology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Botany (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a molecular marker for controlling close linkage of soybean chloroplast development related genes and application thereof, belonging to the technical field of breeding and molecular genetics. The molecular marker SNP-1319 closely linked to the gene related to the control of soybean chloroplast development is located on chromosome 19. The invention uses a soybean seedling stage yellowing lethal mutant ed1 obtained by screening EMS mutagenesis mesogen 661 as a material, performs phenotype identification through chloroplast observation, chlorophyll content determination and chloroplast ultrastructure observation, and uses a mutant M5Yellow and green individuals in filial generations separated from generation heterozygous single plants construct a mixed pool for BSA-seq sequencing, a genetic segregation population is combined for linkage analysis, dCAPS markers are developed aiming at the mutation sites of candidate genes, ZP661 Xed 1(F2:3) populations are identified by using the developed dCAPS markers to obtain genotype data, and the accuracy and reliability of the markers are identified.
Description
Technical Field
The invention relates to the technical field of breeding and molecular genetics, in particular to a close linkage marker for controlling soybean chloroplast development related genes and application thereof.
Background
The leaf color is one of important agronomic character traits and is the comprehensive expression of various pigments of plant chloroplast, and the mutation of leaf color related genes can influence the development of the chloroplast or the normal function of biosynthesis of various pigments. The leaf color mutant is an ideal material for researching the structure, the function and the regulation mechanism of a photosynthetic system such as photosynthesis, hormone physiology, photomorphogenesis and signal transduction pathways.
However, the development of soybean functional genomics research is limited by a plurality of factors such as complex genome structure, low genetic transformation efficiency and the like. Both the yield phenotype and the quality phenotype are extremely complex quantitative traits, and the research on related genes by using the traditional variety resource materials is difficult. With the publication of soybean genome sequencing results and the continuous development of sequencing technologies, functional genomics has become an important direction for soybean subject research.
With the rapid development of Next-generation Sequencing (NGS) technology, various high-throughput genotyping analysis methods based on re-Sequencing have emerged and are continuously perfected, such as those based on whole-genome re-Sequencing, high-density functional SNP chips, and the like.
Therefore, it is a problem to be urgently solved by those skilled in the art to provide a closely linked marker for controlling soybean chloroplast development related genes.
Disclosure of Invention
In view of this, the invention provides a close linkage marker for controlling soybean chloroplast development related genes and application thereof. The group separation analysis method (BSA method) is used for coarse positioning of plant character genes, the difficulty in obtaining near-isogenic lines of many species is overcome, and the method is efficient and convenient compared with the near-isogenic line method.
In order to achieve the purpose, the invention adopts the following technical scheme:
a close linkage marker of a gene related to the control of soybean chloroplast development, which is SNP-1319 positioned on chromosome 19; the nucleotide sequence of the SNP-1319 is shown as SEQ ID NO. 1.
The invention also provides an application of the close linkage marker for controlling the soybean chloroplast development related gene in identifying the yellowing death of soybean plants, if the 23 rd bp of the nucleotide sequence SEQ ID NO.1 is mutated from C to T, the obvious yellowing phenotype is shown from the emergence of seedlings, the yellowing phenotype is obvious when true leaves grow and are completely unfolded, and the true leaves, the young buds, the cotyledons and the hypocotyls are all shown to be yellowing; after the VC period, the plants begin to gradually show a lethal phenotype of shriveling withering, and the plants are withered and lethal in the V1 period.
The invention also provides the amplification primer pair for controlling the close linkage marker of the soybean chloroplast development related gene, wherein the PCR amplification upstream primer sequence of the SNP-1319 is 5'-AGAAGCTTCGGTTGACTATCGA-3', and is shown as SEQ ID NO. 2; the sequence of the PCR amplified downstream primer of SNP-1319 is 5'-TCACTTCTATCAATGAGC-3', as shown in SEQ ID NO 3.
The invention also provides the application of the linkage marker or the primer pair in soybean breeding.
The invention also provides application of the primer pair in preparation of a detection kit for controlling soybean chloroplast development related genes.
According to the technical scheme, compared with the prior art, the invention discloses and provides the close linkage marker for controlling the soybean chloroplast development related gene and the application thereof, and the obtained technical effects are as follows: the method utilizes a soybean seedling stage yellowing lethal mutant ed1 obtained by screening EMS mutagenesis mesogen 661 as a material, and performs phenotype identification through chloroplast observation, chlorophyll content determination and chloroplast ultrastructure observation; yellow and green individuals in the separated offspring of the mutant M5 generation heterozygous single plant are used for constructing a mixed pool for BSA-seq sequencing, and linkage analysis is carried out by combining genetic segregation populations; and developing dCAPS markers aiming at the mutation sites of the candidate genes, and identifying ZP661 multiplied 1(F2:3) groups by using the developed dCAPS markers to obtain genotype data, thereby identifying the accuracy and reliability of the markers.
Drawings
In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the embodiments or the prior art will be briefly described below, it is obvious that the drawings in the following description are only embodiments of the present invention, and for those skilled in the art, other drawings can be obtained according to the provided drawings without creative efforts.
FIG. 1 is a drawing of a ZP661, ED1 and an etiolation lethal ED1 entity provided by the invention, wherein, a drawing shows a seedling plant (7D) of ZP661, ED1 and etiolation lethal ED1 from left to right, and a ruler (Bar) in the drawing is 1 cm; panel B is from left to right ZP661, ED1, etiolated lethal ED1 true leaf (7D) panel, Bar 1 cm.
FIG. 2 is a diagram showing the contents of ZP661, ED1 and ED1 chlorophyll.
FIG. 3 is a left-to-right view of the ultrastructure of ZP661, ED1, ED1 chloroplast.
FIG. 4 shows the observation of chloroplasts of ZP661(A, D), ED1(B, E) and the yellowing lethal mutant ED1(C, F), wherein a is normal form chloroplast, and b, c and d are abnormal form chloroplasts.
FIG. 5 is a diagram illustrating a result of a candidate interval correlation analysis.
FIG. 6 is a drawing of 6 site identifications and signatures, wherein A: site PCR amplification band agarose detection results, B: site sequencing results, C: success or failure of marker development and successful development of marker types.
FIG. 7 is a schematic diagram of candidate intervals obtained from the molecular marker identification population.
FIG. 8 is a graph of dCAPS markers identifying ZP661 Xed 1 population F2 recessive individuals. Lane 1: marker, lane 2: band (a) generated by ZP661, lane 3: flavobacterium mutant ed 1-produced band (B), and others: ZP661 Xed 1 population F2 generation recessive individuals produced A band, B band and heterozygous band H.
Detailed Description
The technical solutions in the embodiments of the present invention will be clearly and completely described below with reference to the drawings in the embodiments of the present invention, and it is obvious that the described embodiments are only a part of the embodiments of the present invention, and not all of the embodiments. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.
The embodiment of the invention discloses a close linkage marker for controlling soybean chloroplast development related genes and application thereof.
In the examples, wild soybean germplasm 661(ZP661), seedling yellowing lethal mutant ED1, and control ED1 were all from the subject group of soybean gene resource mining and utilization of the institute of crop science, Chinese academy of agricultural sciences.
Example 1
1. Determination of photosynthetic pigment content
And (3) measuring the content of the photosynthetic pigment in the soybean leaves by using a spectrophotometry.
In 2016, respectively selecting a wild type ZP661, a mutant control ED1 and a yellowing-lethal mutant ED1 with relatively consistent growth vigor in an incubator, selecting the same position of a leaf, sampling, and determining the pigment content of true leaves of a plant in a seedling stage. The operation method comprises the following steps: weighing about 0.1g of leaves, shearing into pieces, placing into 5mL of 95% ethanol, uniformly mixing, sealing, and processing in dark for 24-48h, shaking and uniformly mixing for multiple times during the period until the leaves are totally green and become white, and repeating for 10 times. The absorbance at 665nm, 649nm and 470nm was determined using a DU800UV/Vis UV spectrophotometer (Beckman Cloulter).
Chlorophyll a concentration Ca is 13.95 XD 665-6.88 XD 649
The concentration Cb of chlorophyll b is 24.96 XD 649-7.32 XD 665
Carotenoid concentration Cx (1000 XD 470-2.05 XCA-114 XCB)/245
Chloroplast pigment content (mg/g) ═ pigment concentration (C) × extract volume (mL)/fresh or dry weight (g) of sample
2. Chloroplast morphology identification
Chloroplast isolation: reference is made to the method of J.Cummis with appropriate modifications and observation by means of an optical microscope. In 2017, in winter, wild ZP661, mutant control ED1 and yellowing lethal mutant ED1 leaves with consistent growth vigor in an incubator are respectively selected, chloroplasts in true leaves at the seedling stage are separated, and the chloroplasts are observed under an optical microscope. The operation method comprises the following steps: selecting ZP661, ED1 and ED1 leaves with consistent growth vigor in seedling stage (VC stage), cleaning, and pre-cooling at 0-4 deg.C; adding 30-50mL of precooled separation medium, placing in a precooled mortar, manually and rapidly grinding for 0.5-1min, and filtering homogenate after grinding by using two layers of new gauze; transferring the filtrate into a precooling centrifuge tube, and centrifuging for 2min at 1000 r/min; after sucking the supernatant, centrifuging for 5min at 3000r/min, discarding the supernatant, and taking the remained precipitate as chloroplast; adding 2mL of suspension and determination medium II into the centrifuge tube, and blowing and beating the suspension and the determination medium II by using a pipette to obtain suspension sediment; and (3) sucking a small amount of liquid, adding a small amount of suspension, adding a measuring medium II to dilute the chloroplast solution, and then placing the chloroplast solution under an optical microscope for observation.
3. Chloroplast ultrathin section preparation and transmission electron microscope observation
Fixing: cutting fresh soybean leaf with ultrathin blade to obtain 0.5-1mm thick soybean leaf3And placing the square blocks into 1.5mL of glutaraldehyde stationary liquid, vacuumizing by using a vacuum pump until the square blocks of the blades settle to the bottom of the centrifugal tube, and placing the square blocks in a refrigerator at 4 ℃ for fixation. And (3) dehydrating: washing 3 times with 0.1mol PBS (pH 7.2) at room temperature for 15min each time; then treating with osmic acid for 1.5h, washing with 0.1mol PBS (pH 7.2) for 3 times, 15min each time; and then dehydrating with 30%, 40%, 50%, 60%, 70%, 85%, and 95% ethanol for 15min each time. Dehydration was finally completed with absolute ethanol (100%), repeated twice, each for 15 min. And (3) infiltration: the dehydrated leaves were placed in 100% acetone for infiltration, repeated 2 times, each for 15 min. The leaves were then placed in a resin mixture (acetone: resin 1:1) and allowed to permeate for 2.5 h. The sample was then placed in a resin mixture (acetone: resin: 1: 3) and allowed to permeate for 3 h. Finally, the resin was placed in neat resin overnight at 4 ℃. Embedding: adding resin into the blade sample for embedding, moving the processed blade to an embedding block by using a toothpick, sinking the blade to the bottom, adjusting the direction of the blade so as to be cut by a knife, and fixing the blade in a 65 ℃ constant temperature box for 24 hours after the blade is finished. Tabletting: fixing the prepared resin embedding block on an LEICA EM UC7 type ultrathin slicer, and directly fishing out the resin embedding block by using a copper net after slicing; firstly, staining the ultrathin slice with lead citrate (prepared at present) for 15min, and then cleaning with carbon dioxide-removed double distilled water for 3 times; dyeing with uranyl acetate for 30min, cleaning with carbon dioxide-removed double distilled water for 3 times, and drying. And (4) observation: after the sample sections were dried, they were observed under an analytical transmission electron microscope (Hitachi HT7700) and stored by photographing.
The results show that:
compared with wild type middle products 661(CK) and a control ED1, the etiolation lethal mutant ED1 shows obvious etiolation phenotype from seedling emergence (VE stage), and shows obvious etiolation phenotype when true leaves grow and completely expand (VC stage) (fig. 1A), and the true leaves, the buds, the cotyledons and the hypocotyls all show etiolation (fig. 1B); after the VC period, ed1 plants began to develop a lethal phenotype of shriveling withering, and plants became dry and lethal at V1.
The contents of chlorophyll and carotenoid of 3 phenotypic plants are identified, and the identification result shows that (figure 2) the contents of mutant ED1 chlorophyll a, chlorophyll b and carotenoid are all obviously less than those of wild ZP661 and control ED 1; the controls ED1 chlorophyll a, chlorophyll b were significantly lower than wild-type ZP661, but the carotenoid content was not significantly different from ZP 661. Indicating that the greenish-yellow lethal mutant ed1 is caused by the reduction of chlorophyll and carotenoid content.
Impaired chlorophyll synthesis often affects normal development and structural maintenance of chloroplasts. The number of chloroplasts in the wild type ZP661 visual field is large and the chloroplasts are uniformly distributed, and the shape of the chloroplasts is regular bar-shaped; in the visual field of the control mutant ED1, the number and the morphology of chloroplasts are reduced, and the morphological abnormality of partial chloroplasts is round; the number of chloroplasts of the etiolating lethal mutant ed1 is obviously reduced under the same separation condition, and the chloroplasts are abnormal in morphology and mostly appear to be round and oval (figure 3 and figure 4). The change of the form and the quantity of the chloroplasts can be caused by mutation, and the change of the quantity of the chloroplasts can be caused by the change of the quality of the chloroplasts, so that the phenotype of different quantity of the chloroplasts under the same separation condition is generated.
Example 2
1. Genetic population construction
In summer of 2017, in Beijing cisternal test base of institute of agricultural academy of China, ZP661 as female parent and normal plant in etiolation lethal phenotype segregation line of mutant ED1 as male parent are combined to obtain hybrid seed. And F1 generation plant propagation is carried out in a phytotron of the institute of crop science of Chinese academy of agricultural sciences in 2017 in winter, and seeds are harvested. In summer in 2018, F2 populations are planted in a Beijing cisoid test station, after seedling stage identification, 1F 2 population with yellowing lethal phenotype separation is found, and F3 populations are planted in 2019, and two generation populations are used for seedling stage sampling, genome DNA extraction and marker development and candidate gene identification.
2. Genomic DNA extraction
Sample preparation: weighing 0.1-0.5 g of soybean young leaf, placing the soybean young leaf in a 2mL centrifuge tube, marking sample numbers on a tube cover and a tube wall, adding a steel ball, quickly freezing in liquid nitrogen, and oscillating on an oscillator until the leaf is ground into powder. Cracking: adding 600 μ L2% CTAB (added with 1/1000 volume of beta-mercaptoethanol) extractive solution, shaking, mixing, removing steel ball with magnet, and placing in 65 deg.C water bath for 50 min. Extraction: adding 600 μ L phenol/chloroform (1:1) with the same volume, shaking gently, shaking, mixing, and centrifuging at 12000r/min for 10 min. Separation: taking the supernatant into a new 1.5mL centrifuge tube marked with a sample, adding 2 times of isopropanol into the centrifuge tube, standing at-20 ℃ for 5min to ensure that DNA is fully precipitated, taking out and centrifuging at 10000r/min for 8 min. Washing: discarding the supernatant, adding 500 μ L70% ethanol, cleaning, centrifuging at 10000r/min for 5 min; the washing was repeated. Dissolving: add 200. mu.L of ddH2Dissolving O completely, and storing at-20 deg.C.
3. Construction of sequencing library and Illumina HiSeq sequencing
The experimental process is executed by Beijing Baimaike biotechnology limited referring to the standard method of Illumina, and mainly comprises DNA sample detection, library construction, library quality detection and on-machine sequencing. And after the sample is detected to be qualified, randomly breaking the genome DNA into 350bp fragments by utilizing ultrasonic crushing, and completing construction of a sequencing library after terminal repair, 3' end adding A, sequencing joint addition, purification and PCR amplification. And sequencing by utilizing Illumina HiSeq after quality inspection is qualified. The content of information analysis of sequencing data includes data quality control, comparison with reference genome, variation detection and annotation.
4. Association analysis, candidate SNP and candidate gene screening
And (4) summarizing the different variation sites existing among the samples according to the comparison of the sequencing material and the reference genome. The SNPs were filtered prior to association analysis. And analyzing by using an Euclidean Distance (ED) algorithm or an SNP-Index method to obtain the sites with significant differences among the mixed pools.
During analysis, SNP with genotype difference between two phenotype pools is utilized, sequencing depth of each base in each phenotype mixed pool is counted, ED value of each site is calculated, original ED value is subjected to power processing, appropriate correlation value is selected according to data to achieve the effect of eliminating background noise, and then fitting of ED value is completed by utilizing a DISTANCE method. And fitting the ED value of the marker on the same chromosome by using the position of the marker on the genome so as to achieve the aim of eliminating false positive sites, and selecting a region above the correlation threshold value as a region associated with the target phenotype.
Results of genetic analysis
The genetic analysis is carried out by utilizing the heterozygous single-plant progeny of the mutant, and the result shows that X2(3:1)<3.841、P-value>0.05 (Table 1), the segregation ratio of the mutation phenotype is 3:1, namely the yellowing lethal phenotype at the seedling stage is controlled by a pair of recessive single genes.
TABLE 1 genetic analysis
BSA-seq analysis
Planting M5 generation heterozygous single plants (ZP661 seeds are planted after EMS mutagenesis to obtain M1 single plants, after harvesting, continuously planting M2, after harvesting, only 1 single plant is selected from M3-M5 generation to be planted, and then 1 single plant is harvested next generation to be continuously planted), after emergence of seedlings, the yellowing phenotype is obvious in 5d seedling stage, 60 normal and yellowing lethal plants are selected to be extracted with high-quality gene genome DNA, after agarose gel electrophoresis detection is qualified, sample genome DNA is equivalently mixed to construct wild green leaf pool (R1) and mutant yellow leaf pool (R2), and then, library construction and sequencing are carried out.
The sequencing depth of each base in different phenotype pools is counted by utilizing all SNP sites with genotype difference between the two phenotype pools, the ED value of each site is calculated, the 2 th power of the original ED value is taken as a correlation value to achieve the function of eliminating background noise, 27 correlation intervals are obtained by utilizing the distribution of the correlation values (figure 5) after the ED values are fitted by adopting a DISTANCE method, and the total length is 26.98 Mb. Statistics were performed on the SNP annotation information between the two phenotype pools within the candidate interval, and the results are shown in Table 2.
Theoretically, the base type in the variant pool (yellow leaf pool) should be single, and different from that of the reference genome and control variety ZP661, the wild type pool (green leaf) should exhibit 2 base types, wherein the depth of sequencing value of the variant base type should be lower than that of the wild type base type. According to the BSA pool building rule, the total 14 SNP sites obtained by screening are distributed at 8 genes, wherein 3 intergenic region sites, 1 intron region site, 7 gene upstream (within 5 kb), 1 gene downstream (within 5 kb), 1 nonsynonymous coding SNP mutation and 1 stop codon are obtained.
TABLE 2 SNP/Indel Classification within association intervals
Example 3
CAPS/dCAPS marker development and primer design
Based on the associated region with the high ED value of chromosome 19 in the sequencing data, 6 sites of ED1-1, ED1-2, ED1-3, ED1-4, ED1-5 and ED1-6 are selected for identification (according to the variation sites obtained in the re-sequencing data, SNP site attachment related sequences are obtained from Phytozome websites https:// phytozome.jgi.doe.gov/pz/portal.html #, and primers are designed for identification).
Through sequencing identification, ed1-2(CAPS marker, endonuclease MaeI, SNP-1266), ed1-3(SNP-1319), ed1-5(dCAPS marker, endonuclease KpnI, SNP-1397) and ed1-6(dCAPS marker, endonuclease Hphi and SNP-1459) are true (namely the site variation is consistent with the sequencing result, and FIG. 6) and CAPS and dCAPS markers are respectively developed for identifying the population aiming at the 4 sites.
Candidate marker identification and crossover individual screening are carried out by utilizing recessive individuals (208 strains) in ZP661 multiplied 1 population F3 generation population, and the candidate gene localization interval is identified to be reduced to be between chromosome 19 SNP-1266 and SNP-1397 (figure 7), the interval size is 130kb, 12 genes exist in the interval, only one variation site exists in the interval, namely, the site SNP-1319 linked with the phenotype in candidate gene Gmed1 (figure 8).
Gmed1 was mutated from C to T at 5116bp in exon 8, resulting in the mutation of the amino acid from CAA (glutamine) to TAA (terminator) and thus termination of translation.
Obtaining related sequences of SNP site attachments from a Phytozome website (https:// Phytozome.jgi.doe.gov/pz/portal.html #), and carrying out marker development by using dCAPS Finder 2.0(http:// helix.wustl.edu/dCAPS/dcaps.html). Designing identification marker primers according to enzyme cutting sites, wherein the sequences of primers corresponding to dCAPS molecular marker SNP-1319 closely linked to soybean yellowing lethal phenotype are respectively as follows: an upstream primer 5'-AGAAGCTTCGGTTGACTATCGA-3', shown as SEQ ID NO. 2; the downstream primer 5'-TCACTTCTATCAATGAGC-3' is shown in SEQ ID NO. 3. The amplified band has a size of 180bp and is shown as SEQ ID NO.1 (AGAAGCTTCGGTTGACTATCGAC (or T) AAACAATGCAGGAGCAATCAGTTGAGCTGTTTGATGGTGGTGGAGCTGTTCAAAGTGAACCACAAAACTCCATAAATTGGAACTCTCCCAAAGAAGCTTCTGTCGATAATCAACAGGCAATACAGGGGCAGTCATTTGAGCTCATTGATAGAAGTGA), the used restriction enzyme is ClaI (purchased from Beijing Bailingke Biotech Co., Ltd.), the forward sequence of the cut mutant is shown, and the recognition sequence is ATCGAT. And (3) carrying out fragment PCR amplification by using Easy Taq, identifying the normal size of a band by agarose gel electrophoresis imaging, and detecting a target band sequence by using a Sanger method so as to identify the accuracy of an amplification product.
Wherein, the PCR amplification reaction system (20 μ L) comprises: 1-2. mu.L DNA template (80-150 ng), upstream and downstream primers 0.6. mu.L each, 10 × Easy Taq Buffer (Mg)2+free) 2. mu.L, dNTPs (2.5mM) 2. mu.L, Easy Taq polymerase (all-gold, AP111) 0.2. mu.L, ddH2Make up to 20. mu.L of O. PCR reaction procedure: pre-denaturation at 95 ℃ for 5min, annealing at 95 ℃ for 30s, (Tm-5) ℃ for 30s, extension at 72 ℃ (1min/kb), 35 cycles, and extension at 72 ℃ for 8 min.
Wherein, the DNA template is genome DNA extracted from seedling leaves of parents and groups by a CTAB method.
Agarose gel electrophoresis
The PCR amplification product is identified by 0.8-2% agarose gel. Preparing glue: weighing 0.8-2g of agarose powder, putting into a triangular flask containing 100mL of electrophoresis buffer solution 1 XTAE, and heating in a microwave oven until agarose is completely dissolved; after the temperature of the liquid is reduced to 50-60 ℃, slowly pouring the liquid into a rubber plate which is placed in a rubber groove and is inserted with a comb, and removing bubbles; after the gel is completely solidified, slowly and vertically pulling out the comb upwards, then gently taking out the gel making plate in which the gel is placed, placing the gel making plate and the gel making plate into an electrophoresis tank together, adding 1 XTAE electrophoresis buffer solution (adding 1/30 volumes of EB solution and then uniformly mixing) into the electrophoresis tank until the liquid level of the gel is over the gel. Electrophoresis: a sample of 6. mu.L of the PCR amplification product was sampled, and 1. mu.L of 6 XLoading Buffer (containing bromophenol blue indicator) was added thereto, mixed, and spotted. After the sample application, the voltage is adjusted to 120V, the current is adjusted to 400mA, the start of electrophoresis is confirmed after the electrophoresis is started (the electrode wire generates bubbles), and after about 30min of electrophoresis, the electrophoresis is observed in a gel imaging system and photographed for storage.
Non-denaturing polyacrylamide gel electrophoresis
mu.L of 10 × Loading Buffer was added to the PCR product, and after mixing well, 1.5. mu.L of the sample was taken and examined by Non-denaturing Polyacrylamide Gel Electrophoresis (Non-PAGE). Plate manufacturing: the flat plate and the concave plate glass are washed clean and vertically dried on a horizontal desktop, and are scrubbed by 70% ethanol, the plates are guaranteed to have no residual glue, the two plates are buckled together, the concave plate is arranged below the flat plate, a middle cavity is used for filling gel, and two sides are clamped by clamps, so that liquid leakage is avoided. Glue pouring: 30mL of the prepared gel at the early stage is prepared, added with 1% by volume of Ammonium Persulfate (APS) and 1 ‰ by volume of TMED, horizontally mixed and lightly poured between the two plates. Inserting a clean comb, wherein the comb teeth extend into the gel by about 1.0 cm; standing at normal temperature for 30min-1h, and observing at any time to prevent gel shrinkage cracking and deformation. And (3) upper plate: removing the clamp from the solidified gel, washing the gel (removing residual gel), and slightly pulling out the comb to ensure that the sample dispensing hole is complete and has no residual gel; the two plates are vertically placed and fixed on the electrophoresis tank by a clamp, and the buffer solution is ensured not to leak; 0.5 xTBE buffer solution is added into the upper electrophoresis tank and the lower electrophoresis tank respectively, so that the lower part of the electrophoresis tank is submerged in the clamping groove, and the upper part of the electrophoresis tank is submerged in the spot hole. Sample application: cleaning the sample application hole by using an injector, blowing impurities such as bubbles, broken glue and the like out of the sample application hole, injecting 1.0-1.5 mu L of a non-denatured PCR product added with a small amount of bromophenol blue indicator into the sample application hole by using a micropipette, and injecting D2000 DNA marker into the sample application hole at two ends of the sample application hole as a strip mark. Electrophoresis: and (3) operating at the voltage of 250V for 30-40 min, observing a bromophenol blue indicator strip at any time, wherein the glue running time is determined according to the strip size. Silver staining: and after electrophoresis is finished, taking down the electrophoresis tank clamp, detaching the gel plate, prying open the flat plate and the concave plate, taking out the gel, slowly putting the gel into the prepared 1% AgNO3 aqueous solution for silver dyeing, slightly shaking to ensure that the gel is completely contacted with the silver dyeing solution, taking out the gel after 3-5min, and washing the gel with deionized water for 30 seconds. And (3) developing: and (3) placing the gel in a developing solution (1L of deionized water, adding 1.5g of NaOH and 5-10 mL of formaldehyde, uniformly mixing), developing, observing at any time until strips on the gel are clear, transferring the gel into the deionized water, cleaning, finishing developing and washing away the developing solution. Sealing glue: cleaning the table top, spreading a preservative film, spraying a little clear water, flatly placing the developed gel on the preservative film, spraying a little clear water, sealing with the preservative film, filtering out excessive water and air in the preservative film with a plastic plate, and placing the preservative film in a fume hood in parallel for a period of time to remove formaldehyde.
Reading a tape: a is the band produced by wild type ZP661, B is the band produced by mutant ed1, and H is the heterozygous band produced in the progeny population.
The embodiments in the present description are described in a progressive manner, each embodiment focuses on differences from other embodiments, and the same and similar parts among the embodiments are referred to each other.
The previous description of the disclosed embodiments is provided to enable any person skilled in the art to make or use the present invention. Various modifications to these embodiments will be readily apparent to those skilled in the art, and the generic principles defined herein may be applied to other embodiments without departing from the spirit or scope of the invention. Thus, the present invention is not intended to be limited to the embodiments shown herein but is to be accorded the widest scope consistent with the principles and novel features disclosed herein.
Sequence listing
<110> institute of crop science of Chinese academy of agricultural sciences
<120> close linkage marker of genes related to control of soybean chloroplast development and application thereof
<160> 3
<170> SIPOSequenceListing 1.0
<210> 1
<211> 180
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<221> misc_feature
<222> (23)..(23)
<223> n can be C or T
<400> 1
agaagcttcg gttgactatc ganaaacaat gcaggagcaa tcagttgagc tgtttgatgg 60
tggtggagct gttcaaagtg aaccacaaaa ctccataaat tggaactctc ccaaagaagc 120
ttctgtcgat aatcaacagg caatacaggg gcagtcattt gagctcattg atagaagtga 180
<210> 2
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
agaagcttcg gttgactatc ga 22
<210> 3
<211> 18
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
tcacttctat caatgagc 18
Claims (5)
1. A close linkage marker of a gene related to the control of soybean chloroplast development is characterized in that the marker is SNP-1319 positioned on chromosome 19; the nucleotide sequence of the SNP-1319 is shown as SEQ ID NO. 1.
2. The application of the close linkage marker for controlling soybean chloroplast development related genes in identifying soybean plant yellowing death is characterized in that if the 23 rd bp of the nucleotide sequence SEQ ID NO.1 is mutated from C to T, an obvious yellowing phenotype is shown from seedling emergence, the yellowing phenotype is obvious when true leaves grow and are completely unfolded, and the true leaves, the young buds, the cotyledons and the hypocotyls are all shown to be yellowing; after the VC period, the plants begin to gradually show a lethal phenotype of shriveling withering, and the plants are withered and lethal in the V1 period.
3. The pair of amplification primers for controlling a closely linked marker of a soybean chloroplast development associated gene of claim 1, wherein:
the PCR amplification upstream primer sequence of the SNP-1319 is 5'-AGAAGCTTCGGTTGACTATCGA-3', and is shown as SEQ ID NO. 2;
the sequence of the PCR amplification downstream primer of the SNP-1319 is 5'-TCACTTCTATCAATGAGC-3', and is shown as SEQ ID NO. 3.
4. The linked marker of claim 1 or the primer pair of claim 3 for use in soybean breeding.
5. The use of the primer pair of claim 3 in the preparation of a kit for detecting genes involved in the control of soybean chloroplast development.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110777328.4A CN113355447A (en) | 2021-07-09 | 2021-07-09 | Gene closely linked marker for controlling soybean chloroplast development and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110777328.4A CN113355447A (en) | 2021-07-09 | 2021-07-09 | Gene closely linked marker for controlling soybean chloroplast development and application thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN113355447A true CN113355447A (en) | 2021-09-07 |
Family
ID=77538787
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202110777328.4A Pending CN113355447A (en) | 2021-07-09 | 2021-07-09 | Gene closely linked marker for controlling soybean chloroplast development and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN113355447A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114381544A (en) * | 2022-01-12 | 2022-04-22 | 中国农业科学院郑州果树研究所 | Watermelon leaf etiolation lethal major gene, dCAPS molecular marker for identifying major gene and application |
| CN117568502A (en) * | 2022-12-12 | 2024-02-20 | 江西农业大学 | Primer pair for screening rape aluminum toxin sensitive varieties and application and method thereof |
Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20070094744A1 (en) * | 2004-02-23 | 2007-04-26 | Nam-Chon Paek | A novel stay-green gene and method for preparing stay-green transgenic plants |
| CN105925587A (en) * | 2016-06-13 | 2016-09-07 | 上海师范大学 | Early rice chloroplast development gene affected by low temperature response and detection method and application thereof |
| CN106957897A (en) * | 2016-01-12 | 2017-07-18 | 南京农业大学 | The molecule labelling method of cucumber young yellow gene |
| CN107058519A (en) * | 2017-03-15 | 2017-08-18 | 中国农业科学院作物科学研究所 | Molecular labeling CAPs1516 and its application with Soybean Resistance epidemic disease gene close linkage |
| CN107868847A (en) * | 2017-12-28 | 2018-04-03 | 河南农业大学 | With the molecular labeling of the yellowish green leaf color gene ygl close linkages of muskmelon |
| CN111676308A (en) * | 2020-06-01 | 2020-09-18 | 中国农业科学院作物科学研究所 | QTL (quantitative trait locus) and SNP (Single nucleotide polymorphism) marker related to quantitative traits of soybean branches and application |
-
2021
- 2021-07-09 CN CN202110777328.4A patent/CN113355447A/en active Pending
Patent Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20070094744A1 (en) * | 2004-02-23 | 2007-04-26 | Nam-Chon Paek | A novel stay-green gene and method for preparing stay-green transgenic plants |
| CN106957897A (en) * | 2016-01-12 | 2017-07-18 | 南京农业大学 | The molecule labelling method of cucumber young yellow gene |
| CN105925587A (en) * | 2016-06-13 | 2016-09-07 | 上海师范大学 | Early rice chloroplast development gene affected by low temperature response and detection method and application thereof |
| CN107058519A (en) * | 2017-03-15 | 2017-08-18 | 中国农业科学院作物科学研究所 | Molecular labeling CAPs1516 and its application with Soybean Resistance epidemic disease gene close linkage |
| CN107868847A (en) * | 2017-12-28 | 2018-04-03 | 河南农业大学 | With the molecular labeling of the yellowish green leaf color gene ygl close linkages of muskmelon |
| CN111676308A (en) * | 2020-06-01 | 2020-09-18 | 中国农业科学院作物科学研究所 | QTL (quantitative trait locus) and SNP (Single nucleotide polymorphism) marker related to quantitative traits of soybean branches and application |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114381544A (en) * | 2022-01-12 | 2022-04-22 | 中国农业科学院郑州果树研究所 | Watermelon leaf etiolation lethal major gene, dCAPS molecular marker for identifying major gene and application |
| CN114381544B (en) * | 2022-01-12 | 2023-12-01 | 中国农业科学院郑州果树研究所 | Watermelon leaf yellowing lethal major gene, dCAPS molecular marker for identifying major gene and application |
| CN117568502A (en) * | 2022-12-12 | 2024-02-20 | 江西农业大学 | Primer pair for screening rape aluminum toxin sensitive varieties and application and method thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US11791017B2 (en) | Soybean anti-pod-shattering major QTLqPD05, and mapping method and application thereof | |
| WO2017092110A1 (en) | Sesamum indicum inflorescence definite gene sidt1 and snp marker thereof | |
| EP3561079A1 (en) | Soybean anti-pod-shattering major qtlqpd08-1, and mapping method and application thereof | |
| CN113355447A (en) | Gene closely linked marker for controlling soybean chloroplast development and application thereof | |
| CN112266973B (en) | SNP molecular marker related to wheat ear germination resistance and application thereof | |
| CN106591429B (en) | Method for screening sex reversal genetic control sites of cynoglossus semilaevis, kit and application | |
| CN112961231A (en) | Male sterile gene ZmbHLH122 and application thereof in creating male sterile line of corn | |
| CN112322769B (en) | SNP molecular marker related to cucumber multi-epidermal hair traits and application thereof | |
| CN112899247B (en) | Male sterile gene ZmTKPR1 and application thereof in creating male sterile line of corn | |
| CN112176091B (en) | CAPS molecular marker closely linked with eggplant sepal color character gene and preparation method thereof | |
| CN112680459B (en) | Male sterile gene ZmTGA10 and application thereof in creating male sterile line of corn | |
| CN115948600B (en) | Grape powdery mildew resistance dCAPS molecular marker and application thereof | |
| CN108004236B (en) | Corn stalk rot disease-resistant molecular breeding method and application thereof | |
| CN111676308A (en) | QTL (quantitative trait locus) and SNP (Single nucleotide polymorphism) marker related to quantitative traits of soybean branches and application | |
| CN111088390A (en) | SNP molecular marker related to upland cotton leaf villi and application thereof | |
| CN110004248B (en) | Sesame internode length gene Sidwf1 and SNP marker thereof | |
| CN113604587B (en) | Molecular marker T5198 for rapidly identifying low-temperature tolerant variety of penaeus japonicus and application thereof | |
| CN113502346A (en) | Marker for controlling close linkage of soybean leaf color related genes and application | |
| CN112680458B (en) | Male sterile gene ZmMYB33 and application thereof in creating male sterile line of corn | |
| CN110791511B (en) | Hypoxia-resistant megalobrama amblycephala growth character gene and positioning method and application thereof | |
| CN117487931B (en) | Sillago sihama hypoxia tolerance character related SNP molecular marker and application thereof | |
| CN117247967B (en) | Male sterile gene ZmPKSA and application thereof in creating maize male sterile line | |
| CN114736979B (en) | Molecular marker closely linked with watermelon complete leaf shape gene ClLL and application thereof | |
| CN114410804B (en) | A pair of detection primers for microsatellite markers related to low temperature resistance of tilapia mossambica | |
| CN114134155B (en) | MLO gene mutant and preparation method and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| AD01 | Patent right deemed abandoned |
Effective date of abandoning: 20221111 |
|
| AD01 | Patent right deemed abandoned |