CN113502271B

CN113502271B - Mesenchymal stem cells for treating inflammatory bowel disease and application thereof

Info

Publication number: CN113502271B
Application number: CN202110820531.5A
Authority: CN
Inventors: 颜孙兴; 熊敏敏; 苏建华
Original assignee: Guangzhou Saijun Biological Technology Co ltd
Current assignee: Guangzhou Saijun Biological Technology Co ltd
Priority date: 2021-07-20
Filing date: 2021-07-20
Publication date: 2023-08-11
Anticipated expiration: 2041-07-20
Also published as: CN113502271A

Abstract

The application discloses a mesenchymal stem cell for treating inflammatory bowel disease and application thereof. The mesenchymal stem cells for treating inflammatory bowel diseases are prepared by transfecting the mesenchymal stem cells with a nucleic acid of a chemokine receptor CCR9. The mesenchymal stem cells for treating inflammatory bowel disease can specifically target the lesion part of inflammatory bowel disease, have strong homing capacity, greatly improve the number of homing of the mesenchymal stem cells to the lesion part and improve the treatment effect of inflammatory bowel disease; provides a new individuation and accurate treatment scheme and thought for the treatment of inflammatory bowel disease.

Description

Mesenchymal stem cells for treating inflammatory bowel disease and application thereof

Technical Field

The application relates to the field of medicines for treating inflammatory bowel diseases, in particular to mesenchymal stem cells for treating inflammatory bowel diseases and application thereof.

Background

Inflammatory bowel disease (inflammatory bowel disease, IBD) is a chronic, incurable global disease, with higher morbidity in more developed economic areas, and is expected to be more than 150 ten thousand IBD patients within 10 years of our country. Patients mainly show pain and diarrhea which are easy to relapse, even form fistulae, have great healing difficulty and seriously affect the work and life of the patients. The etiology and pathogenesis of inflammatory bowel disease have not been fully elucidated so far, and abnormal immune response is an important feature of such diseases. Studies have shown that among four broad classes of chemokines, the CC Chemokine Receptor (CCR) has an important role in IBD; of the 19 CCR's currently found, 10 are all associated with IBD, including CCR1 through CCR10.

The mesenchymal stem cells are the most clinically used pluripotent stem cells at present, have all the commonalities of stem cells, and can self-renew and multi-directionally differentiate. The mesenchymal stem cells have various biological effects such as immunoregulation, loss repair and the like, have good application prospects in various diseases, but have poor treatment effects on part of diseases due to reduced homing capacity caused by the change of characters in an in-vitro culture process, so that the application of the mesenchymal stem cells in clinical aspects is limited. The targeting homing of stem cells to lesion tissues is less, and poor therapeutic targeting is a worldwide problem restricting the clinical transformation of stem cells. Mesenchymal stem cell homing is a complex cascade of processes from mesenchymal stem cell activation to specific chemotactic adhesion to the site of tissue injury and migration to injury, involving interactions between multiple chemokines and receptors. To achieve efficient and targeted enrichment of stem cells in diseased tissue, it is critical to find disease individual chemokines and corresponding chemokine receptors with high sensitivity and high specificity.

At present, how to realize the efficient and targeted treatment of inflammatory bowel disease by utilizing the mesenchymal stem cells has not been studied and reported.

Disclosure of Invention

The application aims to provide a novel mesenchymal stem cell for treating inflammatory bowel disease and application thereof.

The application adopts the following technical scheme:

in one aspect, the application discloses a mesenchymal stem cell for treating inflammatory bowel disease, the mesenchymal stem cell is transfected by a nucleic acid of a chemokine receptor CCR9 into the mesenchymal stem cell.

By transfecting the corresponding nucleic acid of the inflammatory bowel disease chemokine receptor CCR9 in the mesenchymal stem cells, the prepared targeting mesenchymal stem cells have good targeting specificity and better targeting homing capacity of lesion tissues, and can realize efficient and targeted enrichment of the mesenchymal stem cells in the lesion tissues, thereby greatly improving the treatment effect of inflammatory bowel diseases. In one implementation of the application, the number of targeted mesenchymal stem cells homing to the lesion site is increased by about 3-fold.

Preferably, the nucleic acid of chemokine receptor CCR9 is the sequence shown in Seq ID No. 1.

Preferably, the mesenchymal stem cells are derived from bone marrow, adipose tissue, dental pulp, umbilical cord blood, amniotic fluid or placenta. More preferably, the mesenchymal stem cells are derived from bone marrow.

Preferably, the transfection is electroporation transfection.

The application also discloses a preparation method of the target mesenchymal stem cell, which comprises the steps of obtaining CCR9 nucleic acid, and transfecting the CCR9 nucleic acid into the mesenchymal stem cell by an electroporation transfection method, wherein the CCR9 nucleic acid is a sequence shown as a Seq ID No. 1.

The application further discloses application of the targeted mesenchymal stem cells in preparation of medicines for treating inflammatory bowel diseases.

In a further aspect, the application discloses a medicament for treating inflammatory bowel disease, which comprises the mesenchymal stem cells of the application.

Preferably, the medicament of the application also contains T cells or immune cells which do not affect the function of the targeted mesenchymal stem cells or can cooperate with the targeted mesenchymal stem cells.

It should be noted that, the existing studies show that some specially modified T cells or immune cells have the same therapeutic effect on inflammatory bowel disease; it will be appreciated that as long as these T cells or immune cells do not have an adverse effect on the mesenchymal stem cells of the present application; in some special use cases, the mesenchymal stem cells can be matched with the mesenchymal stem cells to prepare inflammatory bowel disease medicines or other multifunctional medicines.

Preferably, the medicament of the present application is in a pharmaceutically acceptable dosage form, including but not limited to powders, solvents, tablets or capsules.

It will be appreciated that the drug of the present application, which is critical to the specific targeting of mesenchymal stem cells of the present application, may be used in reference to existing drug dosage forms depending on the use.

Preferably, the medicament also contains pharmaceutically acceptable auxiliary materials.

It is understood that the medicine may contain some supplementary material in addition to the main active component to prepare corresponding preparation or assist the active component; the specific adjuvant type is not particularly limited herein, depending on the production or use requirements.

The application has the beneficial effects that:

the mesenchymal stem cells for treating inflammatory bowel disease can specifically target the lesion part of inflammatory bowel disease, have strong homing capacity, greatly improve the number of homing of the mesenchymal stem cells to the lesion part and improve the treatment effect of inflammatory bowel disease; provides a new individuation and accurate treatment scheme and thought for the treatment of inflammatory bowel disease.

Drawings

FIG. 1 is a graph showing the results of expression of CCR9 by MSC-CCR9 and MSC-EGFP in the examples of the present application;

FIG. 2 is a graph showing mRNA of the right ear after sensitization according to an embodiment of the present application with time;

FIG. 3 is a graph showing the degree of edema of the right ear after sensitization according to an embodiment of the present application over time;

FIG. 4 is a diagram of the modeling and treatment modes of CHS mice in accordance with an embodiment of the present application;

FIG. 5 is a plot of ear edema levels in mice treated according to an embodiment of the present application;

FIG. 6 is a graph showing the results of staining of sections of the CHS+MSC-EGFP group in the examples of the present application;

FIG. 7 shows the results of staining the sections of the CHS+MSC-CCR9 group in the examples of the present application;

FIG. 8 is a graph showing MPO activity in an example of the present application;

FIG. 9 shows the infiltration of inflammatory factor TNFα by ELISA assay in examples of the present application;

FIG. 10 shows the infiltration of the inflammatory factor IFNγ by ELISA in the examples of the present application.

Detailed Description

The application will now be described in more detail with reference to the accompanying drawings by means of specific embodiments. The following examples are given for the purpose of illustration only and are not to be construed as limiting the application.

Example 1

1. Chemokine research

In the example, inflammatory bowel disease is taken as a study object, a blood sample is collected, DNA is extracted, and a chemokine receptor CCR9 of inflammatory bowel disease patients is sequenced; meanwhile, adopting a tissue specimen of a normal person as a control; the changes of CCR9 in inflammatory bowel disease were analyzed in comparison. Based on the effect of CCR9 on inflammatory bowel disease, the corresponding transfected nucleic acids were constructed. The details are as follows:

1. sample collection

Fresh peripheral blood of volunteers was taken at 20mL, diluted 1:1 with 1 XPBS, separated by density gradient centrifugation using Ficoll-Paque lymphatic isolate, and all buffy coat mononuclear cells were collected and diluted 1:4 with sterile PBS. Centrifuge at 2000rpm for 10min and discard supernatant. The mixture was washed twice with sufficient PBS. The cells were suspended in RPMI-1640 complete medium to obtain human Peripheral Blood Mononuclear Cells (PBMC).

2. Nucleic acid extraction

In the method, RNA of peripheral blood mononuclear cells is extracted by adopting a Trizol method, specifically, 1mL of Trizol solution is added into the obtained human Peripheral Blood Mononuclear Cells (PBMC), and the mixture is blown and evenly mixed to fully lyse the cells and stand for 5min; adding 200 mu L of chloroform, shaking vigorously, mixing for 20s, enabling the water phase and the organic phase to be in full contact, and standing at room temperature for 15min; centrifugation at 12000g for 15min at 4deg.C, visible as a three-layer separation, RNA in the upper aqueous phase, was carefully transferred to another new RNase free EP tube; adding 0.5mL of isopropanol, gently and fully mixing, standing at room temperature for 10min, and precipitating RNA; centrifuging 12000g for 10min at 4deg.C, collecting RNA precipitate, and removing supernatant; washing the tube wall twice with 75% ethanol, and air-drying in an ultra clean bench; the precipitate was dissolved by adding 50. Mu.L of DEPC water, and the concentration was measured by a Nanodrop ultra-micro spectrophotometer.

3. Nucleic acid sequencing

(1) Reverse transcription

Firstly, removing genome DNA of RNA extracted by a Trizol method, and then, carrying out reverse transcription to obtain first-strand cDNA, wherein the first-strand cDNA is specifically as follows:

1. Mu.g of extracted RNA, 1. Mu.L of DNase I, buffer DNase I with MgCl ₂ 1 μl, DEPC water was supplemented to 10 μl, incubated at 37deg.C30min; then EDTA 1. Mu.L is added and incubated for 10min at 65 ℃; then adding 1 mu L of Oligo (dT) and incubating for 10min at 65 ℃; finally, 5 Xreaction Buffer 5 mu L, RNase-Ribonuclease Inhibitor mu L, 10mM dNTP Mix 2 mu L, M-MLV RT 1 mu L, RNase Free Water to 25 mu L and incubation at 42 ℃ for 60min are added to obtain cDNA.

(2) PCR reaction and recovery of CCR9cDNA fragment

And (3) PCR reaction: 2 XSar mix 10. Mu. L, DEPC water 7. Mu.L, upstream primer 1. Mu.L, downstream primer 1. Mu. L, cDNA 1. Mu.L, 20. Mu.L overall. Wherein 2×Star mix is a conventional PCR amplification reaction buffer system, and comprises Taq DNA Polymerase, dNTPs, mgCl, and the like.

The PCR reaction conditions were 95℃for 10min, followed by 40 cycles: 95 ℃ for 15s, 60 ℃ for 30s and 72 ℃ for 30s; after the cycle is completed, the temperature is 72 ℃ for 10min, and the standby is 4 ℃.

Wherein the upstream primer is the sequence shown by the Seq ID No.2, and the downstream primer is the sequence shown by the Seq ID No. 3.

Seq ID No.2：5’-atggctgatgactatggctctg-3’

Seq ID No.3：5’-tcagagggagagtgctcctga-3’

After the PCR amplification is finished, detecting a PCR amplification product by agarose gel electrophoresis, and performing gel cutting recovery on the PCR amplification product by using an agarose gel DNA recovery kit. Agarose gel electrophoresis showed that the PCR amplification product contained an amplification product of approximately 1074bp in size, consistent with the expected CCR9 fragment size.

And (3) cutting and recycling: the target fragment band is cut by a sharp scalpel, and the PCR amplification product, namely the CCR9 fragment, is recovered by cutting gel by using an agarose gel DNA recovery kit.

(3) TA cloning and transformation:

the TA cloning system comprises: the PCR amplification product of pMD19-T vector 1 mu L, CCR9 4 mu L and Solution I5 mu L, total 10 mu L reaction system, and react at 16 deg.C for 2h to obtain the cloning plasmid.

Conversion: taking out competent cells DH5 alpha at-80 ℃ and dissolving on ice for 5min; adding 5 mu L of cloning plasmid into 30 mu L of competent cells DH5 alpha, flicking, and placing on ice for 30min; heat-shocking at 42 deg.C for 45s-1min, immediately placing on ice for 2min; LB 600. Mu.L incubated at 37℃was added and incubated on a shaker at 37℃and 1500rpm for 1h; centrifuging at 3500rpm for 4-5min, discarding supernatant, resuspending 100 μl of culture broth, or obtaining a transformant, and then plating 100 μl of the transformant onto a pre-heated LB plate containing 50 μg/mL Amp, and incubating overnight at 37deg.C; 3-5 colonies were picked for PCR detection and sequencing.

The primer and reaction system and reaction conditions adopted in the PCR detection are the same as those of "(2) PCR reaction and recovery of CCR9cDNA fragment". In this example, 4 colonies were specifically picked for PCR detection. The results showed that 4 colonies all amplified a CCR9 fragment of approximately 1074bp, which was consistent with expectations.

The 4 colonies were inoculated into 500. Mu.L of LB medium, incubated overnight at 37℃on a shaker at 1500rpm, and the bacterial solutions were then sent to Shanghai Bioengineering Co.Ltd for sequencing.

Sequencing results show that 1074bp CCR9 fragment is obtained by PCR amplification in the embodiment, and the specific sequence is shown as the sequence ID No. 1.

Seq ID No.1：

atggctgatgactatggctctgaatccacatcttccatggaagactacgttaacttcaacttcactgacttctactgtgagaaaaacaatgtcaggcagtttgcgagccatttcctcccacccttgtactggctcgtgttcatcgtgggtgccttgggcaacagtcttgttatccttgtctactggtactgcacaagagtgaagaccatgaccgacatgttccttttgaatttggcaattgctgacctcctctttcttgtcactcttcccttctgggccattgctgctgctgaccagtggaagttccagaccttcatgtgcaaggtggtcaacagcatgtacaagatgaacttctacagctgtgtgttgctgatcatgtgcatcagcgtggacaggtacattgccattgcccaggccatgagagcacatacttggagggagaaaaggcttttgtacagcaaaatggtttgctttaccatctgggtattggcagctgctctctgcatcccagaaatcttatacagccaaatcaaggaggaatccggcattgctatctgcaccatggtttaccctagcgatgagagcaccaaactgaagtcagctgtcttgaccctgaaggtcattctggggttcttccttcccttcgtggtcatggcttgctgctataccatcatcattcacaccctgatacaagccaagaagtcttccaagcacaaagccctaaaagtgaccatcactgtcctgaccgtctttgtcttgtctcagtttccctacaactgcattttgttggtgcagaccattgacgcctatgccatgttcatctccaactgtgccgtttccaccaacattgacatctgcttccaggtcacccagaccatcgccttcttccacagttgcctgaaccctgttctctatgtttttgtgggtgagagattccgccgggatctcgtgaaaaccctgaagaacttgggttgcatcagccaggcccagtgggtttcatttacaaggagagagggaagcttgaagctgtcgtctatgttgctggagacaacctcaggagcactctccctctga。

2. Mesenchymal stem cell preparation

1. Sample collection

Healthy adults are selected, informed consent is signed after the physical examination is qualified according to the national blood donation standard, bone marrow is extracted by a clinician, and the bone marrow is transported to a laboratory for separation culture.

In this example, 20mL of bone marrow from healthy volunteers was diluted 1:1 with 1 XPBS, single nucleated cells were isolated from the bone marrow by density gradient centrifugation using Ficoll-Paque lymphatic separator at 2000rpm for 30min, and the collected single nucleated cells were collected 1×10 ⁵ Individual/cm ² Density inoculation to 75cm ² The flask was used for culturing. L-DMEM medium was used at 37℃with 5% CO ₂ After 3 days of culture under the condition, the suspension cells are removed, and the culture is continued by changing the liquid. After cells had grown to 80% density, the medium was aspirated, washed 2 times with PBS, digested with 0.125% pancreatin for 1-2min at a passaging ratio of 1:3. Mesenchymal stem cells are isolated from bone marrow donated by healthy donors, and the isolation, expansion, cryopreservation, resuscitation and the like of clinical MSCs are performed under the condition of meeting GMP (good manufacturing practice) standard. The growth and morphological characteristics of primary and passaged cells were observed daily under an inverted microscope and film recordings were made.

2. Mesenchymal stem cell biological evaluation

Taking in vitro cultured mesenchymal stem cells, digesting into single cell suspension, and adding 0.1% BSA and 0.05% NaN ₃ Is washed once, the supernatant is discarded, and the cell density is adjusted to 10 ⁶ Marking mesenchymal stem cells by using flow antibody CD29, CD34, CD44, CD45, CD73, CD90, CD105 and CD166 in a flow tube, fully shaking and uniformly mixing, incubating at 4 ℃ for 30min under dark conditions, and then using a kit containing 0.1% BSA and 0.05% NaN ₃ Washing twice to remove excess antibody; the supernatant was discarded, and the mesenchymal stem cell phenotype CD29 was flow-tested by resuspension of cells with 200. Mu.L of 1% PFA ⁺ 、CD34 ^- 、CD44 ⁺ 、CD45 ^- 、CD73 ⁺ 、CD90 ⁺ 、CD105 ⁺ 、CD166 ⁺ Proved by in vitro culture of mesenchymalThe stem cell phenotype has no effect.

The P2 generation cells are transferred to a six-hole plate and are grown to about 60 percent for standby.

3. Preparation of specific targeting mesenchymal stem cells

The prepared modified mRNA is introduced into mesenchymal stem cells by electroporation technology to obtain the specific targeting mesenchymal stem cells of the example, and the prepared specific targeting mesenchymal stem cells are subjected to functional evaluation, which is detailed as follows:

DNA transfection

Inoculating the artificially cultured mesenchymal stem cells to 75cm ² In a culture flask, 37 ℃ and 5% CO ₂ Culturing for 3 days under the condition; centrifuge at 2000rpm for 30min at 4℃and discard the supernatant. With 0.1% BSA and 0.05% NaN ₃ Is washed once at pH7.4 and the supernatant is discarded. The cells were washed once with 5mL of electroporation buffer and the mesenchymal stem cells were made to a density of 1 x 10 with electroporation buffer ⁶ Each/0.8 mL of cell suspension. All 0.8mL of cells were transferred to a pre-chilled electroporation cuvette, 5. Mu.g of PCR amplification product was added, and a water blank was set. The DNA and cell suspension were mixed and incubated on ice for 10min. The cell suspension was then bombarded at 400V/500. Mu.F and the time recorded. After completion, the electroporation cuvette was taken out and left on ice for 10min. Transferring bombarded cells into a new centrifuge tube containing a culture medium, flushing an electroporation cuvette with a small amount of the culture medium, and collecting the cells into the centrifuge tube; centrifuge at 2000rpm for 30min at 4℃and discard the supernatant. Cells were suspended with 20mL of culture and transferred to 75cm ² In a culture flask, 37 ℃ and 5% CO ₂ Culturing for 3 days under the condition, and centrifuging to collect cells.

2. Transfection assay

The cultured transgenic mesenchymal stem cells are subjected to sorting purification by a flow cytometer, and RNA extraction, reverse transcription and PCR amplification detection are the same as those of the '2. Nucleic acid extraction' and the '3. Nucleic acid sequencing'.

RNA was also extracted by Trizol method, and primers for "(2) PCR reaction and recovery of CCR9cDNA fragment" were used.

The PCR amplification products are detected by agarose gel electrophoresis, and the result shows that all the cultured transgenic mesenchymal stem cells can be amplified to obtain a CCR9 gene fragment of about 1074bp, which accords with the expectation.

Western Blot detection of protein levels of CCR9 expressed by transfected MSC

(1) Protein extraction

The cultured MSC which over expresses CCR9 is marked as MSC-CCR9, and the control group MSC without transfection is marked as MSC-EGFP, the MSC is placed on ice, the culture solution is removed, the PBS is used for washing twice, 1 XSDS loading buffer solution containing 5% DTT is added, and the cells are fully lysed by being blown back and forth rapidly by a 1mL pipetting gun. After blowing, sucking the liquid, putting the liquid into a 1.5mL Eppendorf centrifuge tube, and carrying out ultrasonic crushing for 3 times at 4 ℃ for 1 second each time; boiling at 100deg.C for 5min, cooling at 4deg.C, centrifuging at 15000g at 4deg.C for 5min, and preparing for electrophoresis or preserving at-80deg.C.

Wherein the loading buffer comprises 62.5mM Tris-HCl pH6.8, 2% (w/v) SDS, 10% glycol, 50mM DTT and 0.1% (w/v) bromophenol blue.

(2) Electrophoretic separation

In this example, a denaturing polyacrylamide gel (denatured polyacrylamide gel, abbreviated SDS-PAGE) was used for electrophoretic separation, specifically, 4.1mL of separation gel was added, the gel was sealed with deionized water, after an apparent interface had occurred, the water seal was decanted, and the formulated gel concentrate was added to the top of the short glass block. Inserting comb, when the irregular shape of the glue surface appears, it shows that the glue is well polymerized, and can be pulled out and loaded.

In order, 15. Mu.L of the sample boiled at 100℃for 5 minutes was added to each lane, and the mixture was electrophoresed in SDS running buffer at a constant pressure of 120V for about 45 minutes.

(3) Transfer film

During electrophoresis, materials required by transfer membrane, such as sponge, filter paper, PVDF membrane and the like, are soaked in transfer membrane buffer solution by adopting the PVDF membrane. After electrophoresis, the gel was removed and the upper gel concentrate was removed. The gel was equilibrated in the transfer solution for 15-30 minutes to remove SDS attached to the gel surface. Then the membrane transferring interlayer box is arranged, and the materials are arranged from the negative electrode to the positive electrode according to the sponge, the filter paper, the gel, the PVDF membrane and the filterThe sandwich box of the sequential device of paper and sponge is placed in a transfer groove after being fixed, and the PVDF film faces to the positive electrode direction. The sandwich box and the ice box are placed in a transfer tank, 600mL of transfer buffer solution is injected, and the constant current is 200mA ² Hours.

Wherein the transfer buffer comprises 25mM Tris base, 0.2M glycine and 20% methanol pH8.5.

(4) Antigen-antibody reaction

After the transfer was completed, the PVDF membrane was removed and washed in 25mL of TBS containing 50mM Tris-HCl pH7.4 and 150mM NaCl for 10 minutes. Then, the mixture was transferred to a 20mL blocking solution, and the mixture was blocked by shaking at room temperature for 1 hour, and a corresponding primary anti-dilution solution diluted with 5% (w/v) skimmed milk was added. Gently shake overnight at 4 ℃. Wherein the blocking solution is 1 XTBST containing 5% skimmed milk, and TBST is TBS containing 0.05% Tween-20.

The next day the membranes were washed 3 times with 1 XTBE for 5 minutes each, then 15mL of horseradish peroxidase (horseradish peroxidase, HRP) -labeled secondary antibody (1:2000) diluted with blocking solution was added and shaken at room temperature for 1 hour. Then, the film was washed 3 times with 1×tbst for 10 minutes each, developed and fixed in a dark room: preparing ECL kit A, B liquid into working solution, uniformly coating the working solution on the surface of PVDF film, incubating for 1 minute, removing reaction residual liquid on the surface of the film as much as possible, fixing the film in an X-ray light-sensitive box by using a plastic preservative film, putting an X-ray film for proper exposure, taking out the X-ray film, reacting in developing solution for 1 minute, rinsing the developed film in clear water for several times, reacting in fixing solution for 1 minute, washing with clear water, and airing.

As shown in FIG. 1, MSC-CCR9 expression protein, MSC-EGFP was not expressed, both of which expressed green fluorescent protein EGFP; the transgenic mesenchymal stem cells constructed in the example can effectively express CCR9.

Example two

The mice induced by DNFB are adopted for contact hypersensitivity reaction in the method to verify the treatment effect of the transgenic mesenchymal stem cells constructed in the embodiment I on inflammatory bowel diseases.

In this example, 6-8 week male BALB/c mice, 16-18g, were bred in SPF environment and used for modeling of contact hypersensitivity models.

DNFB pre-sensitization solution: preparing a mixed solution, namely, acetone: the volume ratio of olive oil is 4:1, and the olive oil is mixed by intense shaking;

preparing a pre-sensitization mixed solution: preparing DNFB mixed solution with the concentration of 0.5%, namely pre-sensitization mixed solution.

DNFB sensitization solution: preparing a DNFB mixed solution with the concentration of 0.2%, namely a sensitization mixed solution.

Pre-sensitization: on day 1, a 1.5X1.5 cm area was scraped off by an electric razor from the skin near the back of the mouse, and 20. Mu.L of a 0.5% DNFB pre-sensitized mixture was applied to the scraped skin, and the mice were routinely fed after treatment.

Sensitization: on day 5, the ears of the mice were smeared with 0.2% DNFB mixture, 10. Mu.L on both sides of the ears.

Animals were divided into 4 groups of 8 animals each, with 4 groups including a Control (Control), model (CHS), MSC EGFP-treated (chs+msc-EGFP), and MSC CCR 9-treated (chs+msc-CCR 9). Wherein CHS+MSC-CCR9 is the test group injected with the transgenic mesenchymal stem cells prepared in example I.

On day 2 after molding, the CHS+MSC EGFP group was intravenously injected with 1X 10 MSC-EGFP ⁶ Individual cells/mice; CHS+MSC-CCR9 group intravenous MSC-CCR9 with injection quantity of 1×10 ⁶ Individual cells/mice.

The ear thickness of the mice at days 1, 2, 3, 4, 5 after treatment was recorded and measured with a micrometer. The results show that, after sensitization, the sensitized right ear of mice was continuously raised in chemokine mRNA after inflammation occurred, as shown in fig. 2; at the same time, the ear thickness gradually increased, the edema degree increased, as shown in fig. 3, without a significant change in the corresponding left ear.

Day 4, as shown in fig. 4, the mice were treated with 20 μl of 0.5% DNFB pre-sensitization mixture applied to the back, day 0, day 2 after sensitization of the right ear, day 2, mice were also injected with MSCs intravenously at the tail:

CHS+MSC-EGFP group intravenous MSC EGFP,1×10 ⁶ Individual cells/individual;

CHS+MSC-CCR9 group intravenous MSC CCR9,1×10 ⁶ Individual cells/individual;

control group injected PBS.

The thicknesses of the ears of mice on days 1, 2, 3, 4 and 5 after treatment are recorded, the thickness of the outer edge of the ears is measured by a micrometer, and the average value is obtained by measuring three times at the same time by the same operator every day, so that the result shows that the thickness of the ears of the mice in the CHS+MSC-CCR9 group is the fastest, the treatment effect is the best, and the treatment effect of the CHS+MSC-EGFP group is between the CHS group and the CHS+MSC-CCR9 group as shown in figure 5.

Slicing, dyeing and observing the number of mouse ear MSCs, specifically, killing the mouse by neck breaking, taking the mouse ears of each experimental group, taking paraformaldehyde with the volume of 10 times of the ears for fixation for 6 hours, transferring to 30% sucrose for dehydration, standing overnight at 4 ℃, fixing OCT, slicing at-20 ℃ by a frozen slicer, and carrying out 7 mu m; immunofluorescent staining: baking, 60 ℃,30 min, tearing off OCT, eluting with 0.01M PBS 5min x 3 times, starting the organized fraction with immunohistochemical stroke coil, dripping goat serum, blocking for 30min, adding primary antibody, incubating overnight at 4 ℃, standing at room temperature for 30min, eluting with 0.01M PBS 5min, eluting for 3 times, adding secondary antibody, 30min, eluting with 0.01M PBS 5min x 3 times, adding DAPI,10 min, eluting with 0.01M PBS 5min, eluting for 3 times, sealing.

The results of the section observations are shown in fig. 6 and 7, and the results show that the thickness of the ears of the MSC-CCR9 group after treatment is obviously lower than that of the ears of the MSC-EGFP group, more importantly, the quantity of the MSCs in the ears of the MSC-CCR9 group is obviously higher than that of the MSC-EGFP group, so that the MSC-CCR9 can migrate to the inflammation site in a targeted manner.

Infiltration of local inflammatory cells-Myeloperoxidase (MPO) assay, which is also known as peroxidase, is a heme-prosthetic heme protease, one of the heme peroxidase superfamily members. Myeloperoxidase is unique to neutrophils and is rarely or completely absent even in macrophages with strong phagocytosis. In cytochemistry, this myeloperoxidase is generally used as a marker for neutrophils, and the amount of enzyme contained in each cell is constant, about 5% of the dry weight of the cell, and the enzyme has the ability to reduce hydrogen peroxide, and by using this feature, the activity of the enzyme can be analyzed and the number of neutrophils can be quantitatively determined.

MPO detection: preparing samples to be detected, namely ears of each group of mice, weighing, taking corresponding reagents in the kit as a homogenizing medium, adding the homogenizing medium according to the weight-volume ratio of 1:19 to prepare tissue homogenate of 5%, and detecting the activity of MPO according to the steps of the kit. The results are shown in FIG. 8, which shows that the MPO activity was significantly lower in the CHS+MSC-CCR9 group than in the CHS+MSC-EGFP group and the CHS group. The infiltration of the neutrophils in the MSC-CCR9 group is obviously lower than that in the MSC-EGFP group, and the MSC-CCR9 can be proved to migrate to an inflammation part in a targeted manner, so that the immune function is exerted, and the inflammatory infiltration is reduced.

The secretion of local inflammatory factors is detected in this example, and is specifically as follows:

ELISA detection: 96-well ELISA plate, washing 2 times with 1X washing buffer, adding standard and sample to be tested, incubating for 2h at room temperature in a dark place, discarding liquid, washing 5 times with 1X washing buffer, adding detection antibody 100 μL/well, incubating for 1h at room temperature in a dark place, discarding liquid, washing 5 times with 1X washing buffer, removing excessive antibody, adding enzyme conjugate working solution 100 μL/well, incubating for 30min at room temperature in a dark place, discarding liquid, washing 5 times with 1X washing buffer, adding display substrate 50 μL/well, incubating for 20min at dark place, adding termination solution 50 μL/well, and detecting OD value of 450nm by enzyme-labeling instrument after mixing.

The results are shown in fig. 9 and 10, and the results show that local inflammatory factors TNFα and IFNγ in the CHS+MSC-CCR9 group are significantly lower than those in the CHS+MSC-EGFP group and the CHS group, so that the MSC-CCR9 can migrate to an inflammation site in a targeted manner, play an immune function and reduce inflammatory reaction.

The foregoing is a detailed description of the application in connection with the specific embodiments, and is not intended to limit the application to the specific embodiments described. It will be apparent to those skilled in the art that several simple deductions or substitutions may be made without departing from the basic inventive concept.

/>

SEQUENCE LISTING

<110> Guangzhou Sitting Biotech Co., ltd

<120> a mesenchymal stem cell for treating inflammatory bowel disease and use thereof

<130> 2021.07.20

<160> 3

<170> PatentIn version 3.3

<210> 1

<211> 1074

<212> DNA

<213> CCR9 Gene

<400> 1

atggctgatg actatggctc tgaatccaca tcttccatgg aagactacgt taacttcaac 60

ttcactgact tctactgtga gaaaaacaat gtcaggcagt ttgcgagcca tttcctccca 120

cccttgtact ggctcgtgtt catcgtgggt gccttgggca acagtcttgt tatccttgtc 180

tactggtact gcacaagagt gaagaccatg accgacatgt tccttttgaa tttggcaatt 240

gctgacctcc tctttcttgt cactcttccc ttctgggcca ttgctgctgc tgaccagtgg 300

aagttccaga ccttcatgtg caaggtggtc aacagcatgt acaagatgaa cttctacagc 360

tgtgtgttgc tgatcatgtg catcagcgtg gacaggtaca ttgccattgc ccaggccatg 420

agagcacata cttggaggga gaaaaggctt ttgtacagca aaatggtttg ctttaccatc 480

tgggtattgg cagctgctct ctgcatccca gaaatcttat acagccaaat caaggaggaa 540

tccggcattg ctatctgcac catggtttac cctagcgatg agagcaccaa actgaagtca 600

gctgtcttga ccctgaaggt cattctgggg ttcttccttc ccttcgtggt catggcttgc 660

tgctatacca tcatcattca caccctgata caagccaaga agtcttccaa gcacaaagcc 720

ctaaaagtga ccatcactgt cctgaccgtc tttgtcttgt ctcagtttcc ctacaactgc 780

attttgttgg tgcagaccat tgacgcctat gccatgttca tctccaactg tgccgtttcc 840

accaacattg acatctgctt ccaggtcacc cagaccatcg ccttcttcca cagttgcctg 900

aaccctgttc tctatgtttt tgtgggtgag agattccgcc gggatctcgt gaaaaccctg 960

aagaacttgg gttgcatcag ccaggcccag tgggtttcat ttacaaggag agagggaagc 1020

ttgaagctgt cgtctatgtt gctggagaca acctcaggag cactctccct ctga 1074

<210> 2

<211> 22

<212> DNA

<213> artificial sequence

<400> 2

atggctgatg actatggctc tg 22

<210> 3

<211> 21

<212> DNA

<213> artificial sequence

<400> 3

tcagagggag agtgctcctg a 21

Claims

1. A mesenchymal stem cell for use in the treatment of inflammatory bowel disease, characterized in that: the mesenchymal stem cells are formed by transfecting nucleic acid of a chemokine receptor CCR9 into the mesenchymal stem cells;

the nucleotide sequence of the chemokine receptor CCR9 is shown in Seq ID No. 1.

2. The mesenchymal stem cell of claim 1, wherein: the mesenchymal stem cells are derived from bone marrow, adipose tissue, dental pulp, umbilical cord blood, amniotic fluid or placenta.

3. The mesenchymal stem cell of claim 2, wherein: the mesenchymal stem cells are derived from bone marrow.

4. The mesenchymal stem cell of claim 1, wherein: the transfection is electroporation transfection.

5. The method for preparing mesenchymal stem cells according to any one of claims 1 to 4, wherein: comprising obtaining a CCR9 nucleic acid and transfecting the CCR9 nucleic acid into a mesenchymal stem cell by an electroporation transfection method, wherein the nucleotide sequence of CCR9 is as shown in Seq ID No. 1.

6. Use of the mesenchymal stem cells according to any one of claims 1-4 in the manufacture of a medicament for treating inflammatory bowel disease.

7. A medicament for treating inflammatory bowel disease, characterized in that: the medicine contains the mesenchymal stem cells of any one of claims 1-4.

8. A medicament according to claim 7, characterized in that: the medicine also contains T cells or immune cells which do not affect the functions of the mesenchymal stem cells or can cooperate with the mesenchymal stem cells.

9. A medicament according to claim 7 or 8, characterized in that: the medicament is in a pharmaceutically acceptable dosage form, including but not limited to powder, solvent, tablet or capsule.

10. A medicament according to claim 7 or 8, characterized in that: the medicine also contains pharmaceutically acceptable auxiliary materials.