CN113462791A

CN113462791A - Kit for detecting pathogenic bacteria of pneumonia and drug-resistant gene

Info

Publication number: CN113462791A
Application number: CN202010243115.9A
Authority: CN
Inventors: 颜菁; 杨朝; 吕晓冬; 高鹏飞
Original assignee: Shanghai Bangxian Medical Technology Co ltd
Current assignee: Shanghai Bangxian Medical Technology Co ltd
Priority date: 2020-03-31
Filing date: 2020-03-31
Publication date: 2021-10-01

Abstract

The invention relates to a kit for detecting pneumonia pathogenic bacteria and drug-resistant genes, which comprises primers for multiple asymmetric PCR reactions and a gene chip containing probes; the primer comprises a primer pair corresponding to the pneumonia pathogenic bacteria and a primer pair corresponding to the pneumonia pathogenic bacteria drug-resistant gene, and the probe comprises a probe corresponding to the pneumonia pathogenic bacteria and a probe corresponding to the pneumonia pathogenic bacteria drug-resistant gene. The invention can simultaneously detect the pneumonia pathogenic bacteria and the drug resistance gene in one tube, and the kit can be carried out in 1 tube without being divided into a plurality of tubes when carrying out multiple asymmetric PCR reaction, thereby saving the use amount of raw materials and samples, being more convenient for detection personnel to use, having simple and convenient operation, high accuracy and strong repeatability, being capable of giving out a detection result within 4.5 hours and having certain guiding significance for the medication of a clinician.

Description

Kit for detecting pathogenic bacteria of pneumonia and drug-resistant gene

Technical Field

The invention particularly relates to a kit for detecting pneumonia pathogenic bacteria and drug-resistant genes.

Background

The clinical data of 1194 infants with pneumonia are retrospectively analyzed by a method in China hygienic inspection journal, volume 29, No.6, volume 3, month 29, 2019, Mar.2019, Vol.29 and No.6, and as a result, 835 pathogens are detected in sputum specimens of the infants with pneumonia, the morbidity is 69.9 percent, common pathogens are gram-negative bacillus 450 strains (53.9 percent), and the pathogens mainly comprise Klebsiella pneumoniae, Haemophilus influenzae, Escherichia coli and Moraxella catarrhalis; secondly, a gram-positive coccus 351 strain (42.0 percent) is mainly prepared from streptococcus pneumoniae and staphylococcus aureus; 34 strains (4.1%) of fungi, mainly Candida albicans. The drug resistance of common pathogenic bacteria is high, wherein the drug resistance rate of the Klebsiella pneumoniae, the Haemophilus influenzae and the Escherichia coli to cefazolin, ampicillin and Streptococcus pneumoniae to clindamycin and penicillin is 100.0%, and the drug resistance rate of the Staphylococcus aureus to clindamycin is 100.0%.

The determination of the types of pathogenic bacteria of pneumonia is an important link for early diagnosis of pneumonia, timely adoption of effective treatment measures and reduction of the death rate of pneumonia. CN107338315A discloses a kit for rapid detection of 15 pneumonia pathogens, but the kit needs to be divided into 3 tubes for multiple asymmetric PCR reactions.

In addition, because of high drug resistance of part of pathogenic bacteria, detection of pathogenic bacteria of pneumonia is not enough, and the drug resistance of pathogenic bacteria needs to be determined as soon as possible, and the death rate of pneumonia can be effectively reduced by adopting targeted treatment measures. CN107475422A discloses a kit for rapid detection of drug-resistant genes of pneumonia pathogenic bacteria, but the kit needs to be divided into 4 tubes for PCR reaction.

In addition, the existing kit can only detect pathogenic bacteria and drug resistance genes independently, so that the existing detection method is complicated, and more reagents and samples are needed.

Disclosure of Invention

In order to solve the technical problems, the invention aims to provide a kit capable of simultaneously detecting pathogenic bacteria of pneumonia and drug-resistant genes.

In order to solve the technical problems, the invention adopts the following technical scheme:

the invention provides a kit for detecting pneumonia pathogenic bacteria and drug-resistant genes, which comprises primers for multiple asymmetric PCR reactions and a gene chip containing probes.

The primer comprises a primer pair corresponding to the pneumonia pathogenic bacteria and a primer pair corresponding to the pneumonia pathogenic bacteria drug-resistant gene, the probe comprises a probe corresponding to the pneumonia pathogenic bacteria and a probe corresponding to the pneumonia pathogenic bacteria drug-resistant gene, and at least part of the primer pair and at least part of the probe correspond to the same pneumonia pathogenic bacteria or the same pneumonia pathogenic bacteria drug-resistant gene; therefore, the kit can simultaneously detect the pneumonia pathogenic bacteria and the drug resistance gene.

Wherein "at least a portion of said primer pairs and at least a portion of said probes correspond to the same pneumococcal pathogen or pneumococcal pathogen resistance gene" means that, for example, when said primer pairs comprise a primer pair directed against acinetobacter baumannii, said probes comprise at least a probe directed against acinetobacter baumannii; for methicillin, the femB gene and the mecA gene are required to be expressed cooperatively, the primer pair at least comprises a primer pair aiming at the femB gene of staphylococcus aureus and a primer pair aiming at the mecA, and the probe at least comprises a probe aiming at the mecA.

The primer pair comprises one or more of a first primer pair corresponding to an OXA-51 type gene of Acinetobacter baumannii, a second primer pair corresponding to a FemB gene of Staphylococcus aureus, a third primer pair corresponding to an autolysin gene lytA gene of Streptococcus pneumoniae, a fourth primer pair corresponding to a synthetic regulatory gene rcsA gene of capsular polysaccharide of Klebsiella pneumoniae, a fifth primer pair corresponding to a housekeeping gene phoA gene of Escherichia coli, a sixth primer pair corresponding to a Pseudomonas aeruginosa O antigen acetyltransferase gene PAO1, a seventh primer pair corresponding to an outer membrane P6 omp6 gene of Haemophilus influenzae, an eighth primer pair corresponding to a pehX gene of Klebsiella oxytoca, a ninth primer pair corresponding to a chaperone gene dnaJ gene of Enterobacter cloacae, and a tenth primer pair corresponding to a micromoveof mevalonate pathway coenzyme A as gene of Staphylococcus haemolyticus, and one or more of an eleventh primer pair corresponding to extended spectrum beta-lactamase SHV, a twelfth primer pair corresponding to extended spectrum beta-lactamase TEM, a thirteenth primer pair corresponding to extended spectrum beta-lactamase CTX-M-Q1, a fourteenth primer pair corresponding to extended spectrum beta-lactamase CTX-M-14, a fifteenth primer pair corresponding to carbapenemase OXA-23, and a sixteenth primer pair corresponding to methicillin-resistant gene mecA; the probe comprises a main body sequence and a plurality of bases T marked at the 5' end of the main body sequence, wherein the main body sequence comprises a first main body sequence corresponding to Acinetobacter baumannii, a second main body sequence corresponding to staphylococcus aureus, a third main body sequence corresponding to streptococcus pneumoniae, a fourth main body sequence corresponding to Klebsiella pneumoniae, a fifth main body sequence corresponding to Escherichia coli, a sixth main body sequence corresponding to pseudomonas aeruginosa, a seventh main body sequence corresponding to haemophilus influenzae, an eighth main body sequence corresponding to Klebsiella oxytoca, a ninth main body sequence corresponding to Enterobacter cloacae, a tenth main body sequence corresponding to staphylococcus haemolyticus, an eleventh main body sequence corresponding to SHV, a twelfth main body sequence corresponding to TEM, a thirteenth main body sequence corresponding to CTX-M-Q1, a DNA sequence and a DNA sequence, A fourteenth subject sequence corresponding to CTX-M-14, a fifteenth subject sequence corresponding to OXA-23, a sixteenth subject sequence corresponding to mecA.

Wherein CTX-M-Q1 belongs to CTX-M-1 group; CTX-M-14 belongs to the CTX-M-9 group.

In the present invention, the number of bases T labeled at the 5' -end of the main sequence is 8 to 16, preferably 9 to 15, preferably 10 to 14, preferably 11 to 13, and most preferably 12.

The kit can detect at least one of acinetobacter baumannii, staphylococcus aureus, streptococcus pneumoniae, klebsiella pneumoniae, escherichia coli, pseudomonas aeruginosa, haemophilus influenzae, klebsiella oxytoca, enterobacter cloacae and staphylococcus haemolyticus and at least one of SHV, TEM, CTX-M-Q1, CTX-M-14, OXA-23 and mecA.

According to a preferred embodiment, when the kit of the present invention contains the sixteen primer pairs and the sixteen probes, the kit of the present invention can simultaneously detect Acinetobacter baumannii, Staphylococcus aureus, Streptococcus pneumoniae, Klebsiella pneumoniae, Escherichia coli, Pseudomonas aeruginosa, Haemophilus influenzae, Klebsiella oxytoca, Enterobacter cloacae, Staphylococcus haemolyticus, SHV, TEM, CTX-M-Q1, CTX-M-14, OXA-23, and mecA.

The sequence of the forward primer of the first primer pair is CACCATAAGGCAACCACCACA (SEQ ID NO.1), or has at least 80% homology thereto, preferably at least 85% homology thereto, further preferably at least 90% homology thereto, and more preferably at least 95% homology thereto; the sequence of the reverse primer is CAACACGCTTCACTTCCTTAGACA (SEQ ID NO.2), or has at least 80% homology thereto, preferably at least 85%, further preferably at least 90%, and more preferably at least 95%.

The sequence of the forward primer of the second primer pair is CAACTGAGTATGATACATCGAGCCA (SEQ ID NO.3), or has at least 80% homology thereto, preferably at least 85% homology, further preferably at least 90% homology, and more preferably at least 95% homology; the sequence of the reverse primer is AGCACGCTCTTCAGTTTCACG (SEQ ID NO.4), or has at least 80% homology thereto, preferably at least 85%, further preferably at least 90%, and more preferably at least 95%.

The sequence of the forward primer of the third primer pair is TAAGAACAGATTTGCCTCAAGTCG (SEQ ID NO.5), or has at least 80% homology thereto, preferably at least 85% homology, further preferably at least 90% homology, and more preferably at least 95% homology; the sequence of the reverse primer is CTGCATAGGTCTCAGCATTCCA (SEQ ID NO.6), or has at least 80% homology thereto, preferably at least 85%, further preferably at least 90%, and more preferably at least 95%.

The sequence of the forward primer of the fourth primer pair is GGATATCTGACCAGTCGGGGA (SEQ ID NO.7), or has at least 80% homology thereto, preferably at least 85% homology thereto, further preferably at least 90% homology thereto, and more preferably at least 95% homology thereto; the sequence of the reverse primer is GCCGGGTTTTGCGTAATGA (SEQ ID NO.8), or has at least 80% homology thereto, preferably at least 85%, further preferably at least 90%, and more preferably at least 95%.

The sequence of the forward primer of the fifth primer pair is AGCGGTTGATTGATCAGGTAGAG (SEQ ID NO.9), or has at least 80% homology thereto, preferably at least 85% homology thereto, further preferably at least 90% homology thereto, and more preferably at least 95% homology thereto; the sequence of the reverse primer is at least 80% homologous to TCACAGGGGTAAACAGTAACGGT (SEQ ID NO.10), or to it, preferably at least 85% homologous, more preferably at least 90% homologous, and even more preferably at least 95% homologous.

The sequence of the forward primer of the sixth primer pair is GGGTCGAAAGGTGGTTGTTATC (SEQ ID NO.11), or has at least 80% homology thereto, preferably at least 85% homology thereto, further preferably at least 90% homology thereto, and more preferably at least 95% homology thereto; the sequence of the reverse primer is CTGGTGCGGCTGAGTCTGAG (SEQ ID NO.12), or has at least 80% homology thereto, preferably at least 85%, further preferably at least 90%, and more preferably at least 95%.

The sequence of the forward primer of the seventh primer pair is ATGCAACGCCAGCTGCTAA (SEQ ID NO.13), or has at least 80% homology thereto, preferably at least 85% homology thereto, further preferably at least 90% homology thereto, and more preferably at least 95% homology thereto; the sequence of the reverse primer is TTCTTCACCGTAAGATACTGTGCC (SEQ ID NO.14), or has at least 80% homology thereto, preferably at least 85%, further preferably at least 90%, and more preferably at least 95%.

The sequence of the forward primer of the eighth primer pair is GGAGTATGCCTTTACGGTGCG (SEQ ID NO.15), or has at least 80% homology thereto, preferably at least 85% homology thereto, further preferably at least 90% homology thereto, and more preferably at least 95% homology thereto; the sequence of the reverse primer is ACCTTGCAGCCCTGAGGATAG (SEQ ID NO.16), or has at least 80% homology thereto, preferably at least 85%, further preferably at least 90%, and more preferably at least 95%.

The sequence of the forward primer of the ninth primer pair is TACTGTGAAGTCCCGATCAACTTT (SEQ ID NO.17), or has at least 80% homology thereto, preferably at least 85% homology thereto, further preferably at least 90% homology thereto, and more preferably at least 95% homology thereto; the sequence of the reverse primer is CGTGGGCTGTTTTTCTCACC (SEQ ID NO.18), or has at least 80% homology thereto, preferably at least 85%, more preferably at least 90%, and still more preferably at least 95%.

The sequence of the forward primer of the tenth primer pair is TGGTCGCTTAGTCGGAACAATAG (SEQ ID NO.19), or has at least 80% homology thereto, preferably at least 85% homology thereto, further preferably at least 90% homology thereto, and more preferably at least 95% homology thereto; the sequence of the reverse primer is TGCTGAAAAGTTCTGTGCCAATC (SEQ ID NO.20), or has at least 80% homology thereto, preferably at least 85%, further preferably at least 90%, and more preferably at least 95%.

The sequence of the forward primer of the eleventh primer pair is GGATGCCGGTGACGAACAG (SEQ ID NO.21), or has at least 80% homology thereto, preferably at least 85% homology thereto, further preferably at least 90% homology thereto, and more preferably at least 95% homology thereto; the sequence of the reverse primer is CCGTTTCCCAGCGGTCAA (SEQ ID NO.22), or has at least 80% homology thereto, preferably at least 85%, further preferably at least 90%, and more preferably at least 95%.

The sequence of the forward primer of the twelfth primer pair is CCCGAAGAACGTTTTCCAATG (SEQ ID NO.23), or has at least 80% homology thereto, preferably at least 85% homology thereto, further preferably at least 90% homology thereto, and more preferably at least 95% homology thereto; the sequence of the reverse primer is TCACGCTCGTCGTTTGGTATG (SEQ ID NO.24), or has at least 80% homology thereto, preferably at least 85%, further preferably at least 90%, and more preferably at least 95%.

The sequence of the forward primer of the thirteenth primer pair is ACGCTGGGTAAAGCATTGGG (SEQ ID NO.25), or has at least 80% homology thereto, preferably at least 85% homology, further preferably at least 90% homology, and more preferably at least 95% homology; the sequence of the reverse primer is CCTTAGGTTGAGGCTGGGTGA (SEQ ID NO.26), or has at least 80% homology thereto, preferably at least 85%, further preferably at least 90%, and more preferably at least 95%.

The sequence of the forward primer of the fourteenth primer pair is GGATCGCACTGAACCTACGC (SEQ ID NO.27), or has at least 80% homology thereto, preferably at least 85% homology, further preferably at least 90% homology, and more preferably at least 95% homology; the sequence of the reverse primer is GCTGCCGGTCTTATCACCC (SEQ ID NO.28), or has at least 80% homology thereto, preferably at least 85%, further preferably at least 90%, and more preferably at least 95%.

The sequence of the forward primer of the fifteenth primer pair is GCTGAAATTGGACAGCAGGTTG (SEQ ID NO.29), or has at least 80% homology thereto, preferably at least 85% homology, further preferably at least 90% homology, and more preferably at least 95% homology; the sequence of the reverse primer is GCATTTCTGACCGCATTTCCATA (SEQ ID NO.30), or has at least 80% homology thereto, preferably at least 85%, further preferably at least 90%, and more preferably at least 95%.

The sequence of the forward primer of the sixteenth primer pair is GAAGTTAGATTGGGATCATAGCGTC (SEQ ID NO.31), or has at least 80% homology thereto, preferably at least 85% homology thereto, further preferably at least 90% homology thereto, and more preferably at least 95% homology thereto; the sequence of the reverse primer is TCATCTTGTACCCAATTTTGATCCAT (SEQ ID NO.32), or has at least 80% homology thereto, preferably at least 85%, further preferably at least 90%, and more preferably at least 95%.

The first subject sequence is at least 80% homologous, preferably at least 82% homologous, preferably at least 84% homologous, preferably at least 86% homologous, preferably at least 88% homologous, preferably at least 90% homologous, preferably at least 92% homologous, preferably at least 94% homologous, preferably at least 96% homologous, preferably at least 98% homologous to GAAAGCTTCCGCTATTCCGGTTTATCAAGATTTAGCTCGTCGTATTGG. According to a specific and preferred embodiment, the probe sequence corresponding to Acinetobacter baumannii is TTTTTTTTTTTTGAAAGCTTCCGCTATTCCGGTTTATCAAGATTTAGCTCGTCGTATTGG (SEQ ID NO. 33).

Said second subject sequence is at least 80% homologous, preferably at least 82% homologous, preferably at least 84% homologous, preferably at least 86% homologous, preferably at least 88% homologous, preferably at least 90% homologous, preferably at least 92% homologous, preferably at least 94% homologous, preferably at least 96% homologous, preferably at least 98% homologous to TGTTTCAGGTGTTTTACCTTCAAGGTTTAATACGCCCATCCATCG. According to a specific and preferred embodiment, the probe sequence corresponding to said Staphylococcus aureus is TTTTTTTTTTTTTGTTTCAGGTGTTTTACCTTCAAGGTTTAATACGCCCATCCATCG (SEQ ID NO. 34).

Said third subject sequence is at least 80% homologous, preferably at least 82% homologous, preferably at least 84% homologous, preferably at least 86% homologous, preferably at least 88% homologous, preferably at least 90% homologous, preferably at least 92% homologous, preferably at least 94% homologous, preferably at least 96% homologous, preferably at least 98% homologous to CCCCCAACGTCCCAGGCACCATTATCAACAGGTCCTACC and/or TCAGGATCTTTTCTGTAATGGTAGTCAGCCTCATTTTGAACCGTTG and/or GGTCTTTCCGCCAGTGATAATCCGCTTCATTCTGTACGGTTG. According to a specific and preferred embodiment, the probe sequence corresponding to said Streptococcus pneumoniae is such as TTTTTTTTTTTTCCCCCAACGTCCCAGGCACCATTATCAACAGGTCCTACC (SEQ ID No.35) and/or TTTTTTTTTTTTTCAGGATCTTTTCTGTAATGGTAGTCAGCCTCATTTTGAACCGTTG (SEQ ID No.36) and/or TTTTTTTTTTTTGGTCTTTCCGCCAGTGATAATCCGCTTCATTCTGTACGGTTG (SEQ ID No. 37).

Said fourth body sequence is at least 80% homologous, preferably at least 83% homologous, preferably at least 86% homologous, preferably at least 89% homologous, preferably at least 92% homologous, preferably at least 95% homologous, preferably at least 98% homologous to TTCATTCAGAAACACCACCGCCGGGCAACACGAC and/or TGCAGATCCGCAGCATTGTTGACCTCAACGATTTCC. According to a specific and preferred embodiment, the probe sequence corresponding to said Klebsiella pneumoniae is as defined in TTTTTTTTTTTTTTCATTCAGAAACACCACCGCCGGGCAACACGAC (SEQ ID NO.38) and/or TTTTTTTTTTTTTGCAGATCCGCAGCATTGTTGACCTCAACGATTTCC (SEQ ID NO. 67).

Said fifth subject sequence is at least 80% homologous, preferably at least 82% homologous, preferably at least 84% homologous, preferably at least 86% homologous, preferably at least 88% homologous, preferably at least 90% homologous, preferably at least 92% homologous, preferably at least 94% homologous, preferably at least 96% homologous, preferably at least 98% homologous to CTCCGTATCGTCGTCAGGAATGCTGGCATCGGGCT. According to a specific and preferred embodiment, the probe sequence corresponding to said Escherichia coli is as defined in TTTTTTTTTTTTCTCCGTATCGTCGTCAGGAATGCTGGCATCGGGCT (SEQ ID NO. 39).

Said sixth subject sequence is at least 80% homologous, preferably at least 82% homologous, preferably at least 84% homologous, preferably at least 86% homologous, preferably at least 88% homologous, preferably at least 90% homologous, preferably at least 92% homologous, preferably at least 94% homologous, preferably at least 96% homologous, preferably at least 98% homologous to CCTGGATTGTTTCGCCGAACGTGATGGCTGGTC and/or CGTCGCCTACGTGAATGCGCTGTTCGATGCGTTGG and/or CGTGCTCTGCGATGGCCTGGATTGTTTCGCCGAAC and/or GATGTCGGGCGCGCACGTTTTCCCTTCGCTGAG and/or TGCCGATCGCGCCGGATGATCGAAGTGATCAGGTAG. According to a particular and preferred embodiment, the probe sequences corresponding to said Pseudomonas aeruginosa are such as TTTTTTTTTTTTCCTGGATTGTTTCGCCGAACGTGATGGCTGGTC (SEQ ID NO.40) and/or TTTTTTTTTTTTCGTCGCCTACGTGAATGCGCTGTTCGATGCGTTGG (SEQ ID NO.41) and/or TTTTTTTTTTTTCGTGCTCTGCGATGGCCTGGATTGTTTCGCCGAAC (SEQ ID NO.42) and/or TTTTTTTTTTTTGATGTCGGGCGCGCACGTTTTCCCTTCGCTGAG (SEQ ID NO.43) and/or TTTTTTTTTTTTTGCCGATCGCGCCGGATGATCGAAGTGATCAGGTAG (SEQ ID NO. 44).

Said seventh body sequence is at least 80% homologous, preferably at least 82% homologous, preferably at least 84% homologous, preferably at least 86% homologous, preferably at least 88% homologous, preferably at least 90% homologous, preferably at least 92% homologous, preferably at least 94% homologous, preferably at least 96% homologous, preferably at least 98% homologous to TTACCTGCTAAATAACCTTTAACTGCATCTGCACGACGTTGTCCT. According to a specific and preferred embodiment, the probe sequence corresponding to said haemophilus influenzae is as defined in TTTTTTTTTTTTTTACCTGCTAAATAACCTTTAACTGCATCTGCACGACGTTGTCCT (SEQ ID No. 45).

Said eighth subject sequence is at least 80% homologous, preferably at least 82% homologous, preferably at least 84% homologous, preferably at least 86% homologous, preferably at least 88% homologous, preferably at least 90% homologous, preferably at least 92% homologous, preferably at least 94% homologous, preferably at least 96% homologous, preferably at least 98% homologous to GCTTTAACCACCGCGCTGTCCGGAGATTCCTGGCC and/or GAATGTGCTGGCTTCGATGACGTGCGGCGTTTTGC. According to a specific and preferred embodiment, the probe sequence corresponding to said klebsiella oxytoca is TTTTTTTTTTTTGCTTTAACCACCGCGCTGTCCGGAGATTCCTGGCC (SEQ ID No.46) and/or TTTTTTTTTTTTGAATGTGCTGGCTTCGATGACGTGCGGCGTTTTGC (SEQ ID No. 47).

Said ninth subject sequence has at least 80% homology with GTGGTTGAAACCCCGGTTGGCCTGAATGACAAGCAGAA and/or CTGAAAATCCCAGGCGAAACGCAGACCGGTAAGCTGTTCC, preferably at least 82% homology, preferably at least 84% homology, preferably at least 86% homology, preferably at least 88% homology, preferably at least 90% homology, preferably at least 92% homology, preferably at least 94% homology, preferably at least 96% homology, preferably at least 98% homology. According to a specific and preferred embodiment, the probe sequence corresponding to said Enterobacter cloacae is TTTTTTTTTTTTGTGGTTGAAACCCCGGTTGGCCTGAATGACAAGCAGAA (SEQ ID NO.48) and/or TTTTTTTTTTTTCTGAAAATCCCAGGCGAAACGCAGACCGGTAAGCTGTTCC (SEQ ID NO. 49).

Said tenth subject sequence is at least 80% homologous, preferably at least 82% homologous, preferably at least 84% homologous, preferably at least 86% homologous, preferably at least 88% homologous, preferably at least 90% homologous, preferably at least 92% homologous, preferably at least 94% homologous, preferably at least 96% homologous, preferably at least 98% homologous to GCAATACTTTCGTACCGCCACCGACGATCGCTAATGTCAT and/or CCAACAGCAGCAACAACCTGACCTAATTCTTGTGCTGATTGA and/or ATTCAAGTGATGCTTTCGCAATTGGCAATACTTTCGTACCGC. According to a specific and preferred embodiment, the probe sequence corresponding to said staphylococcus haemolyticus is TTTTTTTTTTTTGCAATACTTTCGTACCGCCACCGACGATCGCTAATGTCAT (SEQ ID No.50) and/or TTTTTTTTTTTTCCAACAGCAGCAACAACCTGACCTAATTCTTGTGCTGATTGA (SEQ ID No.51) and/or TTTTTTTTTTTTATTCAAGTGATGCTTTCGCAATTGGCAATACTTTCGTACCGC (SEQ ID No. 52).

Said eleventh subject sequence has at least 80% homology with GCTGACCGGCGAGTAGTCCACCAGATCCTGCTGGCGATAGT and/or CGAGTAGTCCACCAGATCCTGCTGGCGATAGTGGATCTTTC, preferably at least 82% homology, preferably at least 84% homology, preferably at least 86% homology, preferably at least 88% homology, preferably at least 90% homology, preferably at least 92% homology, preferably at least 94% homology, preferably at least 96% homology, preferably at least 98% homology. According to a specific and preferred embodiment, the probe sequence corresponding to said SHV is TTTTTTTTTTTTGCTGACCGGCGAGTAGTCCACCAGATCCTGCTGGCGATAGT (SEQ ID NO.53) and/or TTTTTTTTTTTTCGAGTAGTCCACCAGATCCTGCTGGCGATAGTGGATCTTTC (SEQ ID NO. 54).

Said twelfth subject sequence is at least 80% homologous, preferably at least 82% homologous, preferably at least 84% homologous, preferably at least 86% homologous, preferably at least 88% homologous, preferably at least 90% homologous, preferably at least 92% homologous, preferably at least 94% homologous, preferably at least 96% homologous, preferably at least 98% homologous to GGAGGACCGAAGGAGCTAACCGCTTTTTTGCACAACATGGG and/or ATGTAACTCGCCTTGATCGTTGGGAACCGGAGCTGAATGAA. According to a specific and preferred embodiment, the probe sequence corresponding to said TEM is as defined in TTTTTTTTTTTTGGAGGACCGAAGGAGCTAACCGCTTTTTTGCACAACATGGG (SEQ ID NO.55) and/or TTTTTTTTTTTTATGTAACTCGCCTTGATCGTTGGGAACCGGAGCTGAATGAA (SEQ ID NO. 66).

Said thirteenth subject sequence is at least 80% homologous, preferably at least 83% homologous, preferably at least 86% homologous, preferably at least 89% homologous, preferably at least 92% homologous, preferably at least 95% homologous, preferably at least 98% homologous to GCCAAAAGATCGTGCGCCGCTGATTCTGGTC and/or ACGGGCGCAGCTGGTGACATGGATGAAAGGCAATA. According to a specific and preferred embodiment, the probe sequence corresponding to said CTX-M-Q1 is as described in TTTTTTTTTTTTGCCAAAAGATCGTGCGCCGCTGATTCTGGTC (SEQ ID NO.56) and/or TTTTTTTTTTTTACGGGCGCAGCTGGTGACATGGATGAAAGGCAATA (SEQ ID NO. 64).

Said fourteenth subject sequence is at least 80% homologous, preferably at least 82% homologous, preferably at least 84% homologous, preferably at least 86% homologous, preferably at least 88% homologous, preferably at least 90% homologous, preferably at least 92% homologous, preferably at least 94% homologous, preferably at least 96% homologous, preferably at least 98% homologous to ATTCGGGCCGGCTTACCGACGTCGTGGACTGTGGGTGATA. According to a specific and preferred embodiment, the probe sequence corresponding to said CTX-M-14 is represented by TTTTTTTTTTTTATTCGGGCCGGCTTACCGACGTCGTGGACTGTGGGTGATA (SEQ ID NO. 57).

Said fifteenth subject sequence is at least 80% homologous, preferably at least 82% homologous, preferably at least 84% homologous, preferably at least 86% homologous, preferably at least 88% homologous, preferably at least 90% homologous, preferably at least 92% homologous, preferably at least 94% homologous, preferably at least 96% homologous, preferably at least 98% homologous to GGGTTGAGCAGCCAGATGGAAAAATTGTCGCTTTTGCATTA. According to a specific and preferred embodiment, the probe sequence corresponding to said OXA-23 is as defined in TTTTTTTTTTTTGGGTTGAGCAGCCAGATGGAAAAATTGTCGCTTTTGCATTA (SEQ ID No. 58).

The sixteenth subject sequence is at least 80% homologous, preferably at least 82% homologous, preferably at least 84% homologous, preferably at least 86% homologous, preferably at least 88% homologous, preferably at least 90% homologous, preferably at least 92% homologous, preferably at least 94% homologous, preferably at least 96% homologous, preferably at least 98% homologous to CCTATCTCATATGCTGTTCCTGTATTGGCCAATTCCACATTGTTTCGG and/or GAACGATGCCTATCTCATATGCTGTTCCTGTATTGGCCAATTCCAC. According to a specific and preferred embodiment, the probe sequence corresponding to said mecA is as defined in TTTTTTTTTTTTCCTATCTCATATGCTGTTCCTGTATTGGCCAATTCCACATTGTTTCGG (SEQ ID NO.59) and/or TTTTTTTTTTTTGAACGATGCCTATCTCATATGCTGTTCCTGTATTGGCCAATTCCAC (SEQ ID NO. 65).

For the scheme with a plurality of main sequences, probes with different sequences can be simultaneously included on the chip, so that the detection accuracy is improved, but the cost is increased. Therefore, for pathogenic bacteria and drug-resistant genes with more types, preferably, a plurality of probes are respectively fixed in different chip holes to improve the detection accuracy; for less typed pathogens and drug resistance genes, it is preferred to use only one probe for cost reasons.

According to one embodiment, the kit further comprises primer pairs and probes for the Enterobacteriaceae 23S and/or primer pairs and probes for the aminoglycoside resistance gene aac (6') -Ie-aph (2") -Ia.

The forward primer sequence for said Enterobacteriaceae 23S (CGJK-23S) is AGCGTCGGTAAGGTGATATGAAC (SEQ ID NO.68) or has at least 80% homology thereto, preferably at least 85% homology thereto, further preferably at least 90% homology thereto, and more preferably at least 95% homology thereto; the reverse primer sequence is CACTAACACACAAGCTGATTCAGACTC (SEQ ID NO.69), or has at least 80% homology thereto, preferably at least 85%, further preferably at least 90%, and more preferably at least 95%; the subject sequence of the probe is at least 80% homologous, preferably at least 82% homologous, preferably at least 84% homologous, preferably at least 86% homologous, preferably at least 88% homologous, preferably at least 90% homologous, preferably at least 92% homologous, preferably at least 94% homologous, preferably at least 96% homologous, preferably at least 98% homologous to CCCGGTTCGCCTCGTTAACCTATGTATTCAGTTAACGATAGTGCA and/or TGCAACGAATTGCACTGGGTTTCCCCATTCGGACATCG; according to a specific and preferred embodiment, said probe sequence is TTTTTTTTTTTTCCCGGTTCGCCTCGTTAACCTATGTATTCAGTTAACGATAGTGCA (SEQ ID NO.70) and/or TTTTTTTTTTTTTGCAACGAATTGCACTGGGTTTCCCCATTCGGACATCG (SEQ ID NO. 71).

The forward primer sequence aiming at the aminoglycoside drug-resistant gene aac (6') -Ie-aph (2') -Ia is AATAATCCAAGAGCAATAAGGGCAT (SEQ ID NO.72) or has at least 80% homology, preferably at least 85% homology, further preferably at least 90% homology, and more preferably at least 95% homology with the same; the reverse primer sequence is GCCACACTATCATAACCACTACCG (SEQ ID NO.73), or has at least 80% homology thereto, preferably at least 85% homology, further preferably at least 90% homology, and more preferably at least 95% homology; the subject sequence of the probe is at least 80% homologous, preferably at least 82% homologous, preferably at least 84% homologous, preferably at least 86% homologous, preferably at least 88% homologous, preferably at least 90% homologous, preferably at least 92% homologous, preferably at least 94% homologous, preferably at least 96% homologous, preferably at least 98% homologous to TAAATAACAATCTTCTTTTTTGCCCTCGTGTAATTCATGTTCTGGC; according to a specific and preferred embodiment, the probe sequence is TTTTTTTTTTTTTAAATAACAATCTTCTTTTTTGCCCTCGTGTAATTCATGTTCTGGC (SEQ ID NO. 74).

Preferably, one primer of each of said primer pairs is a fluorescently labeled primer.

Further preferably, the molar concentration ratio of the primer which is not labeled by fluorescence to the primer with the fluorescence label in each primer pair is 1: 5-15, and more preferably 1: 7 to 13, and preferably 1:9 to 11.

Further preferably, the reverse primer of the primer pair is a fluorescently labeled primer.

Preferably, the 5' end of the main sequence of the probe is modified by amino.

The kit also comprises a quality control probe, wherein the quality control probe comprises a surface quality control probe, a positive probe complementary fluorescent primer and a negative probe, and the sequence of the surface quality control probe (BMQC) is TCACTTGCTTCCGTTGAGG (SEQ ID NO.60) and is used for the point control process of the quality control probe; the sequence of the positive Probe (PC) is TTTTTTTTTTTTCCTCAACGGAAGCAAGTGAT (SEQ ID NO. 61); the positive probe complementary fluorescent primer (C-PC) has a sequence of ATCACTTGCTTCCGTTGAGG (SEQ ID NO.62) and is used for quality control hybridization reaction; the sequence of the negative probe (NC) is TTTTTTTTTTTTGTTGCTTCTGGAATGAGTTTGCT (SEQ ID NO. 63); wherein, the 5 'end of the surface quality control probe is modified by amino, and the 3' end is fluorescently labeled; the 5 'end of the main sequence (namely the sequence of which the 5' end is not modified by 12T) of the positive probe is modified by amino; the 5' end of the positive probe complementary fluorescent primer is subjected to fluorescent modification; the 5 'end of the main sequence (namely the sequence of which the 5' end is not modified by 12T) of the negative probe is modified by amino.

According to the scheme, HEX is adopted for carrying out the fluorescence labeling.

In the invention, the pneumonia pathogenic bacteria and the drug resistance gene are infantile pneumonia pathogenic bacteria and drug resistance genes.

The second aspect of the invention provides a method for using the kit, which comprises the following steps:

(1) extracting DNA of a sample to be detected;

(2) adopting the primer in the kit to carry out multiple asymmetric PCR reaction on the DNA, wherein the reaction condition is

(3) And (3) adding the sample amplified in the step (2) into the gene chip to perform hybridization reaction.

The third aspect of the invention provides a primer for detecting pneumonia pathogenic bacteria and drug-resistant genes, wherein the primer comprises the primer for multiple asymmetric PCR reactions.

The fourth aspect of the invention provides a gene chip for detecting pathogenic bacteria of pneumonia and drug-resistant genes, which comprises the probe.

Due to the implementation of the technical scheme, compared with the prior art, the invention has the following advantages:

the kit can simultaneously detect the pneumonia pathogenic bacteria and the drug resistance gene, can be carried out in 1 tube without being divided into multiple tubes when carrying out multiple asymmetric PCR reaction, thereby saving the use amount of raw materials and samples, being more convenient for detection personnel to use, having simple and convenient operation, high accuracy and strong repeatability, giving out a detection result within 4.5 hours and having certain guiding significance for the medication of a clinician.

Drawings

FIG. 1 is a flow chart of the detection performed by the kit of the present invention;

FIG. 2 is a diagram of gel electrophoresis of an amplification product of a primer pair against Acinetobacter baumannii OXA-51;

FIG. 3 is a gel electrophoresis of the amplification products of the primer pair against methicillin-resistant Staphylococcus aureus (FemB);

FIG. 4 is a gel electrophoresis of the amplification products of the primer pair against Streptococcus pneumoniae lytA;

FIG. 5 is a gel electrophoresis of the amplification products of the primer pair against Klebsiella pneumoniae rcsA;

FIG. 6 is a gel electrophoresis of amplification products of the primer pair against Escherichia coli phoA;

FIG. 7 is a gel electrophoresis image of the amplification products of the primer pair against P.aeruginosa PAO 1;

FIG. 8 is a gel electrophoresis image of the amplification product of the primer pair against Haemophilus influenzae omp 6;

FIG. 9 is a gel electrophoresis of the amplification products of the primer pair against Klebsiella oxytoca pehX;

FIG. 10 is a gel electrophoresis of the amplification products of the primer pair for Enterobacter cloacae dnaJ;

FIG. 11 is a gel electrophoresis of amplification products of primer pairs against Staphylococcus hemolyticus mvaS;

FIG. 12 is a gel electrophoresis of the amplification products of the primer pair against the drug resistance gene SHV;

FIG. 13 is a gel electrophoresis image of the amplification products of the primer pair against drug-resistant gene TEM;

FIG. 14 is a gel electrophoresis diagram of an amplification product of a primer pair against the drug resistance gene CTX-M-Q1;

FIG. 15 is a gel electrophoresis diagram of an amplification product of a primer pair for the drug-resistant gene CTX-M-14;

FIG. 16 is a gel electrophoresis image of an amplification product of a primer pair against the drug resistance gene OXA-23;

FIG. 17 is a gel electrophoresis of the amplification product of the primer pair for the drug resistance gene mecA;

FIG. 18 is a gel electrophoresis of amplification products of primer pairs for AAC-APH;

FIG. 19 is a sequencing result of an amplification product of a primer pair against Acinetobacter baumannii OXA-51;

FIG. 20 is the sequencing result of the amplification product of the primer pair against methicillin-resistant Staphylococcus aureus (FemB);

FIG. 21 is the sequencing result of the amplification product of the primer pair against Streptococcus pneumoniae lytA;

FIG. 22 shows the sequencing of the amplification products of the primer pair against Klebsiella pneumoniae rcsA;

FIG. 23 is the sequencing of the amplification product of the primer pair against Escherichia coli phoA;

FIG. 24 is the sequencing results of the amplification products of primer pairs against P.aeruginosa PAO 1;

FIG. 25 is the sequencing result of the amplification product of the primer pair against Haemophilus influenzae omp 6;

FIG. 26 is the sequencing result of the amplification product against the primer pair of Klebsiella oxytoca pehX;

FIG. 27 is the sequencing result of the amplification product of the primer pair for Enterobacter cloacae dnaJ;

FIG. 28 is the sequencing results of the amplification products of primer pairs against Staphylococcus haemolyticus mvaS;

FIG. 29 is a result of sequencing of an amplification product of a primer pair for the drug resistance gene SHV;

FIG. 30 is a sequencing result of an amplification product of a primer pair against a drug-resistant gene TEM;

FIG. 31 is a sequencing result of an amplification product of a primer pair for the drug resistance gene CTX-M-Q1;

FIG. 32 is a sequencing result of an amplification product of a primer pair for the drug-resistant gene CTX-M-14;

FIG. 33 is a result of sequencing of an amplification product of a primer pair for the drug resistance gene OXA-23;

FIG. 34 is the sequencing result of the amplification product of the primer pair for the drug resistance gene mecA;

FIG. 35 is the sequencing results of the amplification products of the primer pair for AAC-APH;

FIG. 36 is a chip scan of sample No. A332143;

FIG. 37 is a chip scan of sample No. A332165;

FIG. 38 is a chip scan of sample No. A0332132;

FIG. 39 is a chip scan of sample No. A332387;

fig. 40 is a chip scan of sample No. a 0333225;

FIG. 41 is a chip scan of sample number 700324;

FIG. 42 is a scanned view of the chip of sample No. A332025;

FIG. 43 is a chip scan of sample No. A0332693;

FIG. 44 is a chip scan of sample A0334091;

FIG. 45 is a chip scan of a Haemophilus influenzae sample;

FIG. 46 is a chip scan of a sample of clinical pharyngeal test strips;

FIG. 47 is a chip scan of another sample of clinical pharyngeal test strips;

FIG. 48 is a negative control graph;

FIG. 49 is a chip scan of Klebsiella pneumoniae from different colony counts.

Detailed Description

The present invention will be described in further detail with reference to specific examples, but the present invention is not limited to the following examples. The implementation conditions adopted in the embodiments can be further adjusted according to different requirements of specific use, and the implementation conditions not mentioned are conventional conditions in the industry. The sequences in the present invention are written in 5 '-3' order.

First, experimental materials/devices/reagents:

1. experimental materials:

omega D6943-01 plasmid miniprep kit (culture bacteria extraction kit).

Tiangen high-efficiency buccal swab genome DNA extraction kit (centrifugal column type) (DP362) (clinical sample extraction kit).

The hotMaster taq DNA polymerase from heaven roots (cat # ET106) (multiplex amplidase);

primers and probes (general biosynthesis) used in the examples below, and each reverse primer was labeled with HEX fluorescence. Wherein the sequences of the primers are shown as SEQ ID NO.1 to SEQ ID NO.32, SEQ ID NO.68, SEQ ID NO.69, SEQ ID NO.72 and SEQ ID NO. 73. The sequences of the probes are shown in SEQ ID NO. 33-59, SEQ ID NO. 64-67, SEQ ID NO.70, SEQ ID NO.71 and SEQ ID NO.74, and the 5' end C6 of the main sequence of each probe is modified by amino. The surface quality control probe is shown in SEQ ID NO.60, the 5 'end C6 of the surface quality control probe is modified by amino, and the 3' end is marked by HEX fluorescence. The positive probe is shown in SEQ ID NO. 61. The complementary fluorescent primer of the positive probe is shown as SEQ ID NO.62, the 5' end of the complementary fluorescent primer is marked by HEX fluorescence, and the negative probe is shown as SEQ ID NO. 63.

10% SDS solution (raw);

20 XSSC buffer, DEPC treatment (raw);

aldehyde based substrates (boao crystal classic);

Denhardt's Solution(50×)Therom 750018，

nuclease-free water Ambion AM 9930.

2. Experimental equipment:

a PCR instrument, a PCR analyzer and a PCR analyzer,

BioMixer II biochip hybridization instrument, crystal core PersonalArrayer 16 human sample applicator,

SlideWasher 8 biochip washing and drying instrument

3. Preparing a reagent:

preparing a sealing liquid: operating in a fume hood, diluting 45mL of 10 XPBS (phosphate buffer solution) with purified water to 450mL in a 1000mL glass beaker, weighing 1.5g of sodium borohydride, adding the sodium borohydride into the solution until the sodium borohydride is completely dissolved, weighing 150mL of absolute ethyl alcohol, adding the absolute ethyl alcohol, and uniformly mixing for later use;

0.2% SDS formulation: diluting 12mL of 10% SDS in a 1000mL glass beaker with purified water to 600 mL;

preparing a hybridization solution: 50% deionized formamide, 3 XSSC, 0.2% SDS, 5 XDenhardts, sample (4. mu.L) (multiplex PCR product);

washing solution 1: 0.3 × SSC, 0.1% SDS;

washing liquid 2: 0.06 XSSC.

II, an experimental method:

1. sample preparation:

after overnight culture of clinical strains preserved in a laboratory, bacterial plasmid DNA was extracted by using an Omega D6943-01 plasmid miniprep kit.

Clinical samples: samples were collected with pharyngeal test strips, and bacterial DNA was directly extracted using a Tiangen high-performance buccal swab genomic DNA extraction kit (centrifugation column) (DP362) after collection.

2. Multiple asymmetric primer mixing:

the experiment used the htmaster taq DNA polymerase from the Tiangen (cat # ET106) as the amplification reagent. And according to the concentration of the primer optimized by the experiment, the primer is prepared according to the following steps of: fluorescent primers were mixed at a molar ratio of 1: 10.

3. Multiplex PCR reaction System:

name of reagent	Dosage (20 μ L)
		DNA	5μL
Multiplex PCR MasterMix	10μL
		M-primer	1μL
H₂O	4μL

The multiplex primer test primer concentration was 0.5. mu.M.

4. Multiplex PCR reaction conditions

5. And (3) carrying out multiple PCR amplification on each single primer pair listed in the experimental materials according to the experimental method from the step 2 to the step 4, carrying out agarose gel electrophoresis on the amplification products, and sequencing.

The gel electrophoresis of the amplification product of the primer pair against Acinetobacter baumannii OXA-51 is shown in FIG. 2, and the sequencing result is shown in FIG. 19. The gel electrophoresis of the amplification products of the primer pair against methicillin-resistant staphylococcus aureus FemB is shown in fig. 3, and the sequencing result is shown in fig. 20. The gel electrophoresis of the amplification products of the primer pair against Streptococcus pneumoniae lytA is shown in FIG. 4, and the sequencing results are shown in FIG. 21. The gel electrophoresis of the amplification product of the primer pair against klebsiella pneumoniae rcsA is shown in fig. 5, and the sequencing result is shown in fig. 22. FIG. 6 shows the gel electrophoresis of the amplification product of the primer pair against Escherichia coli phoA, and FIG. 23 shows the sequencing result. The gel electrophoresis of the amplification products of the primer pair against P.aeruginosa PAO1 is shown in FIG. 7, and the sequencing results are shown in FIG. 24. The gel electrophoresis of the amplification product of the primer pair against Haemophilus influenzae omp6 is shown in FIG. 8, and the sequencing result is shown in FIG. 25. The gel electrophoresis of the amplification product of the primer pair against klebsiella oxytoca pehX is shown in fig. 9, and the sequencing result is shown in fig. 26. The gel electrophoresis of the amplification products of the primer pair against Enterobacter cloacae dnaJ is shown in FIG. 10, and the sequencing results are shown in FIG. 27. The gel electrophoresis of the amplification products of the primer pair against staphylococcus haemolyticus mvaS is shown in fig. 11, and the sequencing results are shown in fig. 28. The gel electrophoresis of the amplification products of the primer pair against the drug resistance gene SHV is shown in fig. 12, and the sequencing result is shown in fig. 29. The gel electrophoresis of the amplification products of the primer pair against drug-resistant gene TEM is shown in fig. 13, and the sequencing result is shown in fig. 30. The gel electrophoresis of the amplification product of the primer pair against the drug resistance gene CTX-M-Q1 is shown in FIG. 14, and the sequencing result is shown in FIG. 31. FIG. 15 shows a gel electrophoresis of the amplification products of the primer set for drug-resistant gene CTX-M-14, and FIG. 32 shows the sequencing results. The gel electrophoresis of the amplification product of the primer pair against the drug-resistant gene OXA-23 is shown in fig. 16, and the sequencing result is shown in fig. 33. The gel electrophoresis of the amplification product of the primer pair against the drug resistance gene mecA is shown in FIG. 17, and the sequencing result is shown in FIG. 34. The gel electrophoresis of the amplification products of the primer pair against AAC-APH is shown in FIG. 18, and the sequencing result is shown in FIG. 35.

6. Eighteen primer pairs listed in the experimental materials were mixed into 1 tube, and multiplex PCR amplification was performed according to the method of the above step 2 to step 4.

7. Sample hybridization procedure

7.1 chip Probe array design

The probe array is designed according to needs, at least one of probes aiming at 18 pathogenic bacteria and drug-resistant genes is guaranteed to be arranged on the chip, two or more different probes can be fixed on part of the pathogenic bacteria or the drug-resistant genes, each probe is respectively added into three parallel holes to be parallel samples, the final concentration of the surface quality control probe is 0.5 mu M, the probe array is not required to be obvious, and the probe array is mainly used for positioning of the probes and monitoring chip point-making processes.

7.2 chip pretreatment: probe fixing and sealing

(1) The probe was diluted with water to twice the target concentration and then mixed with the spotting fluid at equal ratio to achieve a concentration of 10. mu.M.

(2) And (3) spotting the nucleic acid sample obtained in the step (1) on the surface of the substrate by using a contact type spotting instrument according to the array designed in the step 7.1.

(3) Placing the chip in a wet box after sample application; fixing at 37 deg.C for more than 12 hr.

(4) Inserting the chip into a chip frame, putting the chip into a beaker filled with 0.2% SDS cleaning solution, and shaking the chip on a shaking table at the speed of 75rpm for 5 min; the chip holder containing the chip was taken out into a beaker containing purified water and shaken on a shaker at 110rpm for 3 min.

(5) Placing the chip into a beaker containing the confining liquid, and shaking and washing for 5min on a shaking table at the speed of 75 rpm; taking out the chip frame and the chip, putting the chip frame and the chip into a beaker filled with purified water, shaking and washing the chip frame and the chip on a shaking table at the speed of 110rpm for 3min, and spin-drying the chip frame and the chip; and (4) observing whether the surface of the chip is clean and has no water mark after centrifugation, and repeating the centrifugation operation if the surface of the chip is abnormal.

7.3 chip fence operation:

(1) the gummed paper on the hybridization fence is removed, the gummed paper faces upwards, and the hybridization fence is placed in the central groove of the hybridization mould.

(2) And (3) pinching a section of the label paper stuck on the chip by hands, pushing the other end of the chip against the top end of the mold, and then putting the chip into the mold with the front face downward. Gently press with tweezers (separate different samples to prevent cross contamination), stick the enclosure and add a small amount of ddH into the water tank at the bottom of the hybridization box₂O (200. mu.L) prevents the evaporation of the hybridization solution.

(3) The front surface (the surface with the hybridization fence) of the chip is upwards put into the hybridization box, the cover plate is covered according to the chip placing direction, the convex surface on the cover plate is downward, taking 4 sample fences as an example, 4 bulges on the cover plate just cover 4 dot matrixes to form 4 micro hybridization chambers, and the hybridization box is covered.

7.4 chip hybridization:

take 4 pens as an example: mixing with 4 parts of 12 μ L hybridization sample mixture, mixing, centrifuging at 3000r/min for 30 s. Denaturation at 95 ℃ for 5min, ice-cooling for 5 min. The four wells of the cover plate were filled with 4 aliquots of hybridization solution using a pipette. After confirming the coverage of the hybridization solution, the hybridization chamber was placed in a 45 ℃ hybridization apparatus for hybridization for 1.5 hours.

7.5 chip cleaning

(1) Taking out the chip, and washing the chip in 42 ℃ washing solution I (0.3% SSC, 0.1% SDS) in a washing instrument for 4 minutes;

(2) washing with 42 ℃ washing solution II (0.06% SSC) for 4 minutes, and centrifuging.

7.6 chip Scan

Scanning parameters are as follows: 65 parts of PMT; power 520.

7.7. The result of the detection

The conditions of the laboratory samples used in the present invention are shown in Table 1.

TABLE 1

FIGS. 36 to 44 are graphs showing the scanning results of some samples in Table 1 of the chip test prepared according to one probe array arrangement, FIGS. 46 and 47 are graphs showing the scanning results of the chip test clinical pharyngeal test strip sample with the probe array arrangement, and FIG. 48 is a graph showing the scanning results of the negative control chip with the probe array arrangement. Wherein the sequence of the probe for fixing the bright spot of the TEM is SEQ ID NO.55, the sequence of the probe for fixing the upper row of the bright spot corresponding to the CTX-M-Q1 is SEQ ID NO.56, the sequence of the probe for fixing the lower row of the bright spot corresponding to the CTX-M-Q1 is SEQ ID NO.64, the sequence of the probe for fixing the bright spot of the PhoA is SEQ ID NO.39, the sequence of the probe for fixing the upper row of the bright spot corresponding to the SHV is SEQ ID NO.53, the sequence of the probe for fixing the lower row of the bright spot is SEQ ID NO.54, the sequence of the probe for fixing the bright spot of the rcsA is SEQ ID NO.38, the sequence of the probe for fixing the bright spot of the OXA23 is SEQ ID NO.58, the probe for fixing the bright spot of the OXA51 is SEQ ID NO.33, the sequence of the probe for fixing the upper row of the PAO1 is SEQ ID NO.40, the sequence of the probe for fixing the lower row of the bright spot corresponding to SEQ ID NO.41, the sequence of the probe for fixing the upper row of the bright spot corresponding to the PEhX is SEQ ID NO.46, the sequence of the probe for fixing the upper row of the bright spots corresponding to mecA is SEQ ID No.59, the sequence of the probe for fixing the lower row of the bright spots is SEQ ID No.65, the sequence of the probe for fixing the bright spots of FemB is SEQ ID No.34, the sequence of the probe for fixing the upper row of the bright spots corresponding to dnaJ is SEQ ID No.48, the sequence of the probe for fixing the lower row of the bright spots is SEQ ID No.49, the sequence of the probe for fixing the upper row of the bright spots corresponding to mvaS is SEQ ID No.50, and the sequence of the probe for fixing the lower row of the bright spots is SEQ ID No. 51. The sequence of the bright spot immobilized probe corresponding to AAC is SEQ ID NO. 74. As can be seen from fig. 36 to 44, the scanning results were consistent with the bacterial samples and the drug resistance of the corresponding bacterial samples. The test results of fig. 46 and 47 are consistent with clinical judgment based on clinician feedback.

FIG. 45 is a scanning result diagram of Haemophilus influenzae detection chip prepared according to another probe array arrangement, in which the sequence of the probe immobilized by the upper row of bright spots corresponding to TEM is SEQ ID NO.55, the sequence of the probe immobilized by the lower row of bright spots is SEQ ID NO.66, and the sequence of the probe immobilized by the bright spots of influenza is SEQ ID NO. 45.

7.8 chip sensitivity test results

The klebsiella pneumoniae with different colony numbers is detected according to a chip prepared by another probe array, wherein fig. 49 shows a chip scanning result with different colony numbers, wherein the sequence of the probe with the fixed upper row of the bright spots corresponding to SHV is SEQ ID No.53, the sequence of the probe with the fixed lower row of the bright spots is SEQ ID No.54, the sequence of the probe with the fixed upper row of the bright spots corresponding to TEM is SEQ ID No.55, the sequence of the probe with the fixed lower row of the bright spots is SEQ ID No.66, the sequence of the probe with the fixed upper row of the bright spots corresponding to CTX-M-Q1 is SEQ ID No.56, the sequence of the probe with the fixed lower row of the bright spots corresponding to CTX-M-Q1 is SEQ ID No.64, the sequence of the probe with the fixed upper row of the bright spots corresponding to 23s is SEQ ID No.70, and the sequence of the probe with the fixed lower row of the bright spots is SEQ ID No. 71. It can be seen that the sensitivity of the chip of the invention can reach 3 x 10³CFU/mL。

The present invention has been described in detail in order to enable those skilled in the art to understand the invention and to practice it, and it is not intended to limit the scope of the invention, and all equivalent changes and modifications made according to the spirit of the present invention should be covered by the present invention.

Sequence listing

<110> Shanghai Pongxian medical science and technology Co., Ltd

<120> kit for detecting pneumonia pathogenic bacteria and drug-resistant genes

<160> 74

<170> SIPOSequenceListing 1.0

<210> 1

<211> 21

<212> DNA

<213> Artificial sequence (rengongxulie)

<400> 1

caccataagg caaccaccac a 21

<210> 2

<211> 24

<212> DNA

<213> Artificial sequence (rengongxulie)

<400> 2

caacacgctt cacttcctta gaca 24

<210> 3

<211> 25

<212> DNA

<213> Artificial sequence (rengongxulie)

<400> 3

caactgagta tgatacatcg agcca 25

<210> 4

<211> 21

<212> DNA

<213> Artificial sequence (rengongxulie)

<400> 4

agcacgctct tcagtttcac g 21

<210> 5

<211> 24

<212> DNA

<213> Artificial sequence (rengongxulie)

<400> 5

taagaacaga tttgcctcaa gtcg 24

<210> 6

<211> 22

<212> DNA

<213> Artificial sequence (rengongxulie)

<400> 6

ctgcataggt ctcagcattc ca 22

<210> 7

<211> 21

<212> DNA

<213> Artificial sequence (rengongxulie)

<400> 7

ggatatctga ccagtcgggg a 21

<210> 8

<211> 19

<212> DNA

<213> Artificial sequence (rengongxulie)

<400> 8

gccgggtttt gcgtaatga 19

<210> 9

<211> 23

<212> DNA

<213> Artificial sequence (rengongxulie)

<400> 9

agcggttgat tgatcaggta gag 23

<210> 10

<211> 23

<212> DNA

<213> Artificial sequence (rengongxulie)

<400> 10

tcacaggggt aaacagtaac ggt 23

<210> 11

<211> 22

<212> DNA

<213> Artificial sequence (rengongxulie)

<400> 11

gggtcgaaag gtggttgtta tc 22

<210> 12

<211> 20

<212> DNA

<213> Artificial sequence (rengongxulie)

<400> 12

ctggtgcggc tgagtctgag 20

<210> 13

<211> 19

<212> DNA

<213> Artificial sequence (rengongxulie)

<400> 13

atgcaacgcc agctgctaa 19

<210> 14

<211> 24

<212> DNA

<213> Artificial sequence (rengongxulie)

<400> 14

ttcttcaccg taagatactg tgcc 24

<210> 15

<211> 21

<212> DNA

<213> Artificial sequence (rengongxulie)

<400> 15

ggagtatgcc tttacggtgc g 21

<210> 16

<211> 21

<212> DNA

<213> Artificial sequence (rengongxulie)

<400> 16

accttgcagc cctgaggata g 21

<210> 17

<211> 24

<212> DNA

<213> Artificial sequence (rengongxulie)

<400> 17

tactgtgaag tcccgatcaa cttt 24

<210> 18

<211> 20

<212> DNA

<213> Artificial sequence (rengongxulie)

<400> 18

cgtgggctgt ttttctcacc 20

<210> 19

<211> 23

<212> DNA

<213> Artificial sequence (rengongxulie)

<400> 19

tggtcgctta gtcggaacaa tag 23

<210> 20

<211> 23

<212> DNA

<213> Artificial sequence (rengongxulie)

<400> 20

tgctgaaaag ttctgtgcca atc 23

<210> 21

<211> 19

<212> DNA

<213> Artificial sequence (rengongxulie)

<400> 21

ggatgccggt gacgaacag 19

<210> 22

<211> 18

<212> DNA

<213> Artificial sequence (rengongxulie)

<400> 22

ccgtttccca gcggtcaa 18

<210> 23

<211> 21

<212> DNA

<213> Artificial sequence (rengongxulie)

<400> 23

cccgaagaac gttttccaat g 21

<210> 24

<211> 21

<212> DNA

<213> Artificial sequence (rengongxulie)

<400> 24

tcacgctcgt cgtttggtat g 21

<210> 25

<211> 20

<212> DNA

<213> Artificial sequence (rengongxulie)

<400> 25

acgctgggta aagcattggg 20

<210> 26

<211> 21

<212> DNA

<213> Artificial sequence (rengongxulie)

<400> 26

ccttaggttg aggctgggtg a 21

<210> 27

<211> 20

<212> DNA

<213> Artificial sequence (rengongxulie)

<400> 27

ggatcgcact gaacctacgc 20

<210> 28

<211> 19

<212> DNA

<213> Artificial sequence (rengongxulie)

<400> 28

gctgccggtc ttatcaccc 19

<210> 29

<211> 22

<212> DNA

<213> Artificial sequence (rengongxulie)

<400> 29

gctgaaattg gacagcaggt tg 22

<210> 30

<211> 23

<212> DNA

<213> Artificial sequence (rengongxulie)

<400> 30

gcatttctga ccgcatttcc ata 23

<210> 31

<211> 25

<212> DNA

<213> Artificial sequence (rengongxulie)

<400> 31

gaagttagat tgggatcata gcgtc 25

<210> 32

<211> 26

<212> DNA

<213> Artificial sequence (rengongxulie)

<400> 32

tcatcttgta cccaattttg atccat 26

<210> 33

<211> 60

<212> DNA

<213> Artificial sequence (rengongxulie)

<400> 33

tttttttttt ttgaaagctt ccgctattcc ggtttatcaa gatttagctc gtcgtattgg 60

<210> 34

<211> 57

<212> DNA

<213> Artificial sequence (rengongxulie)

<400> 34

tttttttttt tttgtttcag gtgttttacc ttcaaggttt aatacgccca tccatcg 57

<210> 35

<211> 51

<212> DNA

<213> Artificial sequence (rengongxulie)

<400> 35

tttttttttt ttcccccaac gtcccaggca ccattatcaa caggtcctac c 51

<210> 36

<211> 58

<212> DNA

<213> Artificial sequence (rengongxulie)

<400> 36

tttttttttt tttcaggatc ttttctgtaa tggtagtcag cctcattttg aaccgttg 58

<210> 37

<211> 54

<212> DNA

<213> Artificial sequence (rengongxulie)

<400> 37

tttttttttt ttggtctttc cgccagtgat aatccgcttc attctgtacg gttg 54

<210> 38

<211> 46

<212> DNA

<213> Artificial sequence (rengongxulie)

<400> 38

tttttttttt ttttcattca gaaacaccac cgccgggcaa cacgac 46

<210> 39

<211> 47

<212> DNA

<213> Artificial sequence (rengongxulie)

<400> 39

tttttttttt ttctccgtat cgtcgtcagg aatgctggca tcgggct 47

<210> 40

<211> 45

<212> DNA

<213> Artificial sequence (rengongxulie)

<400> 40

tttttttttt ttcctggatt gtttcgccga acgtgatggc tggtc 45

<210> 41

<211> 47

<212> DNA

<213> Artificial sequence (rengongxulie)

<400> 41

tttttttttt ttcgtcgcct acgtgaatgc gctgttcgat gcgttgg 47

<210> 42

<211> 47

<212> DNA

<213> Artificial sequence (rengongxulie)

<400> 42

tttttttttt ttcgtgctct gcgatggcct ggattgtttc gccgaac 47

<210> 43

<211> 45

<212> DNA

<213> Artificial sequence (rengongxulie)

<400> 43

tttttttttt ttgatgtcgg gcgcgcacgt tttcccttcg ctgag 45

<210> 44

<211> 48

<212> DNA

<213> Artificial sequence (rengongxulie)

<400> 44

tttttttttt tttgccgatc gcgccggatg atcgaagtga tcaggtag 48

<210> 45

<211> 57

<212> DNA

<213> Artificial sequence (rengongxulie)

<400> 45

tttttttttt ttttacctgc taaataacct ttaactgcat ctgcacgacg ttgtcct 57

<210> 46

<211> 47

<212> DNA

<213> Artificial sequence (rengongxulie)

<400> 46

tttttttttt ttgctttaac caccgcgctg tccggagatt cctggcc 47

<210> 47

<211> 47

<212> DNA

<213> Artificial sequence (rengongxulie)

<400> 47

tttttttttt ttgaatgtgc tggcttcgat gacgtgcggc gttttgc 47

<210> 48

<211> 50

<212> DNA

<213> Artificial sequence (rengongxulie)

<400> 48

tttttttttt ttgtggttga aaccccggtt ggcctgaatg acaagcagaa 50

<210> 49

<211> 52

<212> DNA

<213> Artificial sequence (rengongxulie)

<400> 49

tttttttttt ttctgaaaat cccaggcgaa acgcagaccg gtaagctgtt cc 52

<210> 50

<211> 52

<212> DNA

<213> Artificial sequence (rengongxulie)

<400> 50

tttttttttt ttgcaatact ttcgtaccgc caccgacgat cgctaatgtc at 52

<210> 51

<211> 54

<212> DNA

<213> Artificial sequence (rengongxulie)

<400> 51

tttttttttt ttccaacagc agcaacaacc tgacctaatt cttgtgctga ttga 54

<210> 52

<211> 54

<212> DNA

<213> Artificial sequence (rengongxulie)

<400> 52

tttttttttt ttattcaagt gatgctttcg caattggcaa tactttcgta ccgc 54

<210> 53

<211> 53

<212> DNA

<213> Artificial sequence (rengongxulie)

<400> 53

tttttttttt ttgctgaccg gcgagtagtc caccagatcc tgctggcgat agt 53

<210> 54

<211> 53

<212> DNA

<213> Artificial sequence (rengongxulie)

<400> 54

tttttttttt ttcgagtagt ccaccagatc ctgctggcga tagtggatct ttc 53

<210> 55

<211> 53

<212> DNA

<213> Artificial sequence (rengongxulie)

<400> 55

tttttttttt ttggaggacc gaaggagcta accgcttttt tgcacaacat ggg 53

<210> 56

<211> 43

<212> DNA

<213> Artificial sequence (rengongxulie)

<400> 56

tttttttttt ttgccaaaag atcgtgcgcc gctgattctg gtc 43

<210> 57

<211> 52

<212> DNA

<213> Artificial sequence (rengongxulie)

<400> 57

tttttttttt ttattcgggc cggcttaccg acgtcgtgga ctgtgggtga ta 52

<210> 58

<211> 53

<212> DNA

<213> Artificial sequence (rengongxulie)

<400> 58

tttttttttt ttgggttgag cagccagatg gaaaaattgt cgcttttgca tta 53

<210> 59

<211> 60

<212> DNA

<213> Artificial sequence (rengongxulie)

<400> 59

tttttttttt ttcctatctc atatgctgtt cctgtattgg ccaattccac attgtttcgg 60

<210> 60

<211> 19

<212> DNA

<213> Artificial sequence (rengongxulie)

<400> 60

tcacttgctt ccgttgagg 19

<210> 61

<211> 32

<212> DNA

<213> Artificial sequence (rengongxulie)

<400> 61

tttttttttt ttcctcaacg gaagcaagtg at 32

<210> 62

<211> 20

<212> DNA

<213> Artificial sequence (rengongxulie)

<400> 62

atcacttgct tccgttgagg 20

<210> 63

<211> 35

<212> DNA

<213> Artificial sequence (rengongxulie)

<400> 63

tttttttttt ttgttgcttc tggaatgagt ttgct 35

<210> 64

<211> 47

<212> DNA

<213> Artificial sequence (rengongxulie)

<400> 64

tttttttttt ttacgggcgc agctggtgac atggatgaaa ggcaata 47

<210> 65

<211> 58

<212> DNA

<213> Artificial sequence (rengongxulie)

<400> 65

tttttttttt ttgaacgatg cctatctcat atgctgttcc tgtattggcc aattccac 58

<210> 66

<211> 53

<212> DNA

<213> Artificial sequence (rengongxulie)

<400> 66

tttttttttt ttatgtaact cgccttgatc gttgggaacc ggagctgaat gaa 53

<210> 67

<211> 48

<212> DNA

<213> Artificial sequence (rengongxulie)

<400> 67

tttttttttt tttgcagatc cgcagcattg ttgacctcaa cgatttcc 48

<210> 68

<211> 23

<212> DNA

<213> Artificial sequence (rengongxulie)

<400> 68

agcgtcggta aggtgatatg aac 23

<210> 69

<211> 27

<212> DNA

<213> Artificial sequence (rengongxulie)

<400> 69

cactaacaca caagctgatt cagactc 27

<210> 70

<211> 57

<212> DNA

<213> Artificial sequence (rengongxulie)

<400> 70

tttttttttt ttcccggttc gcctcgttaa cctatgtatt cagttaacga tagtgca 57

<210> 71

<211> 50

<212> DNA

<213> Artificial sequence (rengongxulie)

<400> 71

tttttttttt tttgcaacga attgcactgg gtttccccat tcggacatcg 50

<210> 72

<211> 25

<212> DNA

<213> Artificial sequence (rengongxulie)

<400> 72

aataatccaa gagcaataag ggcat 25

<210> 73

<211> 24

<212> DNA

<213> Artificial sequence (rengongxulie)

<400> 73

gccacactat cataaccact accg 24

<210> 74

<211> 58

<212> DNA

<213> Artificial sequence (rengongxulie)

<400> 74

tttttttttt tttaaataac aatcttcttt tttgccctcg tgtaattcat gttctggc 58

Claims

1. A kit for detecting pneumonia pathogenic bacteria and drug-resistant genes is characterized in that: the kit comprises primers for multiple asymmetric PCR reactions and a gene chip containing a probe;

the primer comprises a primer pair corresponding to the pneumonia pathogenic bacteria and a primer pair corresponding to the pneumonia pathogenic bacteria drug-resistant gene, the probe comprises a probe corresponding to the pneumonia pathogenic bacteria and a probe corresponding to the pneumonia pathogenic bacteria drug-resistant gene, and at least part of the primer pair and at least part of the probe correspond to the same pneumonia pathogenic bacteria or the same pneumonia pathogenic bacteria drug-resistant gene;

the primer pair comprises one or more of a first primer pair corresponding to an OXA-51 type gene of Acinetobacter baumannii, a second primer pair corresponding to a FemB gene of staphylococcus aureus, a third primer pair corresponding to an autolysin gene lytA of streptococcus pneumoniae, a fourth primer pair corresponding to a synthesis regulatory gene rcsA of capsular polysaccharide of Klebsiella pneumoniae, a fifth primer pair corresponding to a housekeeping gene phoA gene of Escherichia coli, a sixth primer pair corresponding to a Pseudomonas aeruginosa O antigen acetyl transferase gene PAO1, a seventh primer pair corresponding to an outer membrane P6 gene omp6 of Haemophilus influenzae, an eighth primer pair corresponding to a pehX gene of Klebsiella oxytoca, a ninth primer pair corresponding to a molecular chaperone gene dnaJ of Enterobacter cloacae, and a tenth primer pair corresponding to a coenzyme As gene of a mevalonate pathway of staphylococcus haemolyticus, and one or more of an eleventh primer pair corresponding to extended spectrum beta-lactamase SHV, a twelfth primer pair corresponding to extended spectrum beta-lactamase TEM, a thirteenth primer pair corresponding to extended spectrum beta-lactamase CTX-M-Q1, a fourteenth primer pair corresponding to extended spectrum beta-lactamase CTX-M-14, a fifteenth primer pair corresponding to carbapenemase OXA-23, and a sixteenth primer pair corresponding to methicillin-resistant gene mecA;

the sequence of the forward primer of the first primer pair is CACCATAAGGCAACCACCACA, or has at least 80% homology thereto; the reverse primer has a sequence of CAACACGCTTCACTTCCTTAGACA, or at least 80% homology thereto;

the sequence of the forward primer of the second primer pair is CAACTGAGTATGATACATCGAGCCA, or has at least 80% homology thereto; the reverse primer has a sequence of AGCACGCTCTTCAGTTTCACG, or at least 80% homology thereto;

the sequence of the forward primer of the third primer pair is TAAGAACAGATTTGCCTCAAGTCG, or has at least 80% homology thereto; the reverse primer has a sequence of CTGCATAGGTCTCAGCATTCCA, or at least 80% homology thereto;

the sequence of the forward primer of said fourth primer pair is GGATATCTGACCAGTCGGGGA, or has at least 80% homology thereto; the reverse primer has a sequence of GCCGGGTTTTGCGTAATGA, or at least 80% homology thereto;

the sequence of the forward primer of said fifth primer pair is AGCGGTTGATTGATCAGGTAGAG, or has at least 80% homology thereto; the reverse primer has a sequence of TCACAGGGGTAAACAGTAACGGT, or at least 80% homology thereto;

the sequence of the forward primer of the sixth primer pair is GGGTCGAAAGGTGGTTGTTATC, or has at least 80% homology thereto; the reverse primer has a sequence of CTGGTGCGGCTGAGTCTGAG, or at least 80% homology thereto;

the sequence of the forward primer of the seventh primer pair is ATGCAACGCCAGCTGCTAA, or has at least 80% homology thereto; the reverse primer has a sequence of TTCTTCACCGTAAGATACTGTGCC, or at least 80% homology thereto;

the sequence of the forward primer of the eighth primer pair is GGAGTATGCCTTTACGGTGCG, or has at least 80% homology thereto; the reverse primer has a sequence of ACCTTGCAGCCCTGAGGATAG, or at least 80% homology thereto;

the sequence of the forward primer of the ninth primer pair is TACTGTGAAGTCCCGATCAACTTT, or has at least 80% homology thereto; the reverse primer has a sequence of CGTGGGCTGTTTTTCTCACC, or at least 80% homology thereto;

the sequence of the forward primer of said tenth primer pair is TGGTCGCTTAGTCGGAACAATAG, or at least 80% homologous thereto; the reverse primer has a sequence of TGCTGAAAAGTTCTGTGCCAATC, or at least 80% homology thereto;

the sequence of the forward primer of the eleventh primer pair is GGATGCCGGTGACGAACAG, or has at least 80% homology thereto; the reverse primer has a sequence of CCGTTTCCCAGCGGTCAA, or at least 80% homology thereto;

the sequence of the forward primer of the twelfth primer pair is CCCGAAGAACGTTTTCCAATG, or has at least 80% homology thereto; the reverse primer has a sequence of TCACGCTCGTCGTTTGGTATG, or at least 80% homology thereto;

the sequence of the forward primer of said thirteenth primer pair is ACGCTGGGTAAAGCATTGGG, or has at least 80% homology thereto; the reverse primer has a sequence of CCTTAGGTTGAGGCTGGGTGA, or at least 80% homology thereto;

the sequence of the forward primer of the fourteenth primer pair is GGATCGCACTGAACCTACGC, or has at least 80% homology thereto; the reverse primer has a sequence of GCTGCCGGTCTTATCACCC, or at least 80% homology thereto;

the sequence of the forward primer of the fifteenth primer pair is GCTGAAATTGGACAGCAGGTTG, or has at least 80% homology thereto; the reverse primer has a sequence of GCATTTCTGACCGCATTTCCATA, or at least 80% homology thereto;

the sequence of the forward primer of the sixteenth primer pair is GAAGTTAGATTGGGATCATAGCGTC, or has at least 80% homology thereto; the reverse primer has a sequence of TCATCTTGTACCCAATTTTGATCCAT, or at least 80% homology thereto;

the probe comprises a main body sequence and a plurality of bases T marked at the 5' end of the main body sequence, wherein the main body sequence comprises a first main body sequence corresponding to Acinetobacter baumannii, a second main body sequence corresponding to staphylococcus aureus, a third main body sequence corresponding to streptococcus pneumoniae, a fourth main body sequence corresponding to Klebsiella pneumoniae, a fifth main body sequence corresponding to Escherichia coli, a sixth main body sequence corresponding to pseudomonas aeruginosa, a seventh main body sequence corresponding to haemophilus influenzae, an eighth main body sequence corresponding to Klebsiella oxytoca, a ninth main body sequence corresponding to Enterobacter cloacae, a tenth main body sequence corresponding to staphylococcus haemolyticus, an eleventh main body sequence corresponding to SHV, a twelfth main body sequence corresponding to TEM, a thirteenth main body sequence corresponding to CTX-M-Q1, a DNA sequence and a DNA sequence, One or more of a fourteenth subject sequence corresponding to CTX-M-14, a fifteenth subject sequence corresponding to OXA-23, a sixteenth subject sequence corresponding to mecA;

said first subject sequence is GAAAGCTTCCGCTATTCCGGTTTATCAAGATTTAGCTCGTCGTATTGG, or has at least 80% homology thereto;

said second body sequence is TGTTTCAGGTGTTTTACCTTCAAGGTTTAATACGCCCATCCATCG, or has at least 80% homology thereto;

said third body sequence is CCCCCAACGTCCCAGGCACCATTATCAACAGGTCCTACC, or has at least 80% homology thereto; and/or said third body sequence is TCAGGATCTTTTCTGTAATGGTAGTCAGCCTCATTTTGAACCGTTG, or has at least 80% homology thereto; and/or said third body sequence is GGTCTTTCCGCCAGTGATAATCCGCTTCATTCTGTACGGTTG, or has at least 80% homology thereto; (ii) a

Said fourth body sequence is TTCATTCAGAAACACCACCGCCGGGCAACACGAC, or has at least 80% homology thereto; and/or said fourth body sequence is TGCAGATCCGCAGCATTGTTGACCTCAACGATTTCC, or has at least 80% homology thereto;

said fifth subject sequence is CTCCGTATCGTCGTCAGGAATGCTGGCATCGGGCT, or has at least 80% homology thereto;

said sixth body sequence is CCTGGATTGTTTCGCCGAACGTGATGGCTGGTC, or has at least 80% homology thereto; and/or said sixth body sequence is CGTCGCCTACGTGAATGCGCTGTTCGATGCGTTGG, or has at least 80% homology thereto; and/or said sixth body sequence is CGTGCTCTGCGATGGCCTGGATTGTTTCGCCGAAC, or has at least 80% homology thereto; and/or said sixth body sequence is GATGTCGGGCGCGCACGTTTTCCCTTCGCTGAG, or has at least 80% homology thereto; and/or said sixth body sequence is TGCCGATCGCGCCGGATGATCGAAGTGATCAGGTAG, or has at least 80% homology thereto;

said seventh body sequence is TTACCTGCTAAATAACCTTTAACTGCATCTGCACGACGTTGTCCT, or has at least 80% homology thereto;

said eighth body sequence is GCTTTAACCACCGCGCTGTCCGGAGATTCCTGGCC, or has at least 80% homology thereto; and/or said eighth body sequence is GAATGTGCTGGCTTCGATGACGTGCGGCGTTTTGC, or has at least 80% homology thereto;

said ninth subject sequence is GTGGTTGAAACCCCGGTTGGCCTGAATGACAAGCAGAA, or has at least 80% homology thereto; and/or said ninth subject sequence is CTGAAAATCCCAGGCGAAACGCAGACCGGTAAGCTGTTCC, or has at least 80% homology thereto;

said tenth subject sequence is GCAATACTTTCGTACCGCCACCGACGATCGCTAATGTCAT, or has at least 80% homology thereto; and/or said tenth subject sequence is CCAACAGCAGCAACAACCTGACCTAATTCTTGTGCTGATTGA, or has at least 80% homology thereto; and/or said tenth subject sequence is ATTCAAGTGATGCTTTCGCAATTGGCAATACTTTCGTACCGC, or has at least 80% homology thereto;

said eleventh subject sequence is GCTGACCGGCGAGTAGTCCACCAGATCCTGCTGGCGATAGT, or has at least 80% homology thereto; and/or said eleventh subject sequence is CGAGTAGTCCACCAGATCCTGCTGGCGATAGTGGATCTTTC, or has at least 80% homology thereto;

said twelfth body sequence is GGAGGACCGAAGGAGCTAACCGCTTTTTTGCACAACATGGG, or has at least 80% homology thereto; and/or said twelfth body sequence is ATGTAACTCGCCTTGATCGTTGGGAACCGGAGCTGAATGAA, or has at least 80% homology thereto;

said thirteenth subject sequence is GCCAAAAGATCGTGCGCCGCTGATTCTGGTC, or has at least 80% homology thereto; and/or said thirteenth subject sequence is ACGGGCGCAGCTGGTGACATGGATGAAAGGCAATA, or has at least 80% homology thereto;

said fourteenth host sequence is ATTCGGGCCGGCTTACCGACGTCGTGGACTGTGGGTGATA, or has at least 80% homology thereto;

said fifteenth body sequence is GGGTTGAGCAGCCAGATGGAAAAATTGTCGCTTTTGCATTA, or has at least 80% homology thereto;

said sixteenth body sequence is CCTATCTCATATGCTGTTCCTGTATTGGCCAATTCCACATTGTTTCGG, or has at least 80% homology thereto; and/or said sixteenth body sequence is GAACGATGCCTATCTCATATGCTGTTCCTGTATTGGCCAATTCCAC, or has at least 80% homology thereto.

2. The kit for detecting the pathogenic bacteria of pneumonia and the drug-resistant genes as claimed in claim 1, wherein: the kit also comprises a primer pair and a probe aiming at the Enterobacteriaceae 23S and/or a primer pair and a probe aiming at the aminoglycoside resistance gene aac (6') -Ie-aph (2') -Ia,

wherein the forward primer sequence for said Enterobacteriaceae 23S is AGCGTCGGTAAGGTGATATGAAC, or has at least 80% homology thereto, the reverse primer sequence is CACTAACACACAAGCTGATTCAGACTC, or has at least 80% homology thereto, and the probe for said Enterobacteriaceae 23S has a main sequence of CCCGGTTCGCCTCGTTAACCTATGTATTCAGTTAACGATAGTGCA, or has at least 80% homology thereto; and/or the probe for said Enterobacteriaceae 23S has a body sequence of TGCAACGAATTGCACTGGGTTTCCCCATTCGGACATCG, or has at least 80% homology thereto;

the forward primer sequence aiming at the aminoglycoside drug-resistant gene aac (6') -Ie-aph (2') -Ia is AATAATCCAAGAGCAATAAGGGCAT or has at least 80% homology with the sequence, and the reverse primer sequence is GCCACACTATCATAACCACTACCG or has at least 80% homology with the sequence; the main sequence of the probe aiming at the aminoglycoside drug-resistant gene aac (6') -Ie-aph (2') -Ia is TAAATAACAATCTTCTTTTTTGCCCTCGTGTAATTCATGTTCTGGC, or has at least 80% homology with the main sequence.

3. The kit for detecting the pathogenic bacteria of pneumonia and the drug-resistant genes as claimed in claim 1 or 2, wherein: one primer in each primer pair is a fluorescence-labeled primer.

4. The kit for detecting the pathogenic bacteria of pneumonia and the drug-resistant genes as claimed in claim 3, wherein: the molar concentration ratio of the primer which is not subjected to the fluorescent labeling to the primer with the fluorescent labeling in each primer pair is 1: 5-15.

5. The kit for detecting the pathogenic bacteria of pneumonia and the drug-resistant genes as claimed in claim 3, wherein: the reverse primer in the primer pair is a fluorescence-labeled primer.

6. The kit for detecting the pathogenic bacteria of pneumonia and the drug-resistant genes as claimed in claim 3, wherein: the fluorescent labeling was performed using HEX.

7. The kit for detecting the pathogenic bacteria of pneumonia and the drug-resistant genes as claimed in claim 1 or 2, wherein: the 5' end of the main sequence of the probe is modified by amino.

8. The kit for detecting the pathogenic bacteria of pneumonia and the drug-resistant genes as claimed in claim 1 or 2, wherein: the pneumonia pathogenic bacteria and the drug resistant gene are infantile pneumonia pathogenic bacteria and drug resistant genes.

9. A method of use of a kit according to any one of claims 1 to 8, wherein: the method comprises the following steps:

(1) extracting DNA of a sample to be detected;

10. A primer for detecting pneumonia pathogenic bacteria and drug-resistant genes is characterized in that: the primers as claimed in any one of claims 1 to 6 for use in multiplex asymmetric PCR reactions.

11. A gene chip for detecting pneumonia pathogenic bacteria and drug-resistant genes is characterized in that: the gene chip comprises the probe as claimed in claim 1, 2 or 7.