CN113499439B - Application of tubercle bacillus UreC protein in preparation of anti-mycobacterium tuberculosis drugs - Google Patents

Abstract

The invention provides application of tubercle bacillus UreC protein in preparation of anti-mycobacterium tuberculosis medicines and medicines for treating tuberculosis, and particularly relates to a medicine for inhibiting enzyme activity function or expression of UreC protein by taking tubercle bacillus UreC protein as a target. Experiments verify that UreC is an important virulence factor of tubercle bacillus, determines the survival of tubercle bacillus in a host, and proves that the inhibition of UreC can improve the anti-tubercle immunity of the host, so that the effect of removing tubercle bacillus is achieved, and a new target and direction are provided for developing anti-tubercle mycobacterium and drugs for treating tuberculosis.

Description

Application of tubercle bacillus UreC protein in preparation of anti-mycobacterium tuberculosis drugs

Technical Field

The invention relates to the field of biological medicines, in particular to application of tubercle bacillus UreC protein in preparation of anti-mycobacterium tuberculosis medicines.

Background

Tuberculosis caused by mycobacterium tuberculosis infection is one of the world problems to date. In World Health Organization (WHO) worldwide tuberculosis report, 140 million people died of tuberculosis in 2019 worldwide. Tuberculosis is one of ten causes of death in the world and is the disease with the most number of dead people caused by single pathogen infection, and China is the second world with high tuberculosis burden. The main reasons that tuberculosis cannot be effectively controlled are that the protective effect of the existing tuberculosis vaccine-BCG is limited and the drug-resistant tuberculosis is increased day by day, and the research of the tuberculosis mechanism can provide an effective target for the development of new vaccines and new drugs. In the initial stage of mycobacterium tuberculosis infection host, natural immune cells such as macrophages and the like can activate downstream cascade signals after recognizing mycobacterium tuberculosis, and various natural immune reactions can be started to resist mycobacterium tuberculosis infection. However, tubercle bacillus has a variety of immune evasion strategies, and one of the most important mechanisms is that tubercle bacillus passes through a hydrophobic and extremely low permeability bacterial wall structure through a secretion system to reach a host cell phagocyte or even cytoplasm, so as to directly regulate and control the anti-tubercle immune response of the host.

At present, the action mechanism of all clinical antituberculosis drugs is a key link which is crucial to the in vitro growth of tubercle bacillus, such as a targeted tubercle bacillus respiratory chain, and the like, so that the direct killing effect of the tubercle bacillus is achieved. The antitubercular drugs in use are classified into 2 groups, which are the first line antitubercular drug and the second line antitubercular drug. First-line antituberculosis drugs: isoniazid, rifampicin, ethambutol, pyrazinamide, streptomycin. Second line antitubercular drugs: for aminosalicylic acid, ethionamide, capreomycin, rifampicin, and the like. A regular medication period is as long as 6-9 months, and because more and more drug-resistant tuberculosis can be generated, clinical drug-resistant tuberculosis patients face the dilemma that no drug is available. If the mycobacterium tuberculosis infected by tuberculosis patients has drug resistance to one or more antitubercular drugs, the drug-resistant tuberculosis is obtained. In recent years, the drug-resistant tuberculosis has increased year by year. In 2019, 18% (95% ci. China is a tuberculosis high-burden country, and is also a drug-resistant/multi-drug resistant tuberculosis high-burden country. In 2019, about 6.5 million MDR/RR-TB patients (the incidence rate is 4.5/10 million population) in China account for 14 percent of MDR/RR-TB cases worldwide; in 74% of RR-TB cases, MDR-TB was noted. In newly diagnosed and treated tuberculosis cases, the drug-resistant patient ratios are as high as 7.1% (5.6% -8.7%) and 23% (23% -24%), respectively. Because MDR-TB has strong infectivity and relatively low treatment success rate, the importance of timely detection, diagnosis and treatment on national health is self-evident. Therefore, there is an urgent need to find new antitubercular drugs, as well as therapeutic strategies and targets.

Disclosure of Invention

In order to overcome the defects in the prior art, the research idea of the inventor is to find important virulence factors of tubercle bacillus by knowing the interaction mechanism of tubercle bacillus and host immune response, and the virulence factors serve as action targets for new drug research and development to mobilize the anti-tubercular immunity of a host, so that the host immunity actively eliminates the tubercle bacillus. The method provides a new treatment scheme for drug-resistant tuberculosis patients, shortens the medication time for new tuberculosis patients, and has high clinical value. Specifically, the invention provides application of tubercle bacillus UreC protein in preparation of anti-mycobacterium tuberculosis drugs.

In order to realize the purpose, the invention adopts the following technical scheme:

the invention provides an application of tubercle bacillus UreC protein in preparing anti-mycobacterium tuberculosis drugs, and the drugs take the tubercle bacillus UreC protein as a target to inhibit the enzyme activity function or expression of the tubercle bacillus UreC protein.

Further, the above drugs enhance the host macrophage immune response to the clearance of Mycobacterium tuberculosis.

The second aspect of the invention provides application of UreC protein of tubercle bacillus in preparing a medicament for treating tuberculosis, wherein the medicament takes UreC protein as a target to inhibit the enzyme activity function or expression of UreC protein.

Further, the administration route of the above drugs is intravenous injection, intramuscular injection, oral administration or transdermal administration.

The third aspect of the invention provides a method for screening anti-mycobacterium tuberculosis drugs, which takes the mycobacterium tuberculosis UreC protein as a target spot, and screens out compounds for inhibiting the enzyme activity function or expression of the mycobacterium tuberculosis UreC protein, namely the main active ingredients of the anti-mycobacterium tuberculosis drugs.

The fourth aspect of the invention provides a method for screening drugs for treating tuberculosis, which takes the UreC protein of tubercle bacillus as a target spot, and screens out compounds for inhibiting the enzyme activity function or expression of the UreC protein, namely the main active ingredients of the drugs for treating tuberculosis.

Further, the administration route of the above drugs is intravenous injection, intramuscular injection, oral administration or transdermal administration.

Further, the medicine also comprises a pharmaceutically acceptable carrier or excipient.

Furthermore, the dosage form of the medicine is tablets, capsules, oral liquid, buccal agents, granules, medicinal granules, pills, powder, pellets, suspensions, powder, solutions, injections or drops.

By adopting the technical scheme, compared with the prior art, the invention has the following technical effects:

experiments verify that UreC is an important virulence factor of tubercle bacillus, determines the survival of tubercle bacillus in a host, and proves that the inhibition of UreC can improve the anti-tubercle immunity of the host, so that the effect of removing tubercle bacillus is achieved, and a new target and direction are provided for developing anti-tubercle mycobacterium and drugs for treating tuberculosis.

Drawings

FIG. 1 is a schematic illustration of a knockout primer design in one embodiment of the invention;

FIG. 2 is a schematic diagram of the design of a knockout primer for the UreC encoding gene Rv1850 of the H37Rv strain in one embodiment of the present invention;

FIG. 3 is a schematic diagram showing an alternative sequence employed in constructing a knockout strain of the UreC encoding gene Rv1850 in one embodiment of the present invention;

FIG. 4 shows the results of PCR amplification of the left and right arms in one embodiment of the present invention, wherein column 1 shows the left arm DNA fragment, column 2 shows the right arm DNA fragment, and M shows the DNA maker;

FIG. 5 is a diagram showing the results of the phagemid restriction verification electrophoresis in one embodiment of the present invention; wherein, the 1-3 lists represent phagemid enzyme cutting results, and M represents a DNA marker;

FIG. 6 is a schematic diagram of the design of a knockout and verification primer in one embodiment of the invention;

FIG. 7 is a graph showing the results of PCR-verifying the Rv1850 knock-out strain in one embodiment of the present invention;

FIG. 8 is a diagram illustrating the design of primers for verifying gene knockout by the full-length method according to an embodiment of the present invention;

FIG. 9 is a graph showing the results of verifying the Rv1850 knock-out strain by full-length PCR in one example of the present invention;

FIG. 10 is a result of verifying the action of UreC on the virulence of tuberculosis mouse infection in one embodiment of the present invention; wherein, the graph A is the result of the detection of the load bacterial quantity of the lung of the H37Rv and delta UreC infected mouse, and the graph B is the result of the HE and acid-fast staining of the lung of the H37Rv and delta UreC infected mouse;

FIG. 11 is a statistical chart of intracellular survival measured after H37Rv and Δ UreC infect mouse peritoneal macrophages in accordance with one embodiment of the present invention;

FIG. 12 is a graph of the in vitro growth of H37Rv and Δ UreC strains according to one embodiment of the present invention.

Detailed Description

The invention provides application of UreC protein in preparation of anti-mycobacterium tuberculosis drugs and drugs for treating tuberculosis, and particularly relates to a drug which takes the ureC protein of tubercle bacillus as a target to inhibit the enzyme activity function or expression of the UreC protein.

The present invention will be described in detail and specifically with reference to the following examples and drawings so as to provide a better understanding of the invention, but the following examples do not limit the scope of the invention.

In the examples, the conventional methods were used unless otherwise specified, and reagents used were those conventionally commercially available or formulated according to the conventional methods without specifically specified.

Example 1

In this embodiment, a temperature-sensitive phage method is used to construct a UreC knockout strain (H37 Rv Δ UreC) of H37Rv, and the specific construction process and verification result are as follows:

1.1 Gene knockout related primer design sequence localization

As shown in FIG. 1, assuming that a light gray band is a gene to be knocked out (target gene), and dark gray bands are upstream and downstream sequence gene fragments of the gene to be knocked out, called a left arm (L) and a right arm (R), a primer pair LFP/LRP and RFP/RRP are respectively designed, and the left arm and the right arm (about 600-1000 bp) are amplified, wherein the primer pair LFP and RFP need to contain partial DNA sequences at the left end and the right end of the gene to be knocked out. Validation primers were designed upstream of the LFP and downstream of the RRP, and validation primers (LYZFP/RYZRP) were used in the subsequent PCR validation stage. The sequences of the specific primers used in the above steps are shown in Table 1 below.

TABLE 1 sequence information of Gene knockout related primers

As shown in FIG. 2, the light grey bottom is the ORF of the gene, the front and back 1000bp are the upstream and downstream sequences, the square box is the left and right arm PCR primers, and the dark grey bottom background is labeled as the verification primer sequence. The DNA in the second to third boxes of the gene of the successfully constructed knock-out strain was replaced by the sequences shown in FIG. 3 (mainly the hygromycin B resistance gene and the SacB gene for subsequent resistance elimination, about 3.7kb in total).

1.2PCR amplification of the left and right arms

Left and right arm DNA fragments of the UreC (Rv 1850) gene in Mycobacterium tuberculosis H37Rv were amplified using Phusion high fidelity DNA polymerase from Thermo Scientific, using primer pairs LFP/LRP and RFP/RRP, respectively, to amplify the left arm (718) and the right arm (657).

The left arm DNA sequence is as follows:

TGGCAGGATCGCAGAGCATGCGCCTGACGCCGCACGAACAGGAGCGTTTGCTGTTGTCCTACGCCGCCGAGTTGGCCCGCCGGCGTCGGGCCCGCGGCCTGCGCCTCAATCATCCGGAAGCCATCGCGGTGATCGCCGACCACATCCTGGAAGGCGCGCGTGACGGCCGCACCGTCGCAGAGTTGATGGCATCCGGGCGTGAGGTGCTCGGCCGTGACGATGTGATGGAGGGAGTGCCGGAGATGCTCGCCGAGGTACAGGTGGAGGCGACGTTTCCGGACGGCACCAAGTTGGTCACCGTGCATCAGCCGATCGCATGATTCCCGGAGAAATCTTTTACGGCAGTGGTGATATCGAGATGAACGCCGCGGCACTCTCCCGCCTGCAGATGCGGATCATCAACGCCGGCGATCGTCCGGTGCAGGTCGGTAGCCACGTCCATCTCCCGCAGGCCAATCGGGCGCTGTCATTCGACCGTGCGACGGCCCACGGCTACCGTCTGGACATCCCGGCGGCGACAGCGGTGCGCTTCGAGCCGGGCATTCCCCAAATCGTCGGGTTGGTTCCGTTGGGCGGACGGCGCGAGGTACCCGGTCTGACGCTAAATCCGCCCGGACGGTTGGACCGCTGATGGCGCGACTGTCAAGGGAGCGCTACGCACAGCTGTACGGACCTACCACCGGCGACCGGATACGGCTGGCCGACACCAACCTGCTGG(SEQ ID No.9)；

the right arm DNA sequence is as follows:

GTCAATCCCGACCCCGCAACCGGTGCTCCCGCGACCGATGTTCGGCGCGGCCGCGGCAACCGCGGCGGCGACCTCGGTGCACTTCGTCGCGCCGCAATCCATCGACGCGCGCCTGGCGGACCGGCTCGCGGTCAATCGGGGACTAGCGCCGGTGGCCGACGTGCGCGCAGTGGGCAAGACCGACCTGCCGCTCAATGATGCCCTACCGAGCATCGAGGTCGATCCCGACACCTTCACCGTGCGAATCGACGGCCAGGTGTGGCAACCGCAGCCGGCCGCCGAACTACCTATGACACAACGGTATTTCCTGTTCTAATGACCTCGCTGGCCGTGCTGCTCACCCTCGCCGACTCGCGGCTGCCCACGGGTGCGCACGTGCACTCGGGCGGCATCGAAGAAGCCATCGCCGCCGGCATGGTGACCGGCCTGGCCACCCTGGAAGCGTTCCTGAAACGGCGGGTCCGCACCCACGGCCTGCTGACGGCGTCCATCGCGGCCGCGGTGCACCGGGGCGAGCTGGCCGTCGACGACGCCGACCGGGAAACCGACGCGCGCACACCGGCTCCCGCGGCCAGACACGCCTCACGCAGCCAGGGCCGCGGGCTGATCAGGCTGGCACGGCGGGTGTGGCCCGATTCCGGCTGGGAGGAACTGGGC(SEQ ID No.10)。

as a result of amplification, as shown in FIG. 4, it was found that the target DNA fragment was successfully amplified.

1.3 construction of phagemids

The left and right arm PCR products are recovered after BglI enzyme digestion and connected with plasmid p0004s digested by Van91I, E.coli DH5 alpha competent cells are transformed, positive clones are screened and sequenced. The positive clones obtained by identification are further cut by restriction enzyme (PacI) and recovered, and are connected with plasmid phiE 159 cut by the same PacI, packaged and transformed into E.coli HB101 cells, and positive phagemids (phasmid) are obtained by screening, and the result of PacI enzyme cutting verification is shown in figure 5.

1.4 construction of Mycobacterium phage

Taking a proper amount of successfully constructed phagemid DNA to carry out electrotransformation competent Mycobacterium smegmatis mc ² 155 cells, plated, cultured for 2-3 days and then observed whether plaques (plaques) are formed. And (4) screening the plaques, and amplifying to prepare the high-titer phage. The obtained phage infected Mycobacterium smegmatis mc ² 155, and the plaque formed.

Construction of 1.5Mycobacterium tuberculosis H37Rv. DELTA. Rv1850 Strain

After high titer phage infection of Mycobacterium tuberculosis H37Rv, 7H10 (supplemented with 10% OADC +0.5% glycerol) solid plate (containing 75 μ g/mL hygromycin B) is coated, after 4-5 weeks of culture at 37 ℃, grown single clone is picked up and inoculated with 7H9 (supplemented with 10% OADC +0.5% glycerol +0.05% Tween-80) liquid medium (containing 75 μ g/mL hygromycin B), after 4-5 weeks of culture at 37 ℃, genome is extracted, and whether gene knockout is successful is verified by PCR.

1.6 two-fragment method PCR-verified gene knockout strain

As shown in FIG. 6, the gene knockout verification primer designs an upstream verification primer (LYZFP) at 100-200bp upstream of the LFP primer matching sequence, and designs a downstream verification primer (RYZRP) at 100-200bp downstream of the RRP primer matching sequence, the LYZRP primer is designed on the sacB gene, and the RYZFP primer is designed on the hyg gene. An upstream primer KOYZFP is designed in the sacB gene, and a downstream primer KOYZRP is designed in the hyg gene.

As shown in FIG. 7, PCR confirmed that the DNA fragments of 1040bp and 1113bp were amplified using the primer pairs LYZFP/LYZRP and RYZFP/RYZRP and using the knock-out strain genome (MUT strain) as a template, while the DNA fragment of interest was not amplified using the same primer pair in PCR using the wild strain genome (WT strain) as a template.

1.7 full-Length PCR-verified Gene knockout Strain

Primers were designed and amplified according to the schematic shown in FIG. 8: PCR confirmed that a 5465bp DNA fragment could be obtained by amplification using the primer pair LYZFP/RYZRP and the knock-out strain genome (MUT strain) as a template, while a 3112bp DNA fragment was obtained by PCR amplification using the wild strain genome (WT strain) as a control. As a result, as shown in FIG. 9, the Rv1850 gene of Mycobacterium tuberculosis H37Rv strain was successfully knocked out to obtain Mycobacterium tuberculosis H37 Rv. DELTA.Rv 1850 strain.

Example 2

This example demonstrates the effect of UreC on tubercle bacillus mouse infectious virulence, and the specific procedures and results are as follows:

after 6-8 weeks female C57BL/6 mice were allowed to enter ABSL-3 for 1 week of acclimation, H37Rv and UreC knockout strains were infected nasally with the same dose, respectively, and sacrificed 8 weeks later. The effect of UreC on MTB mouse infection pathogenicity is clarified by detecting the following indexes:

1. bacterial load of different organs: c57BL/6 mice were infected with 2 strains each by nasal drip for 4 weeks (about 1X 10) ⁵ CFU/mouse), killing the mouse, collecting lung tissue under aseptic condition, adding PBS to homogenate, diluting by 10 times, inoculating on 7H10 agar medium, culturing at 37 deg.C for 4 weeks, observing growth conditions of different strains, calculating CFU number of viable bacteria, and counting the bacterial load of lung tissue. As shown in FIG. 10A, it was found that the log10 of the pulmonary tissue load of the mouse after H37Rv infection was 5.83, whereas UreC knockdown bacteria wasThe lung tissue load log10 of (Δ UreC) mice was 0.65, differing by more than 5 orders of magnitude.

2. And (3) lung histopathological detection: after infection of C57BL/6 mice by nasal drip, mice were sacrificed, lungs were collected under sterile conditions, lesion range was visually observed, and lesion status was recorded. After the lung tissue was fixed with 4% paraformaldehyde, dehydrated, wax-soaked, embedded, sliced, stained with H & E and acid-fast, and examined by microscope for pathological changes in lung tissue, as shown in fig. 10B, it was found that lung tissue infected with Δ urea mice had significantly reduced immune cell infiltration and lung tissue damage as compared to mice infected with control strains.

The results show that UreC is an important pathogenic virulence factor of tubercle bacillus.

Example 3

In this embodiment, on the basis of obtaining a UreC gene knockout strain of tubercle bacillus, the influence of UreC on the intracellular survival of tubercle bacillus is determined through an experiment of infecting tubercle bacillus in vitro with primary macrophage, and the specific experimental steps and results are as follows:

1. separating mouse abdominal cavity macrophage: mice were dosed 6-8 weeks SPF grade C57bl/6 i.p. with broth and sacrificed by 48 hours post cervical dislocation. Injecting 10ml of a total 1640-free culture medium into the abdominal cavity of the mouse by using a 10ml injector, sucking back, extracting primary macrophages in the abdominal cavity of the mouse, paving the primary macrophages in a 12-hole plate, and waiting for a CFU analysis experiment.

Cfu analytical experiments: mice peritoneal primary macrophages plated in 12-well plates were infected with wild-type H37Rv and urea knockout strains with MOI =5. Macrophages were lysed with sterile PBS solution containing 0.1% Triton 100 at both time points of infection 3 hours and 24 hours, respectively. Then, the lysate containing the bacteria was diluted 10 times and inoculated on 7H10 agar medium, cultured at 37 ℃ for 4 weeks, observed for growth of different strains, and the number of viable bacteria CFU was calculated, and the results are shown in FIG. 11.

The results show that there was no significant difference in the entry of bacterial-laden macrophages between the two groups 3 hours after macrophage infection with H37Rv and Δ urea. The survival of H37Rv within macrophages decreased slightly 24 hours after infection, whereas Δ UreC had been completely cleared by macrophages. The above data suggest that UreC is an important virulence factor for tubercle bacillus survival within host macrophages.

Example 4

In this example, a tubercle bacillus control strain and a UreC gene knockout strain are cultured in vitro, an in vitro growth curve is drawn, and the functional influence of the UreC gene on the in vitro growth of the tubercle bacillus is confirmed, and the specific experimental steps and results are as follows:

a Bioscreen full-automatic growth curve analyzer is applied, H37Rv or H37Rv delta UreC strains are diluted to a certain concentration and added into a detection plate, 3 more strains of Kong Duizhao are set, the strains are cultured at 37 ℃ for two weeks, OD590 is detected every 2H, a growth curve is drawn (as shown in figure 12), and the growth activity difference of wild type and UreC knockout strains under an aerobic culture condition is analyzed.

As a result, the UreC gene knockout strain has little obvious influence on the in vitro growth of the tubercle bacillus under the normal aerobic culture condition. The phenotype that the survival ability of the combined UreC knockout bacteria in macrophages and mouse lung tissues is obviously reduced is excluded because the UreC influences the growth function of the tubercle bacillus, and the UreC suggests that the immune response of host macrophages to the removal of the tubercle bacillus can be inhibited, so that the tubercle bacillus escapes in immunity.

Therefore, the design or screening of the small-molecule inhibitor for targeting the tubercle bacillus UreC may not inhibit the growth and reproduction speed of the tubercle bacillus, but can relieve the immunosuppressive function of the UreC on the host, improve the anti-tubercle immune response of the host and achieve the purpose of clearing the tubercle bacillus. And the idea of designing the antituberculosis drug by considering the targeted tubercle bacillus UreC is obviously different from the mechanism of directly killing the tubercle bacillus by the traditional antituberculosis drug, and the generation possibility of the drug-resistant bacteria is reduced.

The embodiments of the present invention have been described in detail, but the embodiments are merely examples, and the present invention is not limited to the embodiments described above. It will be appreciated by those skilled in the art that any equivalent modifications and substitutions are within the scope of the present invention. Accordingly, equivalent changes and modifications made without departing from the spirit and scope of the present invention should be covered by the present invention.

Sequence listing

<110> pulmonale Hospital of Shanghai city

Application of tubercle bacillus UreC protein in preparation of anti-mycobacterium tuberculosis drugs

<160> 10

<170> SIPOSequenceListing 1.0

<210> 1

<211> 37

<212> DNA

<213> primer LFP (artificial sequence)

<400> 1

ttttttttgc ctaaatggct ggcaggatcg cagagca 37

<210> 2

<211> 37

<212> DNA

<213> primer LRP (artificial sequence)

<400> 2

ttttttttgc ctttctggcc cagcaggttg gtgtcgg 37

<210> 3

<211> 37

<212> DNA

<213> primer RFP (artificial sequence)

<400> 3

ttttttttgc ctagatggcg tcaatcccga ccccgca 37

<210> 4

<211> 37

<212> DNA

<213> primer RRP (artificial sequence)

<400> 4

ttttttttgc ctctttggcg cccagttcct cccagcc 37

<210> 5

<211> 22

<212> DNA

<213> primer LYZFP (artificial sequence)

<400> 5

tcagggatgg tgtatggcac cg 22

<210> 6

<211> 20

<212> DNA

<213> primer LYZRP (artificial sequence)

<400> 6

gtggacctcg acgaccctag 20

<210> 7

<211> 20

<212> DNA

<213> primer RYZFP (artificial sequence)

<400> 7

tggatctctc cggcttcacc 20

<210> 8

<211> 23

<212> DNA

<213> primer RYZRP (artificial sequence)

<400> 8

gcggatcaga caagtctgcc agt 23

<210> 9

<211> 718

<212> DNA

<213> left arm DNA sequence (artificial sequence)

<400> 9

tggcaggatc gcagagcatg cgcctgacgc cgcacgaaca ggagcgtttg ctgttgtcct 60

acgccgccga gttggcccgc cggcgtcggg cccgcggcct gcgcctcaat catccggaag 120

ccatcgcggt gatcgccgac cacatcctgg aaggcgcgcg tgacggccgc accgtcgcag 180

agttgatggc atccgggcgt gaggtgctcg gccgtgacga tgtgatggag ggagtgccgg 240

agatgctcgc cgaggtacag gtggaggcga cgtttccgga cggcaccaag ttggtcaccg 300

tgcatcagcc gatcgcatga ttcccggaga aatcttttac ggcagtggtg atatcgagat 360

gaacgccgcg gcactctccc gcctgcagat gcggatcatc aacgccggcg atcgtccggt 420

gcaggtcggt agccacgtcc atctcccgca ggccaatcgg gcgctgtcat tcgaccgtgc 480

gacggcccac ggctaccgtc tggacatccc ggcggcgaca gcggtgcgct tcgagccggg 540

cattccccaa atcgtcgggt tggttccgtt gggcggacgg cgcgaggtac ccggtctgac 600

gctaaatccg cccggacggt tggaccgctg atggcgcgac tgtcaaggga gcgctacgca 660

cagctgtacg gacctaccac cggcgaccgg atacggctgg ccgacaccaa cctgctgg 718

<210> 10

<211> 657

<212> DNA

<213> Right arm DNA sequence (artificial sequence)

<400> 10

gtcaatcccg accccgcaac cggtgctccc gcgaccgatg ttcggcgcgg ccgcggcaac 60

cgcggcggcg acctcggtgc acttcgtcgc gccgcaatcc atcgacgcgc gcctggcgga 120

ccggctcgcg gtcaatcggg gactagcgcc ggtggccgac gtgcgcgcag tgggcaagac 180

cgacctgccg ctcaatgatg ccctaccgag catcgaggtc gatcccgaca ccttcaccgt 240

gcgaatcgac ggccaggtgt ggcaaccgca gccggccgcc gaactaccta tgacacaacg 300

gtatttcctg ttctaatgac ctcgctggcc gtgctgctca ccctcgccga ctcgcggctg 360

cccacgggtg cgcacgtgca ctcgggcggc atcgaagaag ccatcgccgc cggcatggtg 420

accggcctgg ccaccctgga agcgttcctg aaacggcggg tccgcaccca cggcctgctg 480

acggcgtcca tcgcggccgc ggtgcaccgg ggcgagctgg ccgtcgacga cgccgaccgg 540

gaaaccgacg cgcgcacacc ggctcccgcg gccagacacg cctcacgcag ccagggccgc 600

gggctgatca ggctggcacg gcgggtgtgg cccgattccg gctgggagga actgggc 657

Claims (2)

1. The application of the drug which takes the UreC protein as a target to inhibit the enzyme activity function or expression of the UreC protein in the preparation of the drug for improving the immune response of host macrophages to the clearance of mycobacterium tuberculosis.

2. The use according to claim 1, wherein the drug is administered by intravenous, intramuscular, oral or transdermal administration.

Images