CN113493798B

CN113493798B - Method for constructing synthetic strain for generating fengycin by converting xylose by regulating and controlling Dahms approach

Info

Publication number: CN113493798B
Application number: CN202110563500.6A
Authority: CN
Inventors: 闻建平; 高文婷; 靳佳琦
Original assignee: Tianjin University
Current assignee: Tianjin University
Priority date: 2021-05-21
Filing date: 2021-05-21
Publication date: 2022-12-06
Anticipated expiration: 2041-05-21
Also published as: CN113493798A

Abstract

The invention provides a method for constructing a synthetic strain for converting xylose into fengycin by regulating and controlling a Dahms approach; the promoter gene P ₄₃ And xylose dehydrogenase xylB, xylonolactonase xylC, xylonate dehydratase gene yjhG and 2-keto-3-deoxyxylonate dehydratase gene yjhH are connected in series to prepare a Dahms xylose pathway module to a shuttle vector pHY300 PLK; simultaneously starting from glycolaldehyde which is a metabolite of the Dahms pathway, aldehyde dehydrogenase genes aldA, malate synthase aceB, malate dehydrogenase mdh and a promoter P ₄₃ Serially preparing a glycolaldehyde anaplerosis TCA regulation module into a shuttle vector pHP 13; the two shuttle vectors are co-expressed in a chassis strain, and a fengycin high-quality strain BSU02 is constructed by co-expressing and converting xylose by a Dahms module and a regulated glycolaldehyde anaplerosis TCA module.

Description

Method for constructing synthetic strain for generating fengycin by converting xylose by regulating and controlling Dahms approach

Technical Field

The invention relates to a construction method of a synthetic strain for synthesizing fengycin by converting xylose through combined expression of a Dahms xylose pathway module and a TCA module for regulating and controlling glycolaldehyde anaplerosis, belonging to the technical field of industrial microorganisms.

Background

Lignocellulose is the most abundant renewable biomass resource existing in nature, and the annual yield of lignocellulose is about 210 ¹¹ Metric tons, widely derived from woody biomass such as wood, agricultural residues such as rice straw, energy crops such as switchgrass, and various cellulosic wastes such as wastes of wood mills, pulp mills, etc., are mainly composed of cellulose (30% -50%), hemicellulose (20% -35%) and lignin (15% -20%), which can be used as valuable chemical raw materials or pretreated for fermentation of microorganisms (Kim JS, lee YY, kim th.a review on alkaline prediction technology f)or bioconversion of lignocellulosic biomass[J].Bioresource Technology,2016,199:42-48.Zhao Z,Xian M,Liu M,et al.Biochemical routes for uptake and conversion of xylose by microorganisms[J]Biotechnology for Biofuels,2020,13 (1): 12). The hydrolysate obtained by the treatment contains abundant monosaccharides including glucose, mannose, xylose, arabinose, galactose and the like. Therefore, efficient bioconversion of lignocellulose depends greatly on efficient utilization of these monosaccharides in the hydrolysate, glucose, the main hydrolysis monosaccharide of cellulose, as a rapid-acting carbon source directly utilizable by most microorganisms, has been widely studied for biofermentation synthesis of value-added compounds and bulk chemicals, but xylose, as a main monosaccharide component in hemicellulose hydrolysate, is metabolized by only a small proportion of microorganisms in nature, and, in many microorganisms, utilization of xylose is strictly inhibited by glucose metabolism, limiting the conversion efficiency of xylose. Therefore, the rational design of synthetic biology and metabolic engineering is applied, and the construction of an efficient xylose conversion platform for the synthesis of high value-added compounds becomes important.

Fengycin is a secondary metabolite of non-ribosomal synthesis of an enzyme complex formed BY FenC, fenD, fenE, fenA, and FenB, which is an enzyme complex formed BY Fengycin synthetase in the order of five modules, and is a lipopeptide compound (Ke WJ, chang BY, lin TP, et al.activation of the promoter of the Fengycin synthesis operation BY the UP element [ J ]. Journal of Bacteriology,2009,191 (14): 4615-4623.). The structural components of Fengycin comprise hydrophobic branched chain fatty acid C13-C21 and residue peptide consisting of hydrophilic amino acids arranged in sequence, wherein the amino acid sequence in the peptide chain is l-Glu, D-Orn, l-Tyr, D-allo-Thr, l-Glu, D-Ala/D-Val, l-Pro, l-Glu, D-Tyr, l-Ile, wherein l-Tyr and l-Ile are closed in a ring, and the amino acid sequence in the sixth position can be divided into Fengycin A and Fengycin B (Sun S, romo TD, grossfield A.Selectivity and mechanomycin of ngmycin, anti-microbial lipid, from molecular dynamics [ J ]. Journal of physiological B,2018,122 (8): 2219-2226). Depending on the length of the fatty acid moiety and the peptide-based sequence, it may exhibit different biological activities. Compared with other two important classes of lipopeptides surfactin and iturins, the antifungal activity of fengycin is more potent against filamentous fungi, and by binding their cell membranes, causing leakage and lysis, etc., fengycin has antiviral and anticancer activities in addition to antifungal activity, showing great application and research value (Yang RR, lei SZ, xu XG, et al. Key elements and regulation strategies of NRPSs for biosyntheses of lipids by Bacillus [ J ]. Applied Microbiology and Biotechnology,2020,104 (19): 8077-8087). However, the research on the application and function of fengycin in other fields is greatly limited due to factors such as insufficient economic applicability of its biosynthetic substrate (Kumar PN, swapna TH, khan MY, et al. Statistical optimization of anti-interstitial protein a production from Bacillus amyloliquefaciens RHN 22 using agro-industrial furnaces [ J. Saudi Journal of Biological Sciences,2015,370 (s 5-6): 636-640.) and it is necessary to construct a strain that converts fengycin by inexpensive transformation, with xylose as the second largest carbon source in lignocellulose, being the best carbon source to select.

The precursor for Fengycin synthesis contains various amino acids and fatty acids, and during the primary carbon metabolism, pyruvate is a main node metabolite for connecting amino acid metabolism, fatty acid extension and central carbon metabolism, so that the conversion rate from a carbon source to pyruvate is increased, and the synthesis of the related precursor of Fengycin is facilitated. Among the xylose metabolic pathways that have been found in nature today, the traditional isomerisation and redox pathways require the conversion of xylose to pyruvate by first passing through the pentose phosphate pathway and the glycolysis pathway, the recently discovered nonphosphorylated xylose pathway Weimberg converts xylose directly to α -ketoglutarate without passing through pyruvate, while the other metabolic pathway Dahms, which can be completed in only 4 steps (Valdehusa KNG, ramos KRM, nisola GM, et al. However, in studies of xylose transformation using the Dahms pathway, it was found that the strain biomass was reduced due to the expression of this xylose metabolic pathway, for example, by introducing genes xylB and xylC derived from C.crescentus into E.coli XL1-Blue by So Young Choi et al, the complete Dahms metabolic pathway was successfully constructed, and it was observed that the strain had deteriorated growth compared to the original strain during fermentation and that a certain amount of lactic acid was accumulated (Choi SY, park SJ, kim WJ, et al, one-step constructive expression of poly (lactic-co-glycolic acid) from carbohydrate in Escherichia coli [ J ]. Nature technology,2016,34 (4): 435- +). Meanwhile, the Dahms pathway also generates a toxic metabolite, glycolaldehyde, which brings toxic effects to cells. Therefore, when the Dahms pathway is introduced to convert xylose, negative effects brought by the expression of the Dahms pathway need to be considered, the toxic effect of glycolaldehyde is eliminated, meanwhile, the glycolaldehyde is converted into an intermediate substance in a TCA cycle, and the intracellular metabolic state of the strain is indirectly improved while the flux of the TCA cycle is enhanced.

The invention comprehensively utilizes synthetic biology, genetic engineering and metabolic engineering technology, prepares a design module related to Dahms xylose metabolic pathway, and designs the recombination of regulatory genes starting from glycolaldehyde which is a byproduct expressed by the Dahms pathway, thereby generating a high-quality synthetic strain which stably utilizes xylose to synthesize fengycin.

Disclosure of Invention

The invention aims to design and prepare a Dahms pathway module of xylose from the beginning by technical means of synthetic biology and the like, design a TCA module for regulating glycolaldehyde and supplementing the glycolaldehyde aiming at the Dahms pathway from the expression toxic product glycolaldehyde of the Dahms pathway, construct a high-quality synthetic strain BSU02 for synthesizing fengycin by simultaneously combining and expressing and converting xylose by using the Dahms module and the TCA module for regulating glycolaldehyde and supplementing the glycolaldehyde, utilize xylose as a carbon source for fermentation, and detect that the yield of fengycin is 46.82mg/L.

The purpose of the invention is realized by the following technical scheme:

a method for constructing a synthetic strain for converting xylose into fengycin by regulating and controlling a Dahms approach; the Dahms pathway module and the TCA module for regulating and controlling glycolaldehyde anaplerosis are combined to express and transformA construction method of a high-quality strain for synthesizing fengycin by xylose; starting from the supply of synthetic precursors of fengycin, the promoter gene P from Bacillus subtilis ₄₃ And xylose dehydrogenase xylB and xylonolactonase xylC from the Bacillus crescentus, as well as a xylonate dehydratase gene yjhG and a 2-keto-3-deoxyxylonate dehydratase gene yjhH from Escherichia coli MG1655, in series, and preparing a Dahms xylose pathway module into a shuttle vector pHY300 PLK; simultaneously starting from glycolaldehyde which is a metabolite in the Dahms pathway, aldehyde dehydrogenase genes aldA, malate synthase aceB, malate dehydrogenase mdh and a promoter P obtained from escherichia coli ₄₃ Serially connecting, and preparing a TCA regulation module for regulating and controlling glycolaldehyde back-supplement into a shuttle vector pHP13 vector; and co-expressing the two shuttle vectors in a chassis strain to construct a high-quality strain BSU02 for synthesizing fengycin by co-expressing and converting xylose by using a Dahms module and a regulated glycolaldehyde anaplerosis TCA module.

The method comprises the following steps:

1) According to P ₄₃ Designing PCR primers for the promoter, and amplifying a gene fragment promoter P by using Bacillus subtilis 168 genome as a template ₄₃ ；

2) The promoter P ₄₃ Connecting a shuttle vector pHY300PLK to obtain a recombinant vector pHY300P01;

3) Designing a PCR primer according to the xylB gene, and amplifying the xylose dehydrogenase gene xylB;

4) Designing a PCR primer according to the xylC gene, and amplifying the xylonolactonase gene xylC;

5) Connecting the amplified gene xylB and the amplified gene xylC into the vector pHY300P01 constructed in the step 2) through a seamless cloning connection system to obtain a recombinant vector pHY300P02;

6) Designing a PCR primer according to the yjhG gene, and amplifying a xylonic acid dehydratase gene yjhG by taking an Escherichia coli K-12MG1655 genome as a template;

7) Designing a PCR primer according to the yjhH gene, and amplifying a 2-keto-3-deoxyxylonate dehydratase gene yjhH by taking an Escherichia coli K-12MG1655 genome as a template;

8) Connecting the amplified gene yjhG and the amplified gene yjhH into the constructed vector pHY300P02 obtained in the step 5) through a seamless cloning system to obtain a recombinant vector pHY300P03;

9) According to P ₄₃ Designing PCR primers for the promoter, and amplifying a gene fragment promoter P by using Bacillus subtilis 168 genome as a template ₄₃ ；

10 Will amplify promoter P ₄₃ Connecting a shuttle vector pHP13 to obtain a recombinant vector pHP13P01;

11 Designing PCR primers according to aceB gene, and amplifying malic acid synthetase gene aceB by using Escherichia coli K-12MG1655 genome as template;

12 Designing PCR primers according to mdh gene, and amplifying malate dehydrogenase gene mdh by using Escherichia coli K-12MG1655 genome as a template;

13 Connecting the amplified gene aceB and the amplified gene mdh into the constructed vector pHP13P01 obtained in the step 10) through a seamless cloning system to obtain a recombinant vector pHP13P02;

14 Designing PCR primers according to the aldA gene, and amplifying the aldehyde dehydrogenase gene aldA by using Escherichia coli K-12MG1655 genome as a template;

15 The amplified gene aldA is connected with the constructed vector pHP13P02 in the step 13) through a seamless cloning system to obtain a recombinant vector pHP13P03;

16 Introducing the recombinant vector pHY300P03 constructed in the step 8) and the recombinant vector pHP13P03 constructed in the step 15) into B.subtilis 168 modified bacteria by an electrotransformation method, and constructing a high-quality strain BUS02 for synthesizing fengycin by converting xylose through combined expression of a Dahms module and a regulation glycolaldehyde anaplesis TCA module.

Said P ₄₃ The known sequence of the promoter SEQ ID NO 1.

The known sequence of xylB gene SEQ ID NO 2.

The known sequence of xylC gene SEQ ID NO 3.

The known sequence of the yjhG gene is SEQ ID NO. 4.

The known sequence of the yjhH gene is SEQ ID NO. 5.

The known sequence of the aceB gene is SEQ ID NO 6.

The known sequence of mdh gene is SEQ ID NO 7.

The known sequence of the aldA gene is SEQ ID NO. 8.

And (3) selecting the BSU02 which is verified to be correct for activation, selecting a single colony for seed culture and shake flask fermentation, and extracting and detecting the yield of fengycin from the fermentation liquor.

The specific construction steps of the engineering strain are as follows:

1) According to P ₄₃ Known sequence of promoter SEQ ID NO 1 design PCR primers, P ₄₃ IS a constitutive promoter in Bacillus subtilis 168 (NC-000964.3), the nucleotide sequence of which IS shown as SEQ IS NO:1, PCR amplification primers are designed according to the sequence, and a gene fragment promoter P IS amplified by taking Bacillus subtilis 168 (from BGSC) genome (NC-000964.3) as a template ₄₃ ；

2) The P43 promoter is connected into a linearized vector pHY300PLK (purchased from biological companies) subjected to HindIII-SalI double enzyme digestion treatment through a T4 connection system to construct a recombinant vector pHY300P01;

3) The xylB is a gene for coding xylose dehydrogenase, PCR primers are designed according to the known sequence SEQ ID NO. 2 of the xylB gene, and the gene xylB is amplified;

4) xylC is a gene for coding xylonolactonase, and a PCR primer is designed according to the known sequence SEQ ID NO. 3 of the xylC gene to amplify the gene xylC;

5) Connecting the gene xylB and the gene xylC into a linearized vector pHY300P01 subjected to XhoI-EcoRI double enzyme digestion treatment through a seamless cloning connection system to construct a recombinant vector pHY300P02;

6) yjhG is a gene for coding the xylonic acid dehydratase in Escherichia coli K-12MG1655 bacteria, the nucleotide sequence of the gene is shown as SEQ ID NO. 4, PCR amplification primers are designed according to the sequence, and the gene yjhG is amplified by taking an Escherichia coli K-12MG1655 (NC-000913.3) genome as a template;

7) yjhH is a gene for coding 2-keto-3-deoxyxylonic acid dehydratase in Escherichia coli K-12MG1655 bacteria, the nucleotide sequence is shown as SEQ ID NO. 5, PCR amplification primers are designed according to the sequence, and the gene yjhH is amplified by taking an Escherichia coli K-12MG1655 genome as a template;

8) Connecting the gene yjhG and the gene yjhH into the vector pHY300P02 after EcoRI single enzyme digestion treatment through a seamless cloning connection system to construct a recombinant vector pHY300P03;

9)P ₄₃ is a constitutive promoter in Bacillus subtilis 168, the nucleotide sequence is shown as SEQ ID NO:1, PCR amplification primers are designed according to the sequence, a genome (NC-000964.3) of Bacillus subtilis 168 (derived from BGSC) is taken as a template, and a promoter gene fragment P is amplified ₄₃ ；

10 By a T4 linking system ₄₃ The promoter is connected with a linearized vector pHP13 (derived from BGSC) subjected to HindIII-SalI double enzyme digestion treatment to construct a recombinant vector pHP13P01;

11 aceB is a gene which codes malate synthase in Escherichia coli K-12MG1655 bacteria, the nucleotide sequence of the aceB is shown as SEQ ID NO. 6, PCR amplification primers are designed according to the sequence, and the gene group of Escherichia coli K-12MG1655 is used as a template to amplify malate synthase gene aceB;

12 Mdh is a gene which codes the malate dehydrogenase in Escherichia coli K-12MG1655 bacteria, the nucleotide sequence of the gene is shown as SEQ ID NO. 7, PCR amplification primers are designed according to the sequence, and the genome of Escherichia coli K-12MG1655 is used as a template to amplify the malate dehydrogenase gene mdh;

13 Connecting the amplified gene aceB and the amplified gene mdh into a linear vector pHP13P01 subjected to double enzyme digestion treatment by endonuclease XhoI-EcoRI through a seamless cloning system to construct a recombinant vector pHP13P02;

14 aldA is the gene of coding aldehyde dehydrogenase in Escherichia coli K-12MG1655 bacteria, the nucleotide sequence is shown in SEQ ID NO. 8, PCR amplification primer is designed according to the sequence, and the aldehyde dehydrogenase gene aldA is amplified by taking Escherichia coli K-12MG1655 genome as a template;

15 Gene aldA is connected into a vector pHP13P02 which is subjected to SphI-XhoI double enzyme digestion treatment through a seamless cloning system to construct a recombinant vector pHP13P03;

16 Introducing the recombinant vector pHY300P03 constructed in the step 8) and the recombinant vector pHP13P03 constructed in the step 15) into B.subtilis 168 modified bacteria in an electric conversion mode, and constructing a high-quality strain BSU02 for synthesizing fengycin by expressing and converting xylose by combining a Dahms module and a regulation and control glycolaldehyde module;

17 Fengycin is produced from xylose, 16) constructed strains are used for shake flask fermentation culture.

The engineering strain BSU02 constructed by the method can effectively utilize xylose to synthesize fengycin, and the yield of fengycin in BSU02 fermentation liquor detected by high performance liquid chromatography reaches 46.82mg/L.

Drawings

FIG. 1: digestion and PCR validation of plasmid pHY300P01

FIG. 2: PCR amplification of xylB and xylC and restriction enzyme digestion verification of plasmid pHY300P02

FIG. 3: verification of plasmid pHY300P03

FIG. 4 is a schematic view of: verification of plasmid pHP13P01

FIG. 5 is a schematic view of: verification of plasmid pHP1302

FIG. 6: verification of plasmid pHP1303

FIG. 7 is a schematic view of: construction process of Dahms modular vector pHY300P03

FIG. 8: construction process for regulating and controlling glycolaldehyde to complement TCA module plasmid vector pHP13P03

FIG. 9: metabolic map of Dahms module and regulated glycolaldehyde anaplerosis TCA module

Detailed Description

A construction method for synthesizing a high-quality strain of fengycin by expressing and converting xylose by combining a Dahms approach module and a TCA module for regulating and controlling glycolaldehyde to complement; it is characterized by that starting from the synthetic precursor supply of fengycin, in order to shorten the metabolic step from carbon source xylose to nodal metabolite pyruvic acid, it utilizes the gene engineering technique to make the promoter gene P from Bacillus subtilis ₄₃ And xylose dehydrogenase xylB and xylonolactonase xylC from Lactobacillus crescentus, and xylonate dehydratase gene yjhG and 2-keto-3-deoxyxylonate dehydratase gene yjhH from Escherichia coli MG1655 in series to prepare Dahms xylose pathway module into shuttle vector pHY300PLK, and simultaneously, in order to effectively reuse glycolaldehyde which is toxic metabolite of Dahms pathway, the gene from large intestine rodGetting aldehyde dehydrogenase gene aldA, malate synthase aceB, malate dehydrogenase mdh and promoter P ₄₃ And (4) connecting in series, and preparing a TCA regulation module for regulating and controlling glycolaldehyde back-supplement into a shuttle vector pHP13 vector. Co-expressing the two shuttle vectors in the chassis bacteria, constructing a high-quality strain BSU02 for synthesizing fengycin by co-expressing and converting xylose by using a Dahms module and a regulated glycolaldehyde anaplerosis TCA module, fermenting by using xylose as a carbon source, and detecting the yield of the fengycin to be 46.82mg/L.

The first embodiment is as follows: construction of Dahms Module expression vector pHY300P03

(1) Promoter P ₄₃ (SEQ ID NO: 1), gene xylB (SEQ ID NO: 2), gene xylC (SEQ ID NO: 3), yjhG (SEQ ID NO: 4) and yjhH (SEQ ID NO: 5). Less multiple cloning sites were available in shuttle vector pHY300PLK, and therefore P was designed ₄₃ The primer of (4) is prepared by adding a recognition sequence for SphI or XhoI endonuclease to the 3-terminus of the primer at the same time. The RBS sequence-containing amplification primers were designed based on the nucleotide sequences of genes xylB, xylC, yjhG, and yjhH as follows (underlined HindIII restriction sites, double-underlined wavy lines indicating XhoI restriction sites, single wavy lines indicating SphI, dotted lines indicating SalI, and double-underlined RBS sequences), and the plasmids were designed as follows, and the primers were synthesized by Scophthal Ltd.

P43-F：AACGGCTTTGCCCAAGCTTTGATAGGTGGTATGTTTTCGCTTGA

P43-R：

xylB-R：ACGTAACTTGCGCGGTCATAGCTATACCCTCCTTGGTTAGCGCCAGCCCGCATCG

xylC-F：

xylC-R：TTATAACAGGAATTCTTAAACCAGACGAACTTCATGCTGTGGCT

yjhG-F：

yjhG-R：AATATTGCGAACAGACATAGCTATACCCTCCTTGGTCAGACTGGTAAAATGCC

yjhH-F：

yjhH-R：AATTGATCCTTTTTTTATAACAGCGAGCTCTCAGTTTTTATTCATAAAATCGCGC

pHY300-F：AGCGGAATGACACCGGTAAACCGAA

pHY300-R：AGGAATCATTGTCATTAGTTGGCTG

(2) And (3) constructing a glycolaldehyde anaplement TCA module expression vector pHP13P 03. Design and synthesis of amplification primers for genes aldA (SEQ IS NO: 8), aceB (SEQ IS NO: 6) and mdh (SEQ IS NO: 7). Based on the nucleotide sequences of aldA, aceB and mdh genes, amplification primers containing RBS sequences were designed as follows (hind iii restriction site underlined, double-underlined wavy line XhoI restriction site, single-wavy line SphI, dotted line SalI, double-underlined RBS sequence), and primers for plasmid PHP13 were designed as follows, and the primers were synthesized by optima biotechnology limited.

pHP13P43-F：

pHP13P43-R：

aceB-F：

aceB-R：GAGGACTGCGACTTTCATAGCTATACCCTCCTTGGGAGCTCTTACGCTAACAGGCGGT

mdh-F：

mdh-R：TTGTAAAACGACGGCCAGTGAATTCTTACTTATTAACGAACTCTT

aldA-F：

aldA-R：AGTCATAGTAGTTCCTCCTTATGTCTCGAGTTAAGACTGTAAATAAACCACCTGG

pHP13-F：AAGCGGAAGAGCGCCCAATACGCA

pHP13-R：GTGATGGTTATCATGCAGGATTGT

(3) Extraction of Escherichia coli MG1655 (NC-000913.3) and Bacillus subtilis 168 (NC-000964.3) genomes. Culturing at 220rpm and 37 ℃ overnight in an LB liquid culture medium to obtain fresh bacterial liquid for extracting genome, collecting about 1-5mL of cultured bacterial liquid, centrifuging at 12000r/min, discarding supernatant and collecting thalli; adding 1mL of sterile water to sufficiently suck suspended thalli, centrifuging at 12000r/min for 30s, and repeating the steps for 2-3 times in order to prevent medium components from remaining; adding 100uL of bacteria breaking buffer solution into the thalli obtained in the last step, blowing, sucking and re-suspending, and carrying out vortex oscillation for 3min; weighed 0.2g of quartz sand was added, 200uL of phenol: chloroform: isopropanol =25, and vortex shaking the genomic extract of fig. 1 for 3min again; absorbing 10uL of 10 × TE buffer solution, adding into the buffer solution, mixing uniformly, and carrying out vortex oscillation for 3min; centrifuging at 12000r/min for 5min, and carefully sucking the supernatant into a clean and sterile 1.5mL centrifuge tube; adding 20uL 3M sodium acetate solution and 900uL absolute ethyl alcohol into the obtained supernatant, slightly reversing the mixture up and down, uniformly mixing the mixture, and standing the mixture at room temperature for 30min; centrifuging at 12000r/min, discarding supernatant, and resuspending with 70% ethanol, washing and precipitating for 3-4 times; centrifuging at 12000r/min for 10min, collecting precipitate, draining liquid in the centrifuge tube, air drying at room temperature until no ethanol residue is left, adding 20-50uL ddH2O to dissolve precipitate, and storing at-20 deg.C.

(4) Promoter P ₄₃ Amplification of genes xylB, xylC, yjhG and yjhH, aceB, mdh, aldA. Taking the genome of the extracted Bacillus subtilis 168 as a template and the synthesized P43-F and P43-R asPrimer amplification of P ₄₃ A gene; taking SEQ ID NO. 2 and SEQ ID NO. 2 sequences as templates, and amplifying xylB and xylC genes by using primers xylB-F/R and xylC-F/R; PCR amplification of yjhG, yjhH, aceB, mdh and aldA genes was carried out using the extracted Escherichia coli MG1655 genome as a template and the synthesized yjhG-F/yjhG-R, yjhH-F/yjhH-R, aceB-F/aceB-R, mdh-F/mdh-R and aldA-F/aldA-R as primers.

The reaction system of PCR is: the PCR reaction system is as follows: the total volume is 50 mu L, 17 mu L of sterile water, 25 mu L of 2 XPhanta Max Buffer, 1 mu L of dNTP Mix, 2 mu L of upstream primer, 2 mu L of downstream primer, 1 mu L of Phanta Max Super Fidelity DNA Polymerase and 2 mu L of template; the PCR reaction program is: 95 ℃ 3min,95 ℃ 1. Sup. 5s,72 ℃ 60s/kb,72 ℃ 5min,4 ℃ heat preservation, cycle number: 30.

(5) The promoter P ₄₃ Vector pHY300PLK was ligated. Carrying out HindIII and SalI double enzyme digestion reaction on the vector, and carrying out P ligation by using a seamless cloning connection system ₄₃ The promoter gene fragment was ligated to the linearized vector pHY300PLK.

(6) Screening of vector pHY300P01. Transferring the ligation product into Escherichia coli DH5 alpha competence, coating on LB solid culture medium (peptone 10g/L, yeast powder 5g/L, sodium chloride 10g/L, agar 20 g/L) containing 100 mu g/mL ampicillin resistance, culturing at 37 ℃ for 16-18 hours, picking up transformants for colony PCR verification, verifying that the fragments are in accordance with theoretical fragments, namely screening out correct recombinant vector pHY300P01, as shown in figure 1, performing PCR amplification verification of vector HindIII-XhoI double enzyme digestion and plasmid primer pHY300-F/R, and the electrophoresis result is in accordance with the theoretical lengths of 4895bp, 280bp and 644 bp.

(7) The genes xylB and xylC are connected into a vector pHY300P01. The vector was subjected to XhoI and EcoRI endonuclease reactions, and xylB and xylC were ligated into the linearized plasmid pHY300P01 using a seamless cloning ligation system.

(8) Screening of vector pHY300P02. The ligation product is transformed into Escherichia coli DH5 alpha competence, spread on LB solid medium (peptone 10g/L, yeast powder 5g/L, sodium chloride 10g/L, agar 20 g/L) containing 100. Mu.g/mL ampicillin resistance, cultured at 37 ℃ for 16-18 hours, transformants are picked for colony PCR verification, the verification fragment is in accordance with the theoretical fragment, namely, correct recombinant vector pHY300P02 is screened out, as shown in figure 2, the PCR amplification verification of genes xylB and xylC and HindIII-EcoRI enzyme digestion verification of vector pHY300P02 are in accordance with the length of the theoretical sequence.

(9) The genes yjhG and yjhH were ligated into the vector pHY300P02. The vector was subjected to EcoRI single cleavage and yjhG and yjhH were ligated into the linearized plasmid pHY300P02 using a seamless cloning ligation system.

(10) Screening of vector pHY300P 03. The ligation product is transformed into Escherichia coli DH5 alpha competence, spread on LB solid culture medium (peptone 10g/L, yeast powder 5g/L, sodium chloride 10g/L, agar 20 g/L) containing 100 mug/mL ampicillin resistance, cultured for 16-18 hours at 37 ℃, the transformant is picked for colony PCR verification, the verification fragment is in accordance with the theoretical fragment, namely, the correct recombinant vector pHY300P03 is screened out, as shown in figure 3, the primers pHY300-F/R and the primer yjhG-F/yjhH-R respectively are used for PCR amplification verification of the vector pHY300P03, the electrophoresis result is in accordance with the theoretical lengths of 5175bp and 2909bp, and figure 7 is a schematic diagram of the construction process of the pHY300P 03.

(11) The promoter P ₄₃ Ligated into vector pHP13. Carrying out HindIII and SalI double enzyme digestion reaction on the vector, and carrying out P ligation by using a seamless cloning connection system ₄₃ The promoter gene fragment was ligated to the linearized vector pHP13.

(12) Screening of vector pHP13P01. Transforming the ligation product into Escherichia coli DH5 alpha competence, coating on LB solid medium (peptone 10g/L, yeast powder 5g/L, sodium chloride 10g/L, agar 20 g/L) containing 100 mu g/mL chloramphenicol resistance, culturing at 37 ℃ for 16-18 hours, selecting transformants for colony PCR verification, verifying that the fragments are consistent with theoretical fragments, namely screening out correct recombinant vector pHP13P01, as shown in figure 4, performing HindIII-EcoRI double digestion and pHP13-F/R amplification verification on the vector pHP13P01, and ensuring that the electrophoresis results are consistent with theoretical lengths of 4713bp, 344bp and 889 bp.

(13) The genes aceB and mdh are connected into a carrier pHP13P01. The vector was subjected to a double restriction reaction of XhoI and EcoRI, and aceB and mdh were ligated into the linearized plasmid pHP13P01 using a seamless cloning ligation system.

(14) Screening of vector pHP13P02. And (3) transforming the ligation product into a bacillus coli DH5 alpha competence, coating the bacillus coli DH5 alpha competence on an LB solid culture medium (peptone 10g/L, yeast powder 5g/L, sodium chloride 10g/L and agar 20 g/L) containing 100 mu g/mL chloramphenicol resistance, culturing at 37 ℃ for 16-18 hours, selecting a transformant for colony PCR verification, and verifying that the fragment conforms to a theoretical fragment, namely screening out a correct recombinant vector pHP13P02 which is shown in figure 5 and is XhoI single enzyme digestion of a plasmid vector and PCR amplification verification of primers pHP13-F/R and aceB-F/mdh-R, wherein the electrophoresis result is consistent with the lengths of 7592bp, 3424bp and 2582bp of the theoretical sequence.

(15) The gene aldA was ligated into the vector pHP13P02. The vector was subjected to SphI and XhoI double digestion reactions, and aldA was ligated into linearized plasmid pHP13P02 using a seamless cloning ligation system.

(16) Screening of vector pHP13P 03. The ligation product is transformed into Escherichia coli DH5 alpha competence, spread on LB solid culture medium (peptone 10g/L, yeast powder 5g/L, sodium chloride 10g/L, agar 20 g/L) containing 100 mug/mL chloramphenicol resistance, cultured for 16-18 hours at 37 ℃, selected transformant for colony PCR verification, and verified fragments are in accordance with theoretical fragments, namely, correct recombinant vector pHP13P03 is screened out, as shown in figure 6, PCR amplification verification of vector by primers pHP13-F/R, electrophoresis result is consistent with theoretical length 4640bp, figure 8 is a schematic diagram of construction process of pHP 1303.

Example two: electric shock transformation of recombinant vectors pHY300P03 and pHP13P03 into BSU00

(1) Electrotransformation competent preparation of Bacillus subtilis

Performing streak culture and activation on a solid LB plate of the bacillus subtilis preserved at the temperature of-80 ℃ for 16h, selecting a single colony, inoculating the single colony into 50mL of liquid LB culture medium, and performing overnight culture at the temperature of 220rpm and 37 ℃; inoculating into fresh LBS growth medium at 4%, culturing at 37 deg.C and 220rpm until OD600 is 0.85-0.95; collecting bacterial liquid in a 50mL clean sterilized centrifugal tube, and precooling for 30min on ice; centrifuging at 6000rpm and 4 deg.C for 10min, and removing supernatant; washing and resuspending the thallus with 20mL of washing medium, slowly and gently sucking while paying attention to the air suction, centrifuging at 6000rpm for 10min at 4 ℃, and pouring out the supernatant; repeating the previous step for 2-3 times; resuspending the obtained thallus by using 1mL of electrotransfer resuspension culture medium, and subpackaging each 100 mu L of thallus into a clean and sterile 1.5mL centrifuge tube, and preserving at-80 ℃ for later use;

(2) Electrotransformation Screen of vector pHY300P03

Placing competence on ice, adding 4-6 μ L of plasmid per 100 μ L of competence in sterile environment, and flexibly adjusting according to the concentration of the extracted plasmid; pre-cooling the electric rotating cup on ice, and transferring competence of the added plasmid into the electric rotating cup; setting parameters of an electric rotating instrument, wherein the voltage is 1.8kV to 2.5kV, and the electric shock time is generally 4.5.ms to 5.ms; immediately adding 900 mu L of resuscitation medium preheated at 37 ℃ after the electric shock is finished, culturing at 220rpm and 37 ℃ for 3 hours; centrifuging at 5000rpm for 3min, suspending thallus in 200 μ L culture medium, adding into solid culture medium containing tetracycline antibiotic, and coating with rod; culturing in an incubator at 37 ℃ and screening transformants;

(3) Transformant screening of vectors pHP13P03 and pHY300P03

Placing competence on ice, adding 4-6 μ L of plasmid per 100 μ L of competence in sterile environment, and flexibly adjusting according to the concentration of the extracted plasmid; pre-cooling the electric rotating cup on ice, and transferring competence of the added plasmid into the electric rotating cup; setting parameters of an electric rotating instrument, wherein the voltage is 1.8kV to 2.5kV, and the electric shock time is generally 4.5.ms to 5.ms; immediately adding 900 mu L of resuscitation medium preheated at 37 ℃ after the electric shock is finished, culturing at 220rpm and 37 ℃ for 3 hours; centrifuging at 5000rpm for 3min, suspending thallus in 200 μ L culture medium, adding into solid culture medium containing tetracycline and chloramphenicol antibiotic, and coating with rod; culturing in 37 deg.C incubator, and screening transformants, as shown in FIG. 9, for metabolism of two groups of modules;

example three: fermentation experiment for producing fengycin by using recombinant strain BSU02 xylose as carbon source

(1) The components of the culture medium:

solid medium: 10g/L of peptone, 5g/L of yeast powder, 10g/L of sodium chloride and 20g/L of agar;

seed culture medium: 10g/L of peptone, 5g/L of yeast powder and 10g/L of sodium chloride;

fermentation medium: 15g/L of xylose, 21.9g/L of soybean cake powder and NaNO ₃ 3g/L，MnSO ₄ 0.2g/L；

(2) Fermentation experiment: culturing and activating the strain BSU02 constructed by the invention in a solid culture medium at 37 ℃ for 20h, selecting a single colony in a 250mL shake flask filled with 50mL seed culture medium, culturing at 37 ℃ and 220rpm overnight, measuring a fermentation seed solution according to 5% of inoculation amount into the fermentation culture medium, culturing at 30 ℃ and 200rpm for 60h, and ending fermentation.

(3) Extraction and determination of fengycin: and (2) centrifuging 20mL of fermentation liquor in a 50mL centrifuge tube at 8000rpm and 4 ℃ for 30min, removing thallus precipitates, adding 6M HCl into supernatant to adjust the pH to 2.0, precipitating free fengycin in the fermentation liquor, standing overnight at 4 ℃, centrifuging at 8000rpm and 4 ℃ for 30min, collecting acid precipitates, extracting with 3mL of pure methanol solvent, adjusting the pH to 7 with 0.2M NaOH after extraction is finished, and centrifuging to collect supernatant, namely the crude extract containing fengycin. The crude extract obtained by the treatment of the fermentation broth was passed through a 0.22. Mu.M filter and subjected to HPLC (Agilent 1200, USA) analysis using a column 4.6X 150mm XDB C18, with acetonitrile/water/trifluoroacetic acid (50. The fermentation yield result shows that the fermentation yield of the strain BSU02 for synthesizing fengycin by xylose, which is constructed by the method and is expressed by combining the Dahms module and the glycolaldehyde anaplerosis TCA module through the regulation and control module, reaches 46.82mg/L.

The construction method of the engineering strain BSU02 provided by the invention provides a new strategy for improving the yield of fengycin by utilizing xylose.

While the methods and techniques of the present invention have been described in terms of preferred embodiments, it will be apparent to those of ordinary skill in the art that variations and/or modifications of the methods and techniques described herein may be made without departing from the spirit and scope of the invention. It is expressly intended that all such similar substitutes and modifications apparent to those skilled in the art are deemed to be within the spirit, scope and content of the invention.

Sequence listing

<110> Tianjin university

<120> construction method of synthetic strain for generating fengycin by transforming xylose by regulating Dahms approach

<160> 8

<170> SIPOSequenceListing 1.0

<210> 1

<211> 280

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

tgataggtgg tatgttttcg cttgaacttt taaatacagc cattgaacat acggttgatt 60

taataactga caaacatcac cctcttgcta aagcggccaa ggacgctgcc gccggggctg 120

tttgcgtttt tgccgtgatt tcgtgtatca ttggtttact tatttttttg ccaaagctgt 180

aatggctgaa aattcttaca tttattttac atttttagaa atgggcgtga aaaaaagcgc 240

gcgattatgt aaaatataaa gtgatagcgg taccattata 280

<210> 2

<211> 747

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

atgagcagcg cgatctaccc gagcctcaaa ggcaagcgcg ttgttatcac cggtggcggt 60

agcggtattg gtgccggtct gaccgccggt tttgcccgtc aaggcgcgga ggtgatcttt 120

ctggacatcg cggacgaaga tagtcgcgcg ctcgaagccg aactcgccgg tagtccaatc 180

ccgccggttt acaagcgctg cgatctgatg aatctggaag ccatcaaagc ggtgtttgcg 240

gagatcggtg atgtggacgt tctggtgaac aacgcgggca atgacgaccg ccacaaactg 300

gccgatgtta ccggtgccta ctgggacgaa cgcatcaacg tgaatctccg ccacatgctg 360

ttttgcacgc aagccgttgc gccgggcatg aaaaagcgcg gtggcggcgc cgttatcaac 420

ttcggcagta tcagctggca cctcggtctg gaagatctgg tgctgtacga gaccgcgaaa 480

gccggcatcg aaggtatgac ccgtgcgctg gcccgtgaac tcggcccaga tgacattcgc 540

gtgacgtgcg ttgttccggg taacgtgaaa accaagcgcc aagaaaagtg gtacacgcca 600

gaaggtgagg cccaaattgt tgccgcccag tgtctgaaag gccgcattgt tccggagaat 660

gttgccgcgc tggttctgtt cctcgcgagc gatgatgcca gtctgtgcac gggccatgaa 720

tactggatcg atgcgggctg gcgctaa 747

<210> 3

<211> 870

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

atgaccgcgc aagttacgtg cgtgtgggat ctgaaagcga cgctgggtga aggcccgatc 60

tggcatggtg acacgctgtg gtttgtggac atcaagcagc gcaagatcca caattaccac 120

ccagccacgg gtgaacgctt tagctttgat gcgccagacc aagttacgtt tctggcccca 180

attgttggcg ccaccggttt cgttgtgggt ctgaagaccg gtatccaccg cttccaccca 240

gcgacgggtt tcagtctgct gctggaagtt gaggacgccg cgctgaacaa tcgcccgaat 300

gatgccaccg tggatgcgca aggccgtctg tggttcggca ccatgcacga tggcgaggaa 360

aacaacagcg gcagtctgta tcgtatggat ctgaccggtg ttgcgcgcat ggaccgcgat 420

atttgcatta ccaacggccc atgcgtgagc ccggatggca aaacgttcta ccacacggat 480

acgctggaga agacgatcta tgcgttcgat ctggcggaag acggtctgct gagcaataag 540

cgcgtgttcg ttcagtttgc cctcggtgac gacgtttacc cggacggcag cgttgttgat 600

agcgaaggtt atctgtggac cgcgctgtgg ggtggttttg gtgccgttcg cttcagccca 660

caaggcgatg cggttacgcg catcgaactg ccggccccaa atgttacgaa gccgtgcttc 720

ggtggtccgg atctgaaaac gctgtacttc accacggcgc gtaaaggtct cagcgacgaa 780

acgctggccc aatatccact cgccggtggc gtttttgcgg ttccagttga cgttgccggt 840

cagccacagc atgaagttcg tctggtttaa 870

<210> 4

<211> 1968

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

atgtctgttc gcaatatttt tgctgacgag agccacgata tttacaccgt cagaacgcac 60

gccgatggcc cggacggcga actcccatta accgcagaga tgcttatcaa ccgcccgagc 120

ggggatctgt tcggtatgac catgaatgcc ggaatgggtt ggtctccgga cgagctggat 180

cgggacggta ttttactgct cagtacactc ggtggcttac gcggcgcaga cggtaaaccc 240

gtggcgctgg cgttgcacca ggggcattac gaactggaca tccagatgaa agcggcggcc 300

gaggttatta aagccaacca tgccctgccc tatgccgtgt acgtctccga tccttgtgac 360

gggcgtactc agggtacaac ggggatgttt gattcgctac cataccgaaa tgacgcatcg 420

atggtaatgc gccgccttat tcgctctctg cccgacgcga aagcagttat tggtgtggcg 480

agttgcgata aggggcttcc ggccaccatg atggcactcg ccgcgcagca caacatcgca 540

accgtgctgg tccccggcgg cgcgacgctg cccgcaaagg atggagaaga caacggcaag 600

gtgcaaacca ttggcgcacg cttcgccaat ggcgaattat ctctacagga cgcacgccgt 660

gcgggctgta aagcctgtgc ctcttccggc ggcggctgtc aatttttggg cactgccggg 720

acatctcagg tggtggccga aggattggga ctggcaatcc cacattcagc cctggcccct 780

tccggtgagc ctgtgtggcg ggagatcgcc agagcttccg cgcgagctgc gctgaacctg 840

agtcaaaaag gcatcaccac ccgggaaatt ctcaccgata aagcgataga gaatgcgatg 900

acggtccatg ccgcgttcgg tggttcaaca aacctgctgt tacacatccc ggcaattgct 960

caccaggcag gttgccatat cccgaccgtt gatgactgga tccgcatcaa caagcgcgtg 1020

ccccgactgg tgagcgtact gcctaatggc ccggtttatc atccaacggt caatgccttt 1080

atggcaggtg gtgtgccgga agtcatgttg catctgcgca gcctcggatt gttgcatgaa 1140

gacgttatga cggttaccgg cagcacgctg aaagaaaacc tcgactggtg ggagcactcc 1200

gaacggcgtc agcggttcaa gcaactcctg ctcgatcagg aacaaatcaa cgctgacgaa 1260

gtgatcatgt ctccgcagca agcaaaagcg cgcggattaa cctcaactat caccttcccg 1320

gtgggcaata ttgcgccaga aggttcggtg atcaaatcca ccgccattga cccctcgatg 1380

attgatgagc aaggtatcta ttaccataaa ggtgtggcga aggtttatct gtccgagaaa 1440

agtgcgattt acgatatcaa acatgacaag atcaaggcgg gcgatattct ggtcattatt 1500

ggcgttggac cttcaggtac agggatggaa gaaacctacc aggttaccag tgccctgaag 1560

catctgtcat acggtaagca tgtttcgtta atcaccgatg cacgtttctc gggcgtttct 1620

actggcgcgt gcatcggcca tgtggggcca gaagcgctgg ccggaggccc catcggtaaa 1680

ttacgcaccg gggatttaat tgaaattaaa attgattgtc gcgagcttca cggcgaagtc 1740

aatttcctcg gaacccgtag cgatgaacaa ttaccttcac aggaggaggc aactgcaata 1800

ttaaatgcca gacccagcca tcaggattta cttcccgatc ctgaattgcc agatgatacc 1860

cggctatggg caatgcttca ggccgtgagt ggtgggacat ggaccggttg tatttatgat 1920

gtaaacaaaa ttggcgcggc tttgcgcgat tttatgaata aaaactga 1968

<210> 5

<211> 906

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

atgaaaaaat tcagcggcat tattccaccg gtatccagca cgtttcatcg tgacggaacc 60

cttgataaaa aggcaatgcg cgaagttgcc gacttcctga ttaataaagg ggtcgacggg 120

ctgttttatc tgggtaccgg tggtgaattt agccaaatga atacagccca gcgcatggca 180

ctcgccgaag aagctgtaac cattgtcgac gggcgagtgc cggtattgat tggcgtcggt 240

tccccttcca ctgacgaagc ggtcaaactg gcgcagcatg cgcaagccta cggcgctgat 300

ggtatcgtcg ccatcaaccc ctactactgg aaagtcgcac cacgaaatct tgacgactat 360

taccagcaga tcgcccgtag cgtcacccta ccggtgatcc tgtacaactt tccggatctg 420

acgggtcagg acttaacccc ggaaaccgtg acgcgtctgg ctctgcaaaa cgagaatatc 480

gttggcatca aagacaccat cgacagcgtt ggtcacttgc gtacgatgat caacacagtt 540

aagtcggtac gcccgtcgtt ttcggtattc tgcggttacg atgatcattt gctgaatacg 600

atgctgctgg gcggcgacgg tgcgataacc gccagcgcta actttgctcc ggaactctcc 660

gtcggcatct accgcgcctg gcgtgaaggc gatctggcga ccgctgcgac gctgaataaa 720

aaactactac aactgcccgc tatttacgcc ctcgaaacac cgtttgtctc actgatcaaa 780

tacagcatgc agtgtgtcgg gctgcctgta gagacatatt gcttaccacc gattcttgaa 840

gcatctgaag aagcaaaaga taaagtccac gtgctgctta ccgcgcaggg cattttacca 900

gtctga 906

<210> 6

<211> 1602

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

atgactgaac aggcaacaac aaccgatgaa ctggctttca caaggccgta tggcgagcag 60

gagaagcaaa ttcttactgc cgaagcggta gaatttctga ctgagctggt gacgcatttt 120

acgccacaac gcaataaact tctggcagcg cgcattcagc agcagcaaga tattgataac 180

ggaacgttgc ctgattttat ttcggaaaca gcttccattc gcgatgctga ttggaaaatt 240

cgcgggattc ctgcggactt agaagaccgc cgcgtagaga taactggccc ggtagagcgc 300

aagatggtga tcaacgcgct caacgccaat gtgaaagtct ttatggccga tttcgaagat 360

tcactggcac cagactggaa caaagtgatc gacgggcaaa ttaacctgcg tgatgcggtt 420

aacggcacca tcagttacac caatgaagca ggcaaaattt accagctcaa gcccaatcca 480

gcggttttga tttgtcgggt acgcggtctg cacttgccgg aaaaacatgt cacctggcgt 540

ggtgaggcaa tccccggcag cctgtttgat tttgcgctct atttcttcca caactatcag 600

gcactgttgg caaagggcag tggtccctat ttctatctgc cgaaaaccca gtcctggcag 660

gaagcggcct ggtggagcga agtcttcagc tatgcagaag atcgctttaa tctgccgcgc 720

ggcaccatca aggcgacgtt gctgattgaa acgctgcccg ccgtgttcca gatggatgaa 780

atccttcacg cgctgcgtga ccatattgtt ggtctgaact gcggtcgttg ggattacatc 840

ttcagctata tcaaaacgtt gaaaaactat cccgatcgcg tcctgccaga cagacaggca 900

gtgacgatgg ataaaccatt cctgaatgct tactcacgcc tgttgattaa aacctgccat 960

aaacgcggtg cttttgcgat gggcggcatg gcggcgttta ttccgagcaa agatgaagag 1020

cacaataacc aggtgctcaa caaagtaaaa gcggataaat cgctggaagc caataacggt 1080

cacgatggca catggatcgc tcacccaggc cttgcggaca cggcaatggc ggtattcaac 1140

gacattctcg gctcccgtaa aaatcagctt gaagtgatgc gcgaacaaga cgcgccgatt 1200

actgccgatc agctgctggc accttgtgat ggtgaacgca ccgaagaagg tatgcgcgcc 1260

aacattcgcg tggctgtgca gtacatcgaa gcgtggatct ctggcaacgg ctgtgtgccg 1320

atttatggcc tgatggaaga tgcggcgacg gctgaaattt cccgtacctc gatctggcag 1380

tggatccatc atcaaaaaac gttgagcaat ggcaaaccgg tgaccaaagc cttgttccgc 1440

cagatgctgg gcgaagagat gaaagtcatt gccagcgaac tgggcgaaga acgtttctcc 1500

caggggcgtt ttgacgatgc cgcacgcttg atggaacaga tcaccacttc cgatgagtta 1560

attgatttcc tgaccctgcc aggctaccgc ctgttagcgt aa 1602

<210> 7

<211> 939

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

atgaaagtcg cagtcctcgg cgctgctggc ggtattggcc aggcgcttgc actactgtta 60

aaaacccaac tgccttcagg ttcagaactc tctctgtatg atatcgctcc agtgactccc 120

ggtgtggctg tcgatctgag ccatatccct actgctgtga aaatcaaagg tttttctggt 180

gaagatgcga ctccggcgct ggaaggcgca gatgtcgttc ttatctctgc aggcgtagcg 240

cgtaaaccgg gtatggatcg ttccgacctg tttaacgtta acgccggcat cgtgaaaaac 300

ctggtacagc aagttgcgaa aacctgcccg aaagcgtgca ttggtattat cactaacccg 360

gttaacacca cagttgcaat tgctgctgaa gtgctgaaaa aagccggtgt ttatgacaaa 420

aacaaactgt tcggcgttac cacgctggat atcattcgtt ccaacacctt tgttgcggaa 480

ctgaaaggca aacagccagg cgaagttgaa gtgccggtta ttggcggtca ctctggtgtt 540

accattctgc cgctgctgtc acaggttcct ggcgttagtt ttaccgagca ggaagtggct 600

gatctgacca aacgcatcca gaacgcgggt actgaagtgg ttgaagcgaa ggccggtggc 660

gggtctgcaa ccctgtctat gggccaggca gctgcacgtt ttggtctgtc tctggttcgt 720

gcactgcagg gcgaacaagg cgttgtcgaa tgtgcctacg ttgaaggcga cggtcagtac 780

gcccgtttct tctctcaacc gctgctgctg ggtaaaaacg gcgtggaaga gcgtaaatct 840

atcggtaccc tgagcgcatt tgaacagaac gcgctggaag gtatgctgga tacgctgaag 900

aaagatatcg ccctgggcga agagttcgtt aataagtaa 939

<210> 8

<211> 1329

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

atacccgatg gtcaggccga ggatgcccgt aaggcaatcg atgcagcaga acgtgcacaa 60

ccagaatggg aagcgttgcc tgctattgaa cgcgccagtt ggttgcgcaa aatctccgcc 120

gggatccgcg aacgcgccag tgaaatcagt gcgctgattg ttgaagaagg gggcaagatc 180

cagcagctgg ctgaagtcga agtggctttt actgccgact atatcgatta catggcggag 240

tgggcacggc gttacgaggg cgagattatt caaagcgatc gtccaggaga aaatattctt 300

ttgtttaaac gtgcgcttgg tgtgactacc ggcattctgc cgtggaactt cccgttcttc 360

ctcattgccc gcaaaatggc tcccgctctt ttgaccggta ataccatcgt cattaaacct 420

agtgaattta cgccaaacaa tgcgattgca ttcgccaaaa tcgtcgatga aataggcctt 480

ccgcgcggcg tgtttaacct tgtactgggg cgtggtgaaa ccgttgggca agaactggcg 540

ggtaacccaa aggtcgcaat ggtcagtatg acaggcagcg tctctgcagg tgagaagatc 600

atggcgactg cggcgaaaaa catcaccaaa gtgtgtctgg aattgggggg taaagcacca 660

gctatcgtaa tggacgatgc cgatcttgaa ctggcagtca aagccatcgt tgattcacgc 720

gtcattaata gtgggcaagt gtgtaactgt gcagaacgtg tttatgtaca gaaaggcatt 780

tatgatcagt tcgtcaatcg gctgggtgaa gcgatgcagg cggttcaatt tggtaacccc 840

gctgaacgca acgacattgc gatggggccg ttgattaacg ccgcggcgct ggaaagggtc 900

gagcaaaaag tggcgcgcgc agtagaagaa ggggcgagag tggcgttcgg tggcaaagcg 960

gtagagggga aaggatatta ttatccgccg acattgctgc tggatgttcg ccaggaaatg 1020

tcgattatgc atgaggaaac ctttggcccg gtgctgccag ttgtcgcatt tgacacgctg 1080

gaagatgcta tctcaatggc taatgacagt gattacggcc tgacctcatc aatctatacc 1140

caaaatctga acgtcgcgat gaaagccatt aaagggctga agtttggtga aacttacatc 1200

aaccgtgaaa acttcgaagc tatgcaaggc ttccacgccg gatggcgtaa atccggtatt 1260

ggcggcgcag atggtaaaca tggcttgcat gaatatctgc agacccaggt ggtttattta 1320

cagtcttaa 1329

Claims

1. A method for constructing a synthetic strain for generating fengycin by converting xylose by regulating and controlling a Dahms approach; the construction method is characterized in that a Dahms approach module and a regulation module glycolaldehyde anaplerosis TCA module are combined to express and convert xylose to synthesize the strain of fengycin; starting from the synthetic precursor supply of fengycin, the promoter gene P from Bacillus subtilis ₄₃ And xylose dehydrogenase xylB and xylonolactonase xylC from Caulobacter crescentus and xylonate dehydratase gene yjhG and 2-keto-3-deoxyxylonate dehydratase gene yjhH from Escherichia coli MG1655 are connected in series to prepare a Dahms xylose pathway module into a shuttle vector pHY300 PLK; simultaneously, aldehyde dehydrogenase gene aldA, malate synthase aceB, malate dehydrogenase mdh and promoter P from escherichia coli ₄₃ Serially connecting to prepare a glycolaldehyde anaplerosis TCA regulation module to a shuttle vector pHP13 vector; coexpression is carried out on the two shuttle vector chassis strains, and a strain which is synthesized into fengycin by coexpression conversion of xylose by a Dahms module and a regulation module of glycolaldehyde is constructed.

2. The method of claim 1, comprising the steps of:

8) Connecting the amplified gene yjhG and the amplified gene yjhH into the vector pHY300P02 constructed in the step 5) through a seamless cloning system to obtain a recombinant vector pHY300P03;

11 Designing a PCR primer according to aceB gene, and amplifying malic acid synthetase gene aceB by using Escherichia coli K-12MG1655 genome as a template;

12 Designing PCR primers according to the mdh gene, and amplifying the malate dehydrogenase gene mdh by using an Escherichia coli K-12MG1655 genome as a template;

16 Introducing the recombinant vector pHY300P03 constructed in the step 8) and the recombinant vector pHP13P03 constructed in the step 15) into B.subtilis 168 modified bacteria by an electrotransformation method, and constructing a strain in which a Dahms module and a regulation module, namely a glycolaldehyde anaplerosis TCA module, are combined to express and transform xylose to synthesize fengycin.

3. The method of claim 2, wherein P is ₄₃ The sequence of the promoter is shown as SEQ ID NO. 1.

4. The method of claim 2, wherein the xylB gene has the sequence shown in SEQ ID NO 2.

5. The method of claim 2, wherein the xylC gene has the sequence shown in SEQ ID NO 3.

6. The method as claimed in claim 2, wherein the yjhG gene has the sequence shown in SEQ ID NO. 4.

7. The method as claimed in claim 2, wherein the sequence of the yjhH gene is shown in SEQ ID NO. 5.

8. The method as claimed in claim 2, wherein the sequence of the aceB gene is shown in SEQ ID NO 6.

9. The method as claimed in claim 2, wherein the mdh gene has the sequence shown in SEQ ID NO 7.

10. The method according to claim 2, wherein the sequence of the aldA gene is as shown in SEQ ID NO 8.