CN110551671B - Surfactin producing genetic engineering bacterium and construction method and application thereof - Google Patents

Abstract

The invention discloses a surfactin producing genetic engineering bacterium and a construction method and application thereof. The engineering bacteria take bacillus subtilis168 as a host cell, and a synthetic pathway of surfactin synthetic precursor 3-hydroxy fatty acyl CoA is strengthened by a genetic engineering means. The obtained genetic engineering bacteria are classified and named as Bacillus subtilis BSFX022, and the preservation number is CCTCC NO: m2019254. The finally obtained engineering bacterium bacillus subtilis BSFX022 is used for producing surfactin by fermentation, and the yield of the engineering bacterium bacillus subtilis BSFX022 is 2.39 times that of a control strain; in addition, the method of adding 10-20 mM of L-leu into the culture medium can improve the yield of surfactin by about 20% on the original basis. When xylose is used as a carbon source, the strain can efficiently synthesize surfactin, and the accumulation amount of organic acid byproducts is low; based on the invention, the invention provides a fermentation process for synthesizing surfactin by using a phosphate buffer-free fermentation system. In order to further reduce the cost, the diluted acid hydrolysate of the corncobs rich in xylose and the waste fermentation liquid of the monosodium glutamate rich in amino acid are used as raw materials, and the fermentation yield of surfactin of the recombinant bacteria can reach 2032 mg/L.

Description

Surfactin producing genetic engineering bacterium and construction method and application thereof

Technical Field

The invention belongs to the technical field of genetic engineering, and particularly relates to a surfactin producing genetic engineering bacterium, and a construction method and application thereof.

Background

As people pay more and more attention to green chemicals and industrial processes, low-toxicity, environmentally friendly and biodegradable biosurfactants have attracted great interest to researchers. Biosurfactants are classified into glycolipids, phospholipids, lipopeptides, lipoproteins, polymeric surfactants and particulate surfactants according to their natural chemical structure and microbial origin. Wherein, the lipopeptide is a kind of antibacterial peptide consisting of a hydrophilic peptide ring and a hydrophobic fatty acid part. Lipopeptides can be divided into two groups according to their structural characteristics: cyclic Lipopeptides (CLPs) and linear lipopeptides. The cyclic lipopeptides discovered to date are produced predominantly by bacillus subtilis, including: fengycin, iturin and surfactin.

Biosurfactant surfactin, a secondary metabolite found in Bacillus subtilis culture medium, is one of the most reported lipopeptides with broad-spectrum antibacterial activity. The hydrophobic head of Surfactin is composed of a beta-hydroxy fatty acid chain of 13-16 carbon atoms, and the hydrophilic tail is a cyclic heptapeptide, typically containing L-glutamic acid (L-Glu), L-aspartic acid (L-Asp), L-valine (L-Val), L-leucine (L-Leu), and D-leucine (D-Leu)). Due to the unique structure of the Surfactin, the Surfactin not only can reduce the surface tension of water from 72mN/m to 27mN/m, but also has high thermal stability and salt resistance. Thus, Surfactin has great potential in enhancing oil recovery. In addition, surfactin is widely used in the environment, medicine, food and the like,

the yield of wild strains for producing surfactin is low, about 500mg/L, and far from meeting the industrial application scale of surfactin. A common method for increasing yield is fermentation optimization, which involves many factors such as: dissolved oxygen, pH, temperature, stirringSpeed, medium composition and reactor, etc. However, with the development of molecular technology, the construction of surfactin-producing genetically engineered bacteria is receiving more and more attention. Based on the synthetic mechanism and structural studies of surfactin, surfactin is known to be synthesized by non-ribosomal peptide synthetase (NRPS) encoded by the srfA operon (srfAA, srfAB, srfAC, srfAD). Thus, the molecular modification strategy for surfactin is mainly to modify the promoter P of srfA_srfEnhancing efflux systems, modifying srfA-related expression genes, modifying NRPS domains and combining biosynthetic transcriptional regulatory genes. Common underplate cell B.subtiliss 168 has no capability of synthesizing surfactin due to frame shift mutation of sfp gene; therefore, a functional sfp gene needs to be complemented back into the 168 strain to synthesize and accumulate surfactin.

synthetic precursors of surfactin are largely divided into linear and branched fatty acyl-coas. The precursors for the synthesis of branched fatty acyl-CoA are branched amino acids and the precursors for the synthesis of linear fatty acyl-CoA are derived from the de novo fatty acid synthesis pathway. According to the known literature reports that the yield of surfactin can be greatly improved by strengthening the synthetic pathway of the branched chain amino acid L-leu. In addition, because the synthesis of surfactin is strictly regulated and controlled by pH, when the pH of a fermentation system is lower than 6.0, the synthesis of surfactin is inhibited; therefore, in the fermentation system of surfactin, a large amount of phosphate buffer system, usually 30mM potassium dihydrogen phosphate and 30-40mM disodium hydrogen phosphate, is added into the culture medium to neutralize the organic acid by-products accumulated during the fermentation process and maintain the pH of the fermentation system to be nearly neutral.

Disclosure of Invention

The first purpose of the invention is to provide a bacillus subtilis genetically engineered bacterium capable of producing surfactin with high yield.

In order to achieve the technical purpose, the invention adopts the following technical scheme:

a surfactin-producing genetically engineered bacterium is classified and named as Bacillus subtilis BSFX022, and the preservation number is CCTCC NO: m2019254.

Another purpose of the invention is to provide a construction method of the bacillus subtilis BSFX 022.

The construction method of the bacillus subtilis BSFX022 comprises the following steps of:

will contain P₄₃A promoter and an sfp gene for coding phosphopanthenyl mercaptotransferase are integrated into an original strain B.subtiliss 168 to obtain a recombinant strain, which is recorded as BSFX 01;

placing an acyl-carrier protein thioesterase (ACP) thioesterase encoding gene bte of laurel (Umbellularia California) in promoter P₄₃Under the control of (2), P₄₃-bte is integrated into the cydBC (encoding cytochrome quinol oxidase) site in Bacillus subtilis BSFX01 to obtain a recombinant strain, which is recorded as BSFX 02;

the recombinant strain BSFX02 is introduced into a promoter P₄₃Fatty acyl CoA ligase (fat acyl CoA ligase) encoding gene yhfl (P) from Bacillus belgii BS-37(B. velezensis BS-37) under control₄₃-yhfl)，P₄₃Integrating yhfl into amyE site of amylase encoding gene in bacillus subtilis BSFX02 to obtain recombinant strain BSFX 021.

Knocking out fadE in the recombinant strain BSFX021 to obtain a recombinant strain BSFX 022.

The invention further aims to provide application of the bacillus subtilis BSFX022 in fermentation production of surfactin.

The invention provides a specific application mode, which comprises the following steps:

seed culture: culturing the strain BSFX022 in a seed culture medium;

fermentation culture: inoculating a culture solution of the seed culture to a fermentation culture medium for fermentation culture;

separation and purification: centrifuging fermentation liquid obtained by fermentation culture, adding anhydrous ethanol into supernatant, and centrifuging.

The seed culture medium comprises the following components: 10g/L of peptone, 5g/L of yeast powder extract and 10g/L of sodium chloride.

The fermentation medium comprises the following components: 20g/L carbon source, 5g/L peptone, 3g/L potassium dihydrogen phosphate, 10g/L disodium hydrogen phosphate, 0.5g/L magnesium sulfate and 0.02g/L ferrous sulfate. The carbon source is sucrose, glucose, glycerol or xylose.

As a further improvement of the invention, the fermentation culture system is a phosphate-free buffer system; the fermentation medium comprises the following components: 20g/L of carbon source, 5g/L of nitrogen source, 0.5g/L of disodium hydrogen phosphate, 0.5g/L of magnesium sulfate and 0.02g/L of ferrous sulfate; the carbon source is xylose or corncob hydrolysate containing xylose; the nitrogen source is peptone or a composite nitrogen source of monosodium glutamate waste liquid and peptone.

As a further improvement of the invention, the fermentation medium is added with the branched chain amino acid L-leu; further, the branched chain amino acid L-leu is added at a concentration of 0 to 20mM, preferably 10 to 20 mM.

The invention designs a pathway for enhancing metabolism synthesis of surfactin from the perspective of improving intracellular supply of precursor 3-hydroxy fatty acyl CoA, takes B.subtilis168 as a chassis cell, and takes an isolated plasmid pHY containing sfp gene_p43-sfpIntroducing, on the basis of which an exogenous bte gene (acyl carrier protein thioesterase encoding gene of laurellularia californica), a yhfl gene (fatty acyl CoA ligase encoding gene of Bacillus belgii BS-37) are placed in a promoter P₄₃Under the regulation of the beta-fatty acid, B.subtiliss 168 chromosome is integrated, and finally fadE gene (coding acetyl CoA dehydrogenase) which leads fatty acyl CoA to enter a beta-fatty acid oxidation pathway is knocked out, so that a B.subtiliss 168 engineering bacterium for high-yield surfactin is constructed. The genetic engineering strain can utilize carbon sources such as sucrose, glucose, glycerol, xylose and the like to ferment and produce surfactin; particularly, when xylose is taken as a carbon source, the content of organic acid by-products in the fermentation system is low; the method can realize the development of the surfactin fermentation system without phosphate buffer, greatly reduce the phosphate consumption and reduce the fermentation cost. The diluted acid hydrolysate of corncobs rich in xylose and the waste liquid of monosodium glutamate rich in amino acid are used as raw materials, the yield of surfactin produced by fermentation of recombinant bacteria can reach 2032mg/L, and the method has a good application prospect.

Drawings

FIG. 1 is a reverse screening marker knockout method, a technical means provided by New professor of Nanjing university of agriculture Yan; wherein LF represents the upstream fragment of the knocked-out gene of 800bp, RF represents the knocked-out gene of 800bp, DR represents the downstream of the gene of 500bp, and PC cassette is amplified from plasmid pTPC provided by Nannong.

FIG. 2 shows a gene integration method, which is slightly modified from the knockout method, and IG indicates a target fragment to be inserted into a genome.

FIG. 3 shows the production of surfactin by fermentation of genetically engineered bacteria BSFX01, BSFX02, BSFX03, BSFX04, BSFX021 and BSFX 022.

FIG. 4 shows the effect of different concentrations of L-Leu on surfactin production by strain BSFX022, compared to fermentation data of BSFX022 supplemented with 0mM L-Leu.

FIG. 5 shows the organic acid accumulation when the genetically engineered bacteria BSFX022 utilize different carbon sources, and the gray and white are the acetic acid concentration and the lactic acid concentration, respectively.

FIG. 6 shows surfactin yield of genetically engineered bacteria BSFX022 by utilizing corncob hydrolysate and monosodium glutamate fermentation waste liquid.

The biological material is classified and named as Bacillus subtilis BSFX022, is preserved in China Center for Type Culture Collection (CCTCC) and has a preservation number of: CCTCC NO: m2019254, preservation time: year 2019, 4, 15, and the storage address: wuhan, Wuhan university.

Detailed Description

The experimental methods used in the following examples are conventional methods unless otherwise specified, and may be specifically performed by referring to the specific methods listed in the protocols of Dukelong (third edition) J. Samsburg, or according to kits and product instructions; materials, reagents and the like used in the following examples are commercially available unless otherwise specified.

Restriction enzymes, T4 ligase, were purchased from Dalibao bioengineering, and Taq enzyme was purchased from Novozan BioLimited. Other chemical reagents are domestic analytical pure chemical reagents.

The starting strain Bacillus subtilis is the existing Bacillus subtilis 168. The gene knockout method is a reverse screening labeling method, and the flow is shown in figure 1; the gene integration method is a method slightly modified based on the gene knockout method, and the flow chart is shown in FIG. 2.

Obtaining of recombinant gene and construction of recombinant plasmid

Acyl-carrier protein thioesterase (ACP) thioesterase encoding gene bte of laurel (Umbellularia California) is synthesized by Hongsansu Biotech, Inc., the complete sequence of the gene is shown in SEQ ID NO.1, the synthesized gene is constructed on plasmid pUC18 to form recombinant plasmid pUC_BTE. The yhfL gene and sfp gene were amplified using Bacillus belgii BS-37(Bacillus velezensis BS-37) as template, and the whole genome of b.velezensis BS-37 was numbered CP023414.1 in GenBank. . The integrated expression of the genes is integrated on the whole genome of the bacillus subtilis168 according to the mode of figure 2, and the promoter for regulating the expression of the genes sfp, bte and yhfl is P₄₃The whole gene sequence is SEQ ID NO. 2. The knock-out of the gene fadE on the genome of B.subtilis168 was performed in the manner described in FIG. 1.

And (3) PCR amplification: pre-denaturation at 95 ℃ for 3min, denaturation at 95 ℃ for 15s, Tm annealing for 15s, extension at 72 ℃ for 30s/1kb, and extension at 72 ℃ for 5min after 30 cycles.

Bacillus subtilis competence preparation and transformation method

Preparing bacillus subtilis competent cells according to a GM I-GM II method, transforming, and coating a corresponding resistance plate to screen recombinant bacillus subtilis. The screened strains were verified by colony PCR and subsequently sequenced by sequencing companies.

Isolation and detection of fermentation products

1mL of the fermentation broth was centrifuged at 12000rpm for 5 minutes. Then, 300uL of the supernatant was added to 1200uL of analytically pure ethanol and mixed with the mixture at 12000rpm after centrifugation for 5 minutes, and the supernatant was collected and used for HPLC detection after passing through a membrane. The mobile phase 90% (v/v) methanol was detected on Shimadzu LC-20, Venusil XBP C18-P (4.6X 150mm,5 μm) s chromatography column at a wavelength of 214nm and a flow rate of 0.8 mL/min.

Example 1 construction of Bacillus subtilis BSFX01

The first step is as follows: construction of the targeting fragment P as shown in FIG. 2₄₃-sfp. The gene integration site is 4' phosphopanthenyl mercaptotransferase sfp, and then a primer pair P is utilized₄₃-sfp-LF-F/P₄₃-sfp-LF-R and P₄₃-sfp-DR-F/P₄₃-bte-DR-R and P₄₃-sfp-RF-F/P₄₃sfp-RF-R, using the whole genome of B.subtiliss 168 as a template, and amplifying LF, DR and RF of sfp respectively. Providing P by Liulong subject group of Jiangnan university₄₃Promoter and B.velezensis genome as templates, with primer pair P₄₃-sfp-F1/P₄₃-sfp-R1，P₄₃-bte-F2/P₄₃-bte-R2 amplified fragment P₄₃'and sfp'; the pTPC plasmid provided by Nannong is used as a template, and the PC cassette is amplified by using a PC-F/PC-R primer. Subsequently with primer P₄₃Amplifying a targeting fragment LF-P by using LF, P43 ', sfp', DR, PC cassette and RF as templates in sfp-LF-F/P43-bte-RF-R₄₃-sfp-DR-PC-RF。

PC-F:ATTTTTAAAGTATGTATACAAATGA

PC-R:TTATAAAAGCCAGTCATTAGGCCTA

P43-sfp-LF-F:CTAAAATCTATTATTAATCTGTTCAGCA

P43-sfp-LF-R:ATCGCCATTGAACAGCCGGGCTACC

P43-sfp-F1:GGTAGCCCGGCTGTTCAATGGCGATTGATAGGTGGTATGTTTTCGCTTGA

P43-sfp-R1:CCATATATACTCCGTAAATCTTCATGTGTACATTCCTCTCTTACCTATAA

P43-sfp-F2:ATGAAGATTTACGGAGTATATATGG

P43-sfp-R2:TTATAACAGCTCTTCATACGTTTTC

P43-sfp-DR-F:GAAAACGTATGAAGAGCTGTTATAATTCCTTTTCAGTGCGCCTGCACCAG

P43-sfp-DR-R:TCATTTGTATACATACTTTAAAAATCAGATTATCCGAAAGAAAATCTATT

P43-sfp-RF-F:TAGGCCTAATGACTGGCTTTTATAAATGAAGATTTACGGAATTTATATGG

P43-sfp-RF-R:TCTCCTTGAGGCGATAGACCGTCAT

An amplification system:

ddH₂O 20μL

high Fidelity enzyme mixture 25. mu.L

Primer 12. mu.L

Primer 22. mu.L

Template 1. mu.L

PCR procedure: pre-denaturation at 95 ℃ for 5min, (denaturation at 95 ℃ for 15s, annealing Tm temperature, 15s, extension at 72 ℃ for 30s/kb) for 30 cycles at 72 ℃ for 5 min.

The second step is that: the method for preparing the high-efficiency B.subtiliss 168 competent cells by utilizing the formation principle of natural competence of bacillus and adopting a GM I-GM II transfer culture method comprises the following specific steps: a) streaking b.subtiliss 168 to LB plates; b) inoculating a single colony to 5mL of GM I culture medium, and culturing at 30 ℃ overnight at 100 rpm; c) 2mL of the culture solution was transferred to 18mL of GM I medium and cultured at 37 ℃ and 200rpm for 3.5 h; d) transferring 10mL of culture solution to 90mL of GM II culture medium, culturing at 37 deg.C and 100rpm for 1.5 h; e) centrifuging at 8000rpm for 10min at 4 deg.C; f) 0.5mL of the centrifuged cells resuspended in the centrifuged supernatant was taken as competence and recorded as competence I.

The third step: transformation of targeting fragment LF-P₄₃And (4) constructing a recombinant strain BSFX01 by sfp-DR-PC-RF. a) To 0.5mL of the prepared competence, 1ug of the DNA fragment was added and incubated at 37 ℃ and 100rpm for 1 hour. b) The plates were plated with chloramphenicol resistance and incubated at 37 ℃ for 12 h. Transformants were then confirmed by colony PCR. Positive clones were picked and inoculated with non-resistant LB, and cultured for 4h to allow homologous recombination between DR as shown in FIG. 2 to occur in the strain itself. Then diluting 10 times, taking 200 μ L of the mixture, coating the mixture on a MGY-Cl plate containing tetracycline, culturing the mixture at 37 ℃ for 12h, and verifying that P is integrated by colony PCR₄₃Sfp, positive clones without chloramphenicol resistance marker, the correctly sequenced clone was designated BSFX01, the strain was made competent as described above, and finally competent II.

MGY-Cl culture medium formula: 5g/L of glucose, 4g/L of yeast powder extract, 1g/L of ammonium nitrate, 0.5g/L of sodium chloride, 1.5g/L of dipotassium phosphate, 0.5g/L of monopotassium phosphate, 0.2g/L of magnesium sulfate and 5Mm of DL-4-chloro-phenylalanine.

Example 2 construction of Bacillus subtilis BSFX02

The first step is as follows: construction of P Using the fragment integration principle of FIG. 2₄₃Bte targeting fragment. Firstly, the integration site is cytochrome panthenol oxidase cydBC site, and then a primer pair P is utilized₄₃-bte-LF-F/P₄₃-bte-LF-R and P₄₃-bte-DR-F/P43-bte-DR-R and P₄₃-bte-RF-F/P₄₃bte-RF-R, complete gene of B.subtiliss 168The panels are used as templates, and the LF, DR and RF of cydBC are respectively amplified. Providing P by Liulong subject group of Jiangnan university₄₃Promoter and plasmid pUC_BTEAs templates, primer pairs P were used respectively₄₃-bte-F1/P₄₃-bte-R1，P₄₃Fragment P was amplified from-bte-F2/P43-bte-R2₄₃"and bte, PC cassette obtained as described in example 1, followed by the use of primer P₄₃-bte-LF-F/P₄₃-bte-RF-R, in LF, P₄₃", bte, DR, PC cassette, RF as template to amplify the targeting fragment LF-P₄₃-bte-DR-PC-RF。

P₄₃-bte-LF-F:CGGAGTGAGTGCTTTTAAACTGCTG

P₄₃-bte-LF-R:GGTATACCTCCTGACTAAATGGATC

P₄₃-bte-F1:GATCCATTTAGTCAGGAGGTATACCTGATAGGTGGTATGTTTTCGCTTGA

P₄₃-bte-R1:CAGAAGCAAGAGATGTTGTAGCCATGTGTACATTCCTCTCTTACCTATAA

P₄₃-bte-F2:ATGGCTACAACATCTCTTGCTTCTG

P₄₃-bte-R2:TTATATCGAAACAGGTCTTTTCCCATTAAACACGAGGTTCAGCAGGGATA

P₄₃-bte-DR-F:TGGGAAAAGACCTGTTTCGATATAA

P₄₃-bte-DR-R:TCATTTGTATACATACTTTAAAAATGCTGACCATTTTCGGCAGAAACAGC

P₄₃-bte-RF-F:TAGGCCTAATGACTGGCTTTTATAAATGGCATCTCTTCATGATCTTTGGT

P₄₃-bte-RF-R:GGTCAGCGCCAGACCAGCGCCTGTC

The second step is that: the targeting fragment from the first step was transformed into competence II and the resistance selection marker was deleted. As in the transformation method of example 1, 1. mu.g of the targeting fragment was added to 0.5mL of the competence II of the recombinant strain BSFX01, incubated at 37 ℃ for 1 hour at 100rpm, then coated with a chloramphenicol-resistant plate, and incubated at 37 ℃ for 12 hours. Transformants were then confirmed by colony PCR. Positive clones were picked and inoculated with non-resistant LB, and cultured for 4h to allow homologous recombination between DR as shown in FIG. 2 to occur in the strain itself. Then diluted 10 times, 200. mu.L of the suspension was spread on a MGY-Cl plate containing tetracycline, and cultured at 37 ℃ for 12 hours to obtain a colony PCR verifies that P is integrated₄₃Bte, and positive clones without chloramphenicol resistance marker, the clone with the correct sequencing was designated BSFX02, the strain was made competent according to the method of preparation described in example 1, and finally competent was designated competent III.

Example 3 construction of genetically engineered bacteria BSFX03 and BSFX021

The first step is as follows: construction of P₄₃-an integrated targeting fragment of yhfl. The fragment construction method was the same as in example 2, and the whole genome sequences of B.velezensis BS-37 and B.subtiliss 168 were first found from the NCBI database. P₄₃The integration site of yhfl is the amylolytic amyE site. Primers were designed based on the sequence. Then, the primer pair P43-yhfl-LF-F/P43-yhfl-LF-R and P43-yhfl-DR-F/P43-yhfl-DR-R, P₄₃-yhfl-RF-F/P43-yhfl-RF-R and P₄₃-yhfl-F2/P₄₃-yhfl-R2, using the whole genome of Bacillus velezensiss bs-37 as template, to amplify LF, DR, RF and yhfl fragments of amyE, respectively. With P43-yhfl-F1/P₄₃-yhfl-R1 primer, with P₄₃The promoter is used as a template to amplify P₄₃Fragments. PC cassette was amplified as in example 1. Finally, primer P is used₄₃-yhfl-LF-F/P₄₃-yhfl-RF amplification of the targeting fragment LF x-P₄₃*-yhfl*-DR*-PCcassette-RF*

P₄₃-yhfl-LF-F:ACCCGACATCCGGCGTTCTCATGGCGGTGCTTGCC

P₄₃-yhfl-LF-R:TCTTGACACTCCTTATTTGATTTTT

P₄₃-yhfl-F1:AAAAATCAAATAAGGAGTGTCAAGATGATAGGTGGTATGTTTTCGCTTGA

P₄₃-yhfl-R1:CTTCCAATTTTGAAACAAGATTCATGTGTACATTCCTCTCTTACCTATAA

P₄₃-yhfl-F2:ATGAATCTTGTTTCAAAATTGGAAG

P₄₃-yhfl-R2:TTATGAACGTACCGCTTGTTTG

P₄₃-yhfl-DR-F:CAAACAAGCGGTACGTTCATAAGGGCAAGGCTAGACGGGACTTACCG

P₄₃-yhfl-DR-R:TCATTTGTATACATACTTTAAAAATCTTTTGGCAGGCCGCTGAATTTCCA

P₄₃-yhfl-RF-F:TAGGCCTAATGACTGGCTTTTATAAATGTTTGCAAAACGATTCAAAACCT

P₄₃-yhfl-RF-R:TCACCGCCCAGCCTAAACGGATATC

The second step is that: conversion of the targeting fragment LF. about. -P in the first step₄₃-yhfl-DR-PC cassette-RF was entered into competent II and competent III in examples 1 and 2 and the resistance selection marker was deleted. In the same manner as in example 2, 1. mu.g of the targeting fragment LF. multidot. -P was added to the competence of freshly prepared BSFX02 using the same transformation procedure₄₃Culture was performed at 37 ℃ for 1 hour at 100rpm, then plated on chloramphenicol resistant plates, and cultured at 37 ℃ for 12 hours. Transformants were then confirmed by colony PCR. Positive clones were picked and inoculated into non-resistant LB, and cultured for 4h to allow homologous recombination between DR as shown in FIG. 2 to occur in the strain itself. Then diluted 10 times, 200ul of the solution was spread on a MGY-Cl-containing plate, cultured at 37 ℃ for 12 hours, and colony PCR verified that p is integrated at the amyE locus₄₃-yhfl, and positive clones without resistance marker are designated BSFX03 and BSFX021, respectively.

The third step: competent IV was prepared by using the positive clone of BSFX021 described above in the manner of example 1.

Example 4 construction of genetically engineered bacteria BSFX04 and BSFX022 strains

The first step is as follows: construction Using the fragment knockout principle of FIG. 1, a knockout fadE targeting fragment was constructed. The fadE gene sequence and the upstream and downstream gene sequences in the whole genome of Bacillus subtilis168 were found from NCBI data, and the following primers were designed. And utilizing the whole genome of Bacillus velezensis BS-37 as a template to respectively amplify the LF ', DR ' and RF ' of fadE by using fadE-LF-F/fadE-LF-R, fadE-DR-F/fadE-DR-R and fadE-RF-F/fadE-RF-A. And then amplifying the target fragment LF '-DR' -PC-RF 'by using the primers fadE-LF-F/fadE-RF-A and using LF', DR ', PC cassette, RF' as templates.

fadE-LF-F:GTTACCCGTCCGAACCTTGCTTTGG

fadE-LF-R:TCAGACAGTATATTTCTCAGCCTCA

fadE-DR-F:TGAGGCTGAGAAATATACTGTCTGATTGGCCATGAGCTCCGCATGCGCGG

fadE-DR-R:TCATTTGTATACATACTTTAAAAATGCCAAAGCAAGGTTCGGACGGGTAA

fadE-RF-F:TAGGCCTAATGACTGGCTTTTATAAATGGCAAAAAAAGCGGCTGACGTAC

fadE-RF-R:GACGCGTTTAGATGCGCCGATTGTG

The second step is that: the targeting fragment LF '-DR' -PC '-RF' in the first step was transformed into Bacillus subtilis competent forms II and IV prepared in examples 1 and 3, and the resistance selection marker was deleted. As in example 3, 10ug of the targeting fragment LF ' -DR ' -PC-RF ' was added to B.subtilis competent IV using the same transformation protocol. After culturing at 37 ℃ and 100rpm for 1h, the cells were plated with chloramphenicol-resistant and tetracycline-resistant plates and cultured at 37 ℃ for 12 h. Transformants were then confirmed by colony PCR. Positive clones were picked and inoculated into LB containing tetracycline resistance only, and cultured for 4h to allow homologous recombination between DR as shown in FIG. 2 to occur in the strain itself. Then diluted 10 times, 200uL of the diluted sample was spread on a MGY-Cl and tetracycline resistant plate, cultured at 37 ℃ for 12h, and colony PCR verified positive clones with the fadE knockout and without the chloramphenicol resistance marker, and recorded as BSFX04 and BSFX022, respectively.

Example 5 comparison of the Effect of Bacillus subtilis genetically engineered bacteria BSFX01, BSFX02, BSFX03, BSFX04, BSFX021 and BSFX022 in producing surfactin

The seed culture medium and the fermentation culture medium comprise the following components:

the seed culture medium comprises the following components: 10g/L of peptone, 5g/L of yeast powder extract and 10g/L of sodium chloride.

The fermentation medium comprises the following components: 20g/L of sucrose, 5g/L of peptone, 3g/L of potassium dihydrogen phosphate, 10g/L of disodium hydrogen phosphate, 0.5g/L of magnesium sulfate and 0.02g/L of ferrous sulfate.

The preparation method of surfactin comprises the following steps of producing surfactin by using bacillus subtilis genetically engineered bacteria BSFX01, BSFX02, BSFX03, BSFX04, BSFX021 and BSFX 022:

(1) seed culture medium: 50mL of seed medium was added to a 250mL conical flask and sterilized at 121 ℃ for 20 min. After cooling, single colonies of BSFX01, BSFX02, BSFX03, BSFX04, BSFX021 and BSFX022 were picked up in seed medium and cultured at 37 ℃ and 200rpm for 12 hours.

(2) Fermentation culture: 50mL of the fermentation medium was added to a 250mL Erlenmeyer flask and sterilized at 121 ℃ for 20 min. After cooling, the seed solutions of BSFX01, BSFX02, BSFX03, BSFX04, BSFX021 and BSFX022 of (1) above were inoculated in an amount of 4% (v/v) to a fermentation medium, and cultured at 37 ℃ and 200rpm for 36 hours.

(3) And (3) separating and purifying products: after 36h, 1mL of each BSFX01, BSFX02, BSFX03, BSFX04, BSFX021 and BSFX022 fermentation broth was centrifuged at 12000rpm for 5 min. Adding 300 μ L of supernatant into 1500 μ L of anhydrous ethanol, mixing, centrifuging at 12000rpm for 5 min.

(4) Analyzing and detecting: detection was carried out by HPLC using Shimadzu LC-20 at 214nm and a flow rate of 0.8mL/min using a 90% (v/v) methanol, 10% water, Venusil XBP C18-P (4.6X 150mm,5 μm) chromatography column as the mobile phase.

(5) Dry Cell Weight (DCW) assay: 1mL of the fermentation broth was diluted 12 times, and the biomass at a wavelength of 600 was measured by a spectrophotometer and recorded as OD₆₀₀。OD₆₀₀And the conversion relationship of the dry weight of the cells is as follows: 1OD₆₀₀＝0.352DCW(g/L)。

As can be seen from FIG. 4, the BSFX01 strain is a control strain with a yield of about 982mg/L, the BSFX02 and BSFX03 strains obtained by separately overexpressing bte and yhfl are 1.23 times and 1.4 times respectively higher than those of the control strain, and the BSFX021 strain obtained by simultaneously overexpressing two genes is 1.82 times higher than that of the control strain, which indicates that the production of surfactin can be promoted by simultaneously enhancing the synthesis pathway of fatty acyl-CoA.

Meanwhile, as can be seen from the data of BSFX04 and BSFX022 strains, the yields of BSFX04 and BSFX022 were 1.15 and 2.39 times higher than those of the control, respectively, and thus it can be demonstrated that reduction of degradation of fatty acyl-CoA is also advantageous for production of surfactin.

Example 6 examination of the Effect of adding branched-chain amino acid L-leu on surfactin production by Bacillus subtilis genetically engineered bacterium BSFX022

In the first step, the amount of L-leu added is optimized, and different concentrations of L-leu are added to the fermentation medium, wherein the concentrations are 0mM, 0.5mM, 1mM, 5mM, 10mM, 15mM, 20mM, 121 ℃, and the fermentation medium is sterilized for 20 min. The L-leu fermentation medium with different concentrations was inoculated with 4% BSFX022 seed solution. After culturing for 36h, the isolation, purification and detection methods in example 5 were carried out, and the results are shown in FIG. 4.

As can be seen from FIG. 5, the addition of L-leu did not affect the growth of the strain and facilitated the production of surfactin. Since L-leu was added at concentrations of 10mM, 15mM and 20mM, which had almost the same effect on the yield of surfactin, 10mML-leu was selected as the optimum amount for addition from the economical viewpoint.

Second, growth curve monitoring was performed on strain BSFX022 both without and with 10mM L-leu addition. BSFX022 seed culture solution was transferred to a fermentation medium and a fermentation medium added with 10mM L-leu in an amount of 4%, 3 replicates were set for each group, samples were taken every 3 hours to detect surfactin yield and OD, and the results are shown in FIG. 6, and the results of fermentation without L-leu were used as a control. As can be seen from FIG. 4, the genetically engineered bacterium BSFX022 can stably produce surfactin, and the addition of L-leu can properly increase biomass, and can increase the yield of surfactin by about 20.5% on the original basis, wherein the yield is about 2850 mg/L.

Example 7 examination of fermentation of surfactin in different carbon sources by Bacillus subtilis BSFX022

The first step is as follows: the carbon source of the fermentation culture in example 5 is changed to sucrose, glucose, glycerol and xylose, the nitrogen source is changed to ammonium chloride and peptone, the growth and production conditions of the recombinant strain BSFX022 under different carbon source and nitrogen source are examined, and after the culture is carried out for 36 hours, samples are taken to analyze the concentration and the dry weight of cells of surfactin, and the results are shown in Table 1:

TABLE 1 growth and cell Biomass (DCW) of strains BSFX022 surfactin under different carbon and nitrogen sources

From table 1, it can be seen that the recombinant strain BSFX022 does not utilize inorganic nitrogen well, but when organic nitrogen is used as a carbon source, the recombinant strain BSFX022 utilizes xylose well to produce surfactin by fermentation.

And further investigating the accumulation condition of organic acid when the recombinant strain BSFX022 utilizes different carbon sources. The seed solution of BSFX022 strain was inoculated into fermentation media containing xylose as a carbon source and ammonium chloride and peptone as nitrogen sources, and cultured at 37 ℃ and 200rpm, and sampled every 4 hours until 36 hours, and the results are shown in fig. 5. It can be seen from FIG. 5 that the accumulation of organic acids was small when xylose was used as the carbon source; when sucrose, glucose and glycerol are used as carbon sources, the accumulation amounts of lactic acid and acetic acid are 557-823mg/L and 302-512mg/L respectively, while the accumulation amount of lactic acid when xylose is used as a carbon source is only 88 mg/L.

Example 8 examination of the production of surfactin by Bacillus subtilis BSFX022 in phosphate-free buffer System

The phosphate-free buffer system is characterized in that 3g/L of potassium dihydrogen phosphate and 10g/L of disodium hydrogen phosphate in a fermentation medium are replaced by 0.5g/L of disodium hydrogen phosphate. When the fermentation is finished at 48h, sampling is carried out for 24h and 48h to determine DCW, surfactin concentration and pH. The results are shown in table 2:

TABLE 2 Dry cell weight, surfactin yield and pH in the case of unbuffered systems

It can be seen that when sucrose, glucose and glycerol are used as carbon sources without adding phosphate buffer, the production of surfactin can not be well maintained (about <100 mg/L) due to the severe decrease of pH; when xylose is used as a carbon source, surfactin can still be well produced, and the yield can reach 2074 mg/L.

Example 9 examination of surfactin production Using inexpensive waste corncob hydrolysate as carbon Source and monosodium glutamate waste liquid as Nitrogen Source

In a non-buffer fermentation system, the carbon and nitrogen source is respectively replaced by corncob hydrolysate rich in xylose and monosodium glutamate waste liquid rich in amino acid. The total sugar concentration of the corncob is 20g/L, and the corncob corn comprises the following components (g/L): xylose, 13.62 ± 0.31; 1.24 +/-0.11 parts of glucose; arabinose, 4.92 ± 0.29; glycerol, 0.27 + -0.07 and acetic acid, 4.45 + -0.47. The fermentation results using the corncob hydrolysate and the monosodium glutamate waste liquid as carbon and nitrogen sources are shown in fig. 6, and it can be seen from the graph that the surfactin yield is not ideal when the monosodium glutamate waste liquid is used as a single nitrogen source; however, after 1g/L of peptone is added on the basis, the yield of surfactin can reach 2032mg/L, and the production cost is greatly saved.

Sequence listing

<110> Nanjing university of industry

<120> surfactin producing genetic engineering bacterium and construction method and application thereof

<130> xb19092501

<160> 2

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1149

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

atggctacaa catctcttgc ttctgctttc tgctctatga aagctgttat gcttgctcgt 60

gatggccgtg gcatgaaacc tcgttcttct gatcttcaac ttcgtgctgg caacgctcct 120

acatctctta aaatgatcaa cggcacaaaa ttctcttaca cagaatctct taaacgtctt 180

cctgattggt ctatgctttt cgctgttatc acaacaatct tctctgctgc tgaaaaacaa 240

tggacaaacc ttgaatggaa acctaaacct aaacttcctc aacttcttga tgatcatttc 300

ggccttcatg gccttgtttt ccgtcgtaca ttcgctatcc gttcttacga agttggccct 360

gatcgttcta catctatcct tgctgttatg aaccatatgc aagaagctac acttaaccat 420

gctaaatctg ttggcatcct tggcgatggc ttcggcacaa cacttgaaat gtctaaacgt 480

gatcttatgt gggttgttcg tcgtacacat gttgctgttg aacgttaccc tacatggggc 540

gatacagttg aagttgaatg ctggatcggc gcttctggca acaacggcat gcgtcgtgat 600

ttccttgttc gtgattgcaa aacaggcgaa atccttacac gttgcacatc tctttctgtt 660

cttatgaaca cacgtacacg tcgtctttct acaatccctg atgaagttcg tggcgaaatc 720

ggccctgctt tcatcgataa cgttgctgtt aaagatgatg aaatcaaaaa acttcaaaaa 780

cttaacgatt ctacagctga ttacatccaa ggcggcctta cacctcgttg gaacgatctt 840

gatgttaatc aacatgttaa taaccttaaa tacgttgctt gggttttcga aacagttcct 900

gattctatct tcgaatctca tcatatctct tctttcacac ttgaataccg tcgtgaatgc 960

acacgtgatt ctgttcttcg ttctcttaca acagtttctg gcggctcttc tgaagctggc 1020

cttgtttgcg atcatcttct tcaacttgaa ggcggctctg aagttcttcg tgctcgtaca 1080

gaatggcgtc ctaaacttac agattctttc cgtggcatct ctgttatccc tgctgaacct 1140

cgtgtttaa 1149

<210> 2

<211> 300

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

tgataggtgg tatgttttcg cttgaacttt taaatacagc cattgaacat acggttgatt 60

taataactga caaacatcac cctcttgcta aagcggccaa ggacgccgcc gccggggctg 120

tttgcgttct tgccgtgatt tcgtgtacca ttggtttact tatttttttg ccaaggctgt 180

aatggctgaa aattcttaca tttattttac atttttagaa atgggcgtga aaaaaagcgc 240

gcgattatgt aaaatataaa gtgatagcgg taccattata ggtaagagag gaatgtacac 300

Claims (11)

1. A surfactin producing genetic engineering strain is characterized in that the surfactin producing genetic engineering strain is named as bacillus subtilis (Bacillus subtilis)Bacillus subtilis) BSFX022, with a preservation number of CCTCC NO: m2019254.

2. The use of the genetically engineered bacterium of claim 1 in the production of surfactin by fermentation.

3. The use according to claim 2, comprising:

seed culture: culturing the strain BSFX022 in a seed culture medium;

fermentation culture: inoculating a culture solution of the seed culture to a fermentation culture medium for fermentation culture;

separation and purification: centrifuging fermentation liquid obtained by fermentation culture, adding anhydrous ethanol into supernatant, and centrifuging.

4. The use of claim 3, wherein the seed medium comprises peptone 10g/L, yeast extract 5g/L, and sodium chloride 10 g/L.

5. Use according to claim 3, wherein the fermentation medium comprises: 20g/L carbon source, 5g/L peptone, 3g/L potassium dihydrogen phosphate, 10g/L disodium hydrogen phosphate, 0.5g/L magnesium sulfate and 0.02g/L ferrous sulfate;

the carbon source is sucrose, glucose, glycerol or xylose.

6. Use according to claim 5, wherein the carbon source is xylose.

7. Use according to claim 3, wherein the fermentation culture system is a phosphate-free buffer system.

8. Use according to claim 3 or 7, wherein the fermentation medium comprises: 20g/L of carbon source, 5g/L of nitrogen source, 0.5g/L of disodium hydrogen phosphate, 0.5g/L of magnesium sulfate and 0.02g/L of ferrous sulfate;

the carbon source is xylose or corncob hydrolysate containing xylose; the nitrogen source is peptone or a composite nitrogen source of monosodium glutamate waste liquid and peptone.

9. Use according to claim 3, characterized in that the branched-chain amino acid L-leu is added to the fermentation medium.

10. The use according to claim 9, wherein the branched chain amino acid L-leu is added at a concentration of 0 to 20 mM.

11. The use according to claim 10, wherein the branched chain amino acid L-leu is added at a concentration of 10 to 20 mM.

Images