CN113462783A - Brain glioma chromosome lp/19q detection method based on MassArray nucleic acid mass spectrum and application thereof - Google Patents
Brain glioma chromosome lp/19q detection method based on MassArray nucleic acid mass spectrum and application thereof Download PDFInfo
- Publication number
- CN113462783A CN113462783A CN202110946253.8A CN202110946253A CN113462783A CN 113462783 A CN113462783 A CN 113462783A CN 202110946253 A CN202110946253 A CN 202110946253A CN 113462783 A CN113462783 A CN 113462783A
- Authority
- CN
- China
- Prior art keywords
- primer
- deletion
- heterozygous
- chromosome
- detecting
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6858—Allele-specific amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Immunology (AREA)
- Analytical Chemistry (AREA)
- Genetics & Genomics (AREA)
- Physics & Mathematics (AREA)
- Pathology (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- General Health & Medical Sciences (AREA)
- General Engineering & Computer Science (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Oncology (AREA)
- Hospice & Palliative Care (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides a method, a kit and a primer group for detecting the heterozygous deletion of a chromosome lp/19q, wherein the method is used for detecting the heterozygous deletion of the chromosome lp/19q of a glioma on the basis of a MassArray mass spectrometry platform, a normal control sample is not needed, the heterozygous deletion of the chromosome lp/19q of the glioma can be detected, meanwhile, the detection sites on the long arm of the No. 19 chromosome are added, the accuracy of the heterozygous deletion of the chromosome lp/19q of the glioma is further improved, the detection and analysis are simple in operation, short in time consumption, high in accuracy and low in price, and the method, the kit and the primer group are suitable for being popularized in clinic.
Description
Technical Field
The invention belongs to the technical field of medical detection, and particularly relates to a detection method, a kit and a primer group for chromosome 1p/19q heterozygosity loss.
Background
The brain glioma is taken as a malignant tumor with high fatality rate, although the current treatment means has great progress, the median survival time of a patient is still less than 15 months, and the disease causes huge social, economic and family burden in China. In recent years, molecular pathological research of brain glioma has been greatly advanced, and a series of molecular markers which are helpful for clinical diagnosis and prognosis judgment of brain glioma, such as IDH1/2 gene mutation, lp/19q heterozygous deletion mutation (LOH), MGMT promoter methylation and the like, have been discovered. Heterozygous deletion of chromosome lp/19q refers to deletion of one short arm of chromosome 1 or/and one long arm of chromosome 19 in a cell. It is now believed that lp/19q heterozygous deletion is a molecular feature of oligodendroglioma and is a diagnostic molecular marker therefor. Detection of lp/19q heterozygous deletions should typically be performed for both suspected oligodendrogliomas or mixed oligodendroastrocytomas to aid in histological diagnosis. loss of lp/19q heterozygosity can help to distinguish between mixed oligoastrocytomas that are more predisposed to oligodendrogenesis and astrogenesis, which is of some interest for treatment options. Oligodendroglioma tumors that have heterozygous deletions of lp/19q grow at a slower rate and are sensitive to chemotherapy. Current therapeutic guidelines recommend the detection of the loss of lp/19q heterozygosity in oligodendrogliomas.
For lp/19q heterozygous deletion mutation of brain glioma, the detection methods commonly used in clinic mainly include Fluorescence In Situ Hybridization (FISH), polymerase chain reaction (PCR-L0H) based on heterozygous deletion analysis, and array Comparative Genomic Hybridization (CGH). Although FISH technology can visually display the deletion state of lp/19q through a fluorescent signal, the limitation of a probe binding region can make a small-range deletion possibly undetectable, the FISH experiment operation is complex, the experience requirements on operation and result analysis personnel are very high, the detection period is long, and after a plurality of microsatellite regions on Ip and 19q are amplified by an expensive oPCR-LOH (polymerase chain reaction-low) matched instrument and reagent, amplification products need to be detected by methods such as denaturing polyacrylamide electrophoresis or denaturing high performance liquid chromatography, so that the whole experiment flow is complex in operation, easy to generate pollution, and multiple doping factors for result analysis are not beneficial to clinical use. The CGH needs to use an imported gene chip, and the cost of matched instruments and reagent consumables is higher. Therefore, for lp/19q heterozygous deletion mutation detection of glioma, a detection method which is simple to operate, short in time consumption, high in accuracy and low in price is lacked. The early patent of the applicant relates to a method for detecting brain glioma chromosome lp/19q based on a MassArray nucleic acid mass spectrometry platform, but the method needs to be further improved.
In view of the above, the present invention is particularly proposed.
Disclosure of Invention
The invention aims to find a product and a method for detecting the heterozygous deletion of the glioma chromosome lp/19q, which have higher detection flux, simpler operation and lower cost. To achieve this object, the present invention is directed to an upgrade of the applicant's earlier patent CN201810842077.1, thereby overcoming the above-mentioned problems. In order to achieve the purpose, the invention mainly provides the following technical scheme:
the invention provides a primer group for detecting the SNP locus related to the deletion of the polymorphism of the chromosome lp/19q of the glioma, and the primer group is applied to the preparation of a detection product for detecting the glioma.
The invention provides a product for detecting the heterozygous deletion of the glioma chromosome lp/19q, which aims to solve the technical problem that the prior art lacks a product which can detect the heterozygous deletion of the glioma chromosome lp/19q with high throughput, easy operation and low cost.
The invention provides a method for detecting a brain glioma chromosome lp/19q heterozygous deletion related SNP locus, which is used for relieving the technical problems of low flux, complex operation, high price and the like of the existing detection method.
The invention also provides a product for detecting the heterozygous deletion of the glioma chromosome lp/19q, which comprises a reagent and/or a device for detecting the SNP locus and the primer set.
The invention provides a product for carrying out heterozygous deletion on glioma chromosomes lp/19q, which is used for solving the technical problems that the existing detection method has few effective sites, needs a control sample to simultaneously detect and judge the deletion and the like.
In addition, the invention also provides a method for detecting the SNP locus related to the brain glioma chromosome lp/19q heterozygous deletion, which comprises the step of detecting the nucleotide of the SNP locus in the genome of a sample to be detected by applying the primer set.
The specific technical scheme is as follows:
the invention provides a primer group for detecting SNP loci related to brain glioma chromosome lp/19q heterozygous deletion, wherein the SNP loci comprise: rs933032, rs4970520, rs1329113, rs586057, rs624971, rs2038366, rs6426368, rs1457093, rs7512426, rs67421541, rs36624, rs79887225, rs797257, rs2031958, rs16866144, rs10407280, rs12611404, rs10875362, rs212961, rs437229, rs2473287, rs1674139, rs859104, rs11666952, rs 112639, rs4908744, rs 94469, rs4803502, rs 11586586551, rs3766345, rs7507651, rs2385126, rs 1203975, rs 26621996, rs2641114, rs 2424569143, rs 897, rs 120118622, rs 291464658, rs 59978, rs33824, rs 3379107563005630056300736, rs 1077646, rs 2317646, rs 2319647736, rs 231964756345634563971, rs 2319647962, rs 23196479647962, rs.
Further, the primer components are divided into the following 3 groups:
the first group comprises primer groups for detecting rs933032, rs4970520, rs1329113, rs586057, rs624971, rs2038366, rs6426368, rs1457093, rs7512426, rs67421541, rs36624 and rs 79887225;
the second set comprises primer sets for detecting rs797257, rs2031958, rs16866144, rs10407280, rs12611404, rs10875362, rs212961, rs437229, rs2473287, rs1674139, rs859104, rs11666952, rs11247639, rs4908744, rs9426469 and rs 4803502;
the third set comprises primer sets for detecting rs11586551, rs3766345, rs7507651, rs2385126, rs 1203974, rs621996, rs2641114, rs 249143, rs891167, rs12032257, rs11879622, rs2914658, rs7359978, rs33824, rs4927030, rs58568071, rs10776736, rs260502, rs2015, rs 392312, rs4847150 and rs 1199668.
Further, the sequence of the primer group is shown as SEQ ID NO.1-100, or has at least 85% of identity with SEQ ID NO. 1-100.
Further, the primer group further comprises the extension primer shown in SEQ ID NO.101-150, or has at least 85% identity with SEQ ID NO. 101-150.
The invention also provides a product for detecting the heterozygous deletion of the glioma chromosome lp/19q, which comprises any one of the primer sets.
The invention provides a kit for detecting brain glioma chromosome lp/19q heterozygous deletion, which comprises any one of the primer sets.
The invention provides application of any one of the primer sets in preparation of a glioma detection product.
Further, the detection can complete the judgment of lp/19q heterozygosity loss under the condition of no control sample detection; preferably, the judgment is to calculate the deletion score of the related heterozygous SNP site by (T1/T2)/(N1/N2); wherein T1/T2 represents the tumor tissue heterozygous peak SNR ratio, N1/N2 represents the blood sample heterozygous peak SNR ratio; if the site deletion score is less than 0.74, the site status is determined to be deleted; if the number of continuous deletion sites of the chr1p or chr19q in the sample is larger than that of continuous non-deletion sites and the deletion ratio of heterozygous sites is greater than 65%, judging the state of the chr1p or chr19q in the sample as deletion; and when the statuses of the chr1p and the chr19q are judged to be missing, judging the sample to be joint missing, and otherwise, judging the sample to be free of joint missing.
The invention provides a method for detecting brain glioma chromosome lp/19q heterozygosity loss, which comprises the step of detecting the nucleotide of an SNP locus in a genome of a sample to be detected by using any one of the primer sets or the product or the kit.
Further, the method further comprises the step of detecting the amplified and extended product by using a MassARRAY system.
The invention has the beneficial technical effects that:
the invention has higher detection flux, and each chip can detect 128 samples and 1024 samples in one day.
The invention has better detection accuracy which can reach 100 percent, is particularly suitable for Chinese people and is suitable for clinical popularization.
The detection method is simpler, and the 1P/19Q heterozygosity loss judgment can be realized by completing the optimization of the 1P/19Q heterozygosity loss judgment method under the condition of no control sample detection. The invention adds more chromosome probes, has enough probes, establishes consistency after the removal of control blood, and can complete the judgment of 1P/19Q heterozygosity loss in the experiment without the detection of a control sample
Drawings
In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the embodiments or the prior art will be briefly described below, and it is obvious that the drawings in the following description are some embodiments of the present invention, and other drawings can be obtained by those skilled in the art without creative efforts.
Fig. 1 is a diagram of a site peak before optimization of rs11586551 site provided in optimization case 1 of the present invention;
FIG. 2 is a diagram of an optimized site peak of rs11586551 site provided in optimization case 1 of the present invention;
fig. 3 is a site clustering diagram before optimization of the rs2015 site provided in embodiment 2 of the present invention;
fig. 4 is an optimized locus clustering diagram of the rs2015 locus provided in embodiment 2 of the present invention;
fig. 5 is a site peak diagram before optimization of the rs2015 site provided in embodiment 2 of the present invention;
fig. 6 is an optimized site peak diagram of the rs2015 site provided in embodiment 2 of the present invention;
fig. 7 is a site peak diagram before optimization of the rs11879622 site provided in example 3 of the present invention;
fig. 8 is a post-optimization site peak plot of rs11879622 site provided in example 3 of the present invention.
Detailed Description
Embodiments of the present invention will be described in detail below with reference to examples, but those skilled in the art will appreciate that the following examples are only illustrative of the present invention and should not be construed as limiting the scope of the present invention, and that the examples are a part of, but not all of the examples of the present invention. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.
Definition of partial terms
Unless defined otherwise below, all technical and scientific terms used in the detailed description of the present invention are intended to have the same meaning as commonly understood by one of ordinary skill in the art. While the following terms are believed to be well understood by those skilled in the art, the following definitions are set forth to better explain the present invention.
As used herein, the terms "comprising," "including," "having," "containing," or "involving" are inclusive or open-ended and do not exclude additional unrecited elements or method steps. The term "consisting of …" is considered to be a preferred embodiment of the term "comprising". If in the following a certain group is defined to comprise at least a certain number of embodiments, this should also be understood as disclosing a group which preferably only consists of these embodiments.
The terms "about" and "substantially" in the present invention denote an interval of accuracy that can be understood by a person skilled in the art, which still guarantees the technical effect of the feature in question. The term generally denotes a deviation of ± 10%, preferably ± 5%, from the indicated value.
Where an indefinite or definite article is used when referring to a singular noun e.g. "a" or "an", "the", this includes a plural of that noun.
Furthermore, the terms first, second, third, (a), (b), (c), and the like in the description and in the claims, are used for distinguishing between similar elements and not necessarily for describing a sequential or chronological order. It is to be understood that the terms so used are interchangeable under appropriate circumstances and that the embodiments of the invention described herein are capable of operation in other sequences than described or illustrated herein.
According to one aspect of the invention, a primer set for detecting the SNP locus related to the heterozygous deletion of the chromosome lp/19q of the brain glioma is provided,
the primer group for detecting the SNP sites related to the heterozygous deletion of the brain glioma chromosome lp/19q is designed aiming at the first region of the brain glioma with the short arm Ip of the chromosome 1 and the second region of the brain glioma with the long arm 19q of the chromosome 19, can realize the specific detection of the SNP sites related to the heterozygous deletion of the brain glioma chromosome lp/19q, has high accuracy, can finish the detection and analysis without the simultaneous detection of normal control samples, can greatly shorten the detection period, and simultaneously reduce the detection cost, and the detection result covers the first region of the brain glioma with the short arm Ip of the chromosome 1 and the SNP sites with higher heterozygous rate of the second region with the long arm 19q of the chromosome 19. In addition, the primer group provided by the invention is obtained by changing optimization and large sample test screening, all primer sequences can accurately classify samples, and simultaneously can meet the requirements of mass spectrometry detection technology, so that rapid and effective detection of glioma chromosome lp/19q heterozygosity loss by applying a MassARRAY platform is realized.
In some preferred embodiments, the SNP sites of heterozygous deletion of lp/19q of brain glioma chromosome include: rs933032, rs4970520, rs1329113, rs586057, rs624971, rs2038366, rs6426368, rs1457093, rs7512426, rs67421541, rs36624, rs79887225, rs797257, rs2031958, rs16866144, rs10407280, rs12611404, rs10875362, rs212961, rs437229, rs2473287, rs1674139, rs859104, rs11666952, rs 112639, rs4908744, rs 94469, rs4803502, rs 11586586551, rs3766345, rs7507651, rs2385126, rs 1203975, rs 26621996, rs2641114, rs 2424569143, rs 897, rs 120118622, rs 291464658, rs 59978, rs33824, rs 3379107563005630056300736, rs 1077646, rs 2317646, rs 2319647736, rs 231964756345634563971, rs 2319647962, rs 23196479647962, rs.
In some preferred embodiments, the primer set sequences are as set forth in SEQ ID NO.1-100, or are at least 85% identical to SEQ ID NO. 1-100.
It is understood that the primer pairs described in the present invention are PCR primer pairs.
It should be noted that the term "identity" refers to the similarity of sequences. "identity" includes nucleotide sequences having at least 85% (e.g., but not limited to, 85%, 90%, 95% or more) identity to the single-stranded DNA represented by SEQ ID NO.1 to SEQ ID NO.100 as described herein.
In some preferred embodiments, when the practical application requires extension of primers, the primer set further comprises 50 extension primers shown in SEQ ID NO. 101-150.
It is understood that, in the present invention, the primer pair and the extension primer correspond to each other, and the corresponding primer pair and the extension primer are used for detecting nucleotides at the same site. For example, the first primer pair comprises an upstream primer of the nucleotide sequence shown as SEQ ID NO.1, a downstream primer of the nucleotide sequence shown as SEQ ID NO.2 and an extension primer of the nucleotide sequence shown as SEQ ID NO.101, which are used for detecting the nucleotide at the same site; the second primer pair comprises an upstream primer of the nucleotide sequence shown as SEQ ID NO.3, a downstream primer of the nucleotide sequence shown as SEQ ID NO.4 and an extension primer of the nucleotide sequence shown as SEQ ID NO.102, wherein the primers are used for detecting the nucleotide of the same site; the third primer pair comprises an upstream primer of the nucleotide sequence shown as SEQ ID NO.5, a downstream primer of the nucleotide sequence shown as SEQ ID NO.6 and an extension primer of the nucleotide sequence shown as SEQ ID NO.103, wherein the primers are used for detecting the nucleotide and the like of the same site.
It is understood that the numbers of the primer pair and the extension primer correspond to the sequence of the SNP sites, i.e., the first primer pair and the first extension primer correspond to the detection site rs933032, the second primer pair and the second extension primer correspond to the detection site rs4970520, and the third primer pair and the third extension primer correspond to the detection site rs 1329113.
Further, the location of the chromosome of each locus and the genotype detection frequency in east asian population are listed, which are specifically shown in the following table:
SNP site information selected on chromosome 1P19Q
According to the first aspect of the invention, the application of the primer group for the SNP sites related to the heterozygous deletion of the glioma chromosome lp/19q in the preparation of a glioma detection product is provided.
According to a second aspect of the present invention, there is provided a product for detecting heterozygous deletion of glioma chromosome lp/19q, wherein the product comprises the primer set.
The product can realize specific detection on SNP loci related to the heterozygous deletion of the brain glioma chromosome lp/19q, the detection result covers the first region of the short arm Ip of the No.1 chromosome and the SNP loci with higher heterozygous rate of the second region of the long arm 19q of the No. 19 chromosome, the accuracy is high, the detection and analysis can be completed without the simultaneous detection of normal control samples, the detection period can be greatly shortened, and the detection cost is reduced. Has great clinical application value and very wide market promotion prospect.
In some preferred embodiments, the reagent and/or the device are used for detecting the SNP locus related to the heterozygous deletion of the brain glioma chromosome lp/19 q.
It is to be understood that the reagent and/or apparatus for detecting a SNP site may be a reagent and/or apparatus commonly available in the art for detecting a nucleotide at a SNP site, for example, a reagent or kit for detecting a nucleotide at a SNP site, or a kit for detecting a nucleotide at a SNP site including a reagent.
In some preferred embodiments, the reagents include 10 XPCR Buffer, dNTP Mix, MgCl2, Primer Mix, PCR Enzyme, and ultrapure water;
preferably, the apparatus comprises an apparatus for detecting the nucleotide of the SNP site using MassARRAY, preferably the apparatus comprises MassARRAY CPM.
In addition, the invention also provides a method for detecting the SNP locus related to the brain glioma chromosome lp/19q heterozygous deletion, which comprises the step of detecting the nucleotide of the SNP locus in the genome of a sample to be detected by applying the primer set.
The method can detect 29 SNP loci in the first region of the short arm Ip of the chromosome 1 of the brain glioma and 21 SNP loci in the second region of the long arm 19q of the chromosome 19 by applying the primer group provided by the invention, and has the characteristics of strong accuracy, high sensitivity, good repeatability, low cost, short detection period, no need of simultaneous detection of normal control samples and the like.
In some preferred embodiments, the primer set is used to perform PCR amplification and base extension reaction on a genome of a sample to be tested, and then a MassARRAY system is used to detect a product obtained from the reaction, so as to obtain nucleotides of SNP sites in the genome of the sample to be tested, and finally determine whether lp/19q heterozygosity loss exists in a sample through data analysis.
The MassARRAY gene analysis technology is based on the MALDT-TOF flight time mass spectrum technology, a target sequence is amplified through PCR, then SNP sequence specific extension primers are added according to needs, and extension of a single base is carried out on an SNP locus. The technology applies the characteristic of high sensitivity of mass spectrometry to the quality, and can effectively distinguish two gene sequences with only one different base, thereby further inferring SNP typing.
In the preferred embodiment of the invention, the MassARRAY system is adopted for detection, so that the method for detecting multiple gene loci by using a single platform is realized, the detection efficiency is greatly improved, the method is particularly suitable for batch detection, and references are provided for clinical diagnosis and prognosis judgment of brain glioma. The product has single type of required samples, and the deletion condition of the chromosome lp/19q can be detected only by a tumor tissue sample. And the deletion condition of chromosome lp/19q can be correctly detected only by 30 percent of the tumor tissue.
Preferably, the method further comprises the step of dephosphorylating the PCR product prior to the base extension reaction. Specifically, the PCR product was dephosphorylated using shrimp alkaline phosphatase.
Preferably, the method further comprises a step of purifying the reaction product after the base extension reaction, and then detecting the reaction product using MassARRAY. Specifically, the reaction product can be purified by desalting the resin.
In some preferred embodiments, the primer components are grouped into 3 groups as follows:
the first group comprises primer groups for detecting rs933032, rs4970520, rs1329113, rs586057, rs624971, rs2038366, rs6426368, rs1457093, rs7512426, rs67421541, rs36624 and rs 79887225;
the second set comprises primer sets for detecting rs797257, rs2031958, rs16866144, rs10407280, rs12611404, rs10875362, rs212961, rs437229, rs2473287, rs1674139, rs859104, rs11666952, rs11247639, rs4908744, rs9426469 and rs 4803502;
the third set comprises primer sets for detecting rs11586551, rs3766345, rs7507651, rs2385126, rs 1203974, rs621996, rs2641114, rs 249143, rs891167, rs12032257, rs11879622, rs2914658, rs7359978, rs33824, rs4927030, rs58568071, rs10776736, rs260502, rs2015, rs 392312, rs4847150 and rs 1199668.
The grouping comprehensively considers the size of the extension primers, and ensures that the primers in each group have no interference with each other.
Specifically, the first group and the second group reserve the original product group, and the third group is combined in the following way: designing a primer (Assay Design Suite) on line through a MassARRAY website, and adjusting related parameters: firstly, setting Preset as High Multiplexing iPLEX Preset, then setting Flank size of Retrieve and Format Sequences in Advanced Settings as 300, and setting SNP Flanking Sequence of Format Constraints in Advanced Format SNPs as 300; the Maximum amplification Length of the Identify Optimal Primer Areas is set as 420bp, the signaled Sequences specified is set as ALL, and the Maximum Test is set as 300; max PCR Primer Mismatches are set to 0, and Number of 3' bases that must match is set to ALL; maximum of Amplicon in Design Assays is set as 420; the Calculation Algorithm of extended Primer is set to 4+ 2; min Peak Separation assays for Multiple is set to 30; finally, clicking and running, and finally combining 22 sites into a group.
The invention provides a product for carrying out heterozygous deletion on glioma chromosomes lp/19q, which is used for solving the technical problems that the existing detection method has few effective sites, needs a control sample to simultaneously detect and judge the deletion and the like.
In the 3 groups of primer groups, the first group and the second group retain the primer group of the original invention, and the third group of primer group in the original invention: rs3737577, rs6070, rs809972, rs1807277, rs 245638 and rs59317557 are optimized as a third set of newly invented primer sets: rs11586551, rs3766345, rs7507651, rs2385126, rs 120397301, rs621996, rs2641114, rs 249143, rs891167, rs12032257, rs11879622, rs2914658, rs7359978, rs33824, rs4927030, rs58568071, rs10776736, rs 502, rs2015, rs 39732312, rs 47150 and rs 1199668; the new invention increases SNP loci of a first region of a short arm Ip of a No.1 chromosome and a second region of a long arm 19q of the No. 19 chromosome, and the frequency of the increased SNP loci in east Asia population is about 0.5, namely the heterozygous frequency of the SNP loci is higher, so that effective loci for judging the heterozygous deletion of lp/19q are increased.
The invention completes the optimization of the lp/19q heterozygosity loss judgment method, and can complete the lp/19q heterozygosity loss judgment under the condition of no control sample detection. The judging method of the original invention is as follows: N2/N1 is the ratio of two heterozygous peak areas detected by blood genome DNA, T2/T1 is the ratio of two heterozygous peak areas detected by tumor tissue genome DNA, N2/N1/(N2/N1+ T2/T1) is heterozygous and deleted when the obtained value is less than 0.3 or more than 0.7, and heterozygous and deleted when the obtained value is between 0.3 and 0.7; the invention is characterized in that: optimizing the site pure heterozygous threshold under the condition of constructing a single sample at the early stage: selecting a certain number of matched samples as training sets, and calculating mutation abundances of related SNP sites of the case sample and the control sample respectively (AF ═ SNR1/(SNR1+ SNR 2)). And determining the pure heterozygous separation threshold of each site under the condition of single sample analysis according to the distribution state of the mutation abundances of each site case and control sample, and simultaneously calculating the control sample. And (3) a deletion state interpretation method after optimization is completed, filtering homozygous SNP sites according to the pure heterozygous threshold of the sites, and only leaving the heterozygous sites. The deletion score of the related heterozygous SNP sites was calculated by (T1/T2)/(N1/N2). Wherein T1/T2 represents the tumor tissue heterozygous peak SNR ratio, and N1/N2 represents the blood sample heterozygous peak SNR ratio. If the site deletion score is <0.74, the site status is determined to be deleted. If the number of continuous deletion sites of the sample chr1p (or chr19q) is larger than the number of continuous non-deletion sites and the deletion ratio of heterozygous sites is greater than 65%, the state of the sample chr1p (or chr19q) is judged to be deleted. And when the statuses of the chr1p and the chr19q are judged to be missing, judging the sample to be joint missing, and otherwise, judging the sample to be free of joint missing.
The invention is further illustrated by the following specific examples, which, however, are to be construed as merely illustrative, and not limitative of the remainder of the disclosure in any way whatsoever.
The main reagent information used in the examples of the present invention is as follows:
the main instrument information used in the embodiment of the invention is as follows:
example 1: design of primers and establishment of reaction System
PCR and UEP primer design were performed initially for 22 sites and primers were synthesized. Preparing an amplification primer MIX and an extension primer MIX, and finely adjusting the extension primer MIX until the requirements are met. Primer testing and optimization were then performed.
Optimization case 1: optimization of site rs11586551 is taken as an example (adjustment of amplification conditions):
under the condition that the rs11586551 locus has homozygous GG genotype, the A target peak position has a phenomenon of non-specific peak emergence, and the PCR amplification condition is adjusted: the denaturation temperature is optimized from original denaturation at 95 ℃ to denaturation at 94 ℃, the 45-cycle denaturation time is optimized from 30s to 20s, and the modified reaction conditions are found to be better when the test is carried out according to the steps. FIG. 1 is a peak diagram of the situation of rs11586551 site GG homozygosis before optimization of PCR and UEP amplification conditions, and FIG. 2 is a peak diagram of the situation of the rs11586551 site GG homozygosis after optimization of PCR and UEP amplification conditions. This indicates that the modified PCR and UEP amplification conditions are better than the conditions before modification, and meet the detection requirements of this project.
Optimization case 2: optimization of primers at rs2015 locus (adjustment of UEP primer orientation)
When the rs2015 locus is homozygous GG genotype, a basal peak exists at the A target position, as shown in figure 5, and clustering is discrete, as shown in figure 3. Supposing that A, G bases with molecular weight difference of 16Da possibly cause the peak of the G target position to affect the A target position, considering that the selection changes the UEP primer direction, A, G bases (with molecular weight difference of 16Da) are changed into C, T bases (with molecular weight difference of 80Da) by UEP detection, after the UEP primer direction is changed (the UEP sequence before the change is CAGTGTGGGTGTGGGCCTCTGAAT), the test is carried out according to the steps, the test effect of the changed UEP primer is better, under the condition of homozygous UEGG genotype, the A target position has no obvious base peak as shown in figure 6, and the clustering comparison is concentrated without dispersion as shown in figure 4. This indicates that the modified primers are superior to the primers before modification, and meet the detection requirements of the project.
Optimization case 3: optimization of rs11879622 site primer (adjustment of PCR to UEP primer ratio)
In the case of hybrid AG genotype at rs11879622 site, the target peak signal-to-noise ratio (SNR) is small, and the peak-forming effect is poor, as shown in FIG. 7. Considering the selection and adjustment of the ratio of the PCR primers and the UEP primers, 1ul of each rs11879622 site PCR forward and reverse primer is added into every 200ul of PCR primer mixture, 3.45ul of each rs11879622 site UEP primer is added into every 200ul of UEP primer mixture, 1.2ul of each rs11879622 site PCR forward and reverse primer is added into every 200ul of PCR primer mixture, and 4.64ul of each rs11879622 site UEP primer is added into every 200ul of UEP primer mixture, and then the test is carried out according to the steps, so that the test effect of the ratio of the PCR primers and the UEP primers after the change is better, and the problem that the target peak signal-to-noise ratio (SNR) is lower under the heterozygous AG genotype is obviously improved, as shown in FIG. 8. This indicates that the modified primer ratio is superior to the primer ratio before modification, and meets the detection requirements of this project.
Optimization case 4: optimization of the third primer set of the original invention (substitution of detection site, reduction of ratio of deletion waiting (gray zone))
The third group of primers in the original invention selects a certain gene at the locus, which has low or high occurrence frequency in the east Asia population and is not beneficial to judging lp/19q heterozygosity loss. The new invention is to combine the third group of primer sets in the original invention: rs3737577, rs6070, rs809972, rs1807277, rs 245638 and rs59317557 are optimized and adjusted to be a third primer group of the new invention: rs11586551, rs3766345, rs7507651, rs2385126, rs 120397301, rs621996, rs2641114, rs 249143, rs891167, rs12032257, rs11879622, rs2914658, rs7359978, rs33824, rs4927030, rs58568071, rs10776736, rs 502, rs2015, rs 39732312, rs 47150 and rs 1199668; the new invention increases SNP loci of a first region of a short arm Ip of a No.1 chromosome and a second region of a long arm 19q of the No. 19 chromosome, and the frequency of the increased SNP loci in east Asia population is about 0.5, namely the heterozygous frequency of the SNP loci is higher, so that effective loci for judging the heterozygous deletion of lp/19q are increased, and the table 1 shows. The accuracy of lp/19q combined deletion detection is improved, and the ratio of deletion waiting (gray area) is reduced, which is shown in Table 2. This demonstrates that the new invention is superior to the original invention in the detection site.
TABLE 1 comparison of the information of the SNP loci selected on the chromosomes of the original invention and the newly invented 1P19Q which have differences
Optimization case 5: optimizing the analysis method of the original invention (complete lp/19q heterozygosity loss judgment under the condition of no control)
The judging method of the original invention is as follows: N2/N1 is the ratio of two heterozygous peak areas detected by blood genome DNA, T2/T1 is the ratio of two heterozygous peak areas detected by tumor tissue genome DNA, N2/N1/(N2/N1+ T2/T1) is heterozygous and deleted when the obtained value is less than 0.3 or more than 0.7, and heterozygous and deleted when the obtained value is between 0.3 and 0.7; the analysis was done with a control.
The new invention has enough probes by increasing the design of more chromosome probes, can establish consistency after the control blood is removed, and specifically comprises the following steps: optimizing the site pure heterozygous threshold under the condition of constructing a single sample at the early stage: selecting a certain number of matched samples as training sets, and calculating mutation abundances of related SNP sites of the case sample and the control sample respectively (AF ═ SNR1/(SNR1+ SNR 2)). And determining the pure heterozygous separation threshold of each site under the condition of single sample analysis according to the distribution state of the mutation abundances of each site case and control sample, and simultaneously calculating the control sample. And (3) a deletion state interpretation method after optimization is completed, filtering homozygous SNP sites according to the pure heterozygous threshold of the sites, and only leaving the heterozygous sites. The deletion score of the related heterozygous SNP sites was calculated by (T1/T2)/(N1/N2). Wherein T1/T2 represents the tumor tissue heterozygous peak SNR ratio, and N1/N2 represents the blood sample heterozygous peak SNR ratio. If the site deletion score is <0.74, the site status is determined to be deleted. If the number of continuous deletion sites of the sample chr1p (or chr19q) is larger than the number of continuous non-deletion sites and the deletion ratio of heterozygous sites is greater than 65%, the state of the sample chr1p (or chr19q) is judged to be deleted. When both the chr1p and chr19q states are judged to be missing, the sample is judged to be joint missing, otherwise, the sample is judged to be free of joint missing, and the table 2 shows. This demonstrates that the new transmission is superior to the original invention in analytical methods.
TABLE 2 comparison of 1p19q before and after optimization of Combined deletion assays (by comparison with 85 NGS assay samples)
| Original invention (with control) | New invention (without contrast) | |
| Combined deletion detection accuracy | 83.33％ | 100.00％ |
| Detection accuracy without joint deletion | 100.00％ | 100.00％ |
| Absence of undetermined proportion | 7.06％ | 0.00％ |
In summary, optimal PCR amplification primers and single base extension (UEP) primers were obtained, and the specific primer sequences are shown in tables 3 and 4.
TABLE 3 PCR primer sequences
TABLE 4 UEP primer sequences
Example 2 validation of the reaction System
After the optimal reaction system is confirmed, a series of verification experiments are carried out, including accuracy, precision, LOD, personnel comparison and comparison experiments among different batches of primers. The specific verification scheme is as follows:
(1) accuracy experiment verification scheme: selecting 3 samples (3 samples are samples with different genotypes) from each of the 22 newly-added SNP sites to carry out Sanger sequencing, and comparing the sequencing results of the Sanger sequencing and the MassARRAY; selecting samples comprising 41 combined deletion samples of NGS detection 1P19Q and 57 combined deletion samples of 1P19Q, totaling 98 samples, and comparing the results of NGS and MassARRAY; and if the consistency is more than 95%, the verification is passed.
(2) The precision experiment verification scheme is as follows: 3 samples are picked, each sample is repeated for3 times to carry out detection of the first batch, 3 batches are detected in total, 5 times of samples are repeated for3 times, the comparison result is consistent, and the verification is passed if the consistency of the inter-batch precision and the intra-batch precision is more than 95%.
(3) LOD experimental validation protocol: NGS detection 1P19Q is selected to be determined as combined deletion tumor tissue nucleic acid, and the tumor proportion by gradient dilution is respectively as follows: 45%, 40%, 30%, 25% and 20% of samples, and the gradient diluted samples are subjected to 3 times of repeated detection of the same tumor proportion sample by using the same batch of reagents in the same batch, and the detection limit is searched. And selecting a positive sample near the detection limit to complete the precision experiment. And 5 times of repeated detection limit samples, wherein the verification is passed if the result consistency rate is 100%.
(4) Personnel alignment and reagent alignment experimental validation protocol: two batches of primers (batch A and batch B) were prepared in (2), operator A detected batch 1, batch 2 and batch 3 using primer batch A, detected batch 4 using primer batch B, and operator B detected batch 5 using primer batch B, and the results of comparison between the human and the reagent showed that the identity was greater than 95%.
The specific verification process is as follows: first, two batches of amplification primers MIX and extension primers MIX are prepared according to the system addition table provided in example 1 of the present invention, and named as batch A and batch B, respectively. Then, the results were analyzed by PCR amplification, shrimp alkaline phosphatase consumption, single-base extension, resin desalting, and MassARRAY CPM spotting, according to the procedures described in example 1. The results for accuracy, precision, within batch, between batches, between personnel, between reagents, LOD were as follows:
table 5 verification result 1 of accuracy
TABLE 6 verification of accuracy 2
Through the detection of 3 samples with 22 newly added SNP loci, wherein the rs891167 locus has no GG genotype sample in the early stage of product design, GG genotype Sanger verification of the locus is not carried out, and the comparison of MassARRAY results and Sanger results of 65 samples in total shows that the genotyping accuracy of the system verification experiment is 100%;
through 98 sample tests (NGS test 1P19Q combined deletion sample 41, and 1P19Q not combined deletion sample 57), the comparison result of NGS and MassARRAY shows that the accuracy of the system verification experiment is 100%.
TABLE 7 verification results of precision
Through comparison of the detection results of 3 samples in batches and 5 times of repetition, the batch precision and the consistency of the comparison between persons and the comparison between reagents of the system are all 100%.
TABLE 8 LOD test results
The NGS detection 1P19Q is selected to determine the combined deletion of tumor tissue nucleic acid, and the tumor proportion by gradient dilution is respectively: 45%, 40%, 30%, 25% and 20% of samples, and using the same batch number reagent in the same batch to finish 3 times of repeated detection of the same tumor proportion sample, wherein the LOD of the system of the invention is 30% of the tumor proportion;
by comparing the detection results of 3 batches and 5 times of repetition of a sample with 30% of tumor ratio (see precision experiment FOR31018400F1D1L1-30), the consistency of the LOD range detection of the system of the invention is 100%.
Finally, it should be noted that: the above embodiments are only used to illustrate the technical solution of the present invention, and not to limit the same; while the invention has been described in detail and with reference to the foregoing embodiments, it will be understood by those skilled in the art that: the technical solutions described in the foregoing embodiments may still be modified, or some or all of the technical features may be equivalently replaced; and the modifications or the substitutions do not make the essence of the corresponding technical solutions depart from the scope of the technical solutions of the embodiments of the present invention.
Claims (10)
1. A primer group for detecting SNP sites related to heterozygous deletion of chromosome lp/19q of brain glioma, wherein the SNP sites comprise: rs933032, rs4970520, rs1329113, rs586057, rs624971, rs2038366, rs6426368, rs1457093, rs7512426, rs67421541, rs36624, rs79887225, rs797257, rs2031958, rs16866144, rs10407280, rs12611404, rs10875362, rs212961, rs437229, rs2473287, rs1674139, rs859104, rs11666952, rs 112639, rs4908744, rs 94469, rs4803502, rs 11586586551, rs3766345, rs7507651, rs2385126, rs 1203975, rs 26621996, rs2641114, rs 2424569143, rs 897, rs 120118622, rs 291464658, rs 59978, rs33824, rs 3379107563005630056300736, rs 1077646, rs 2317646, rs 2319647736, rs 231964756345634563971, rs 2319647962, rs 23196479647962, rs.
2. The primer set according to claim 1, wherein the primer set is set 3 as follows:
the first group comprises primer groups for detecting rs933032, rs4970520, rs1329113, rs586057, rs624971, rs2038366, rs6426368, rs1457093, rs7512426, rs67421541, rs36624 and rs 79887225;
the second set comprises primer sets for detecting rs797257, rs2031958, rs16866144, rs10407280, rs12611404, rs10875362, rs212961, rs437229, rs2473287, rs1674139, rs859104, rs11666952, rs11247639, rs4908744, rs9426469 and rs 4803502;
the third set comprises primer sets for detecting rs11586551, rs3766345, rs7507651, rs2385126, rs 1203974, rs621996, rs2641114, rs 249143, rs891167, rs12032257, rs11879622, rs2914658, rs7359978, rs33824, rs4927030, rs58568071, rs10776736, rs260502, rs2015, rs 392312, rs4847150 and rs 1199668.
3. The primer set of claim 2, wherein the sequence of the primer set is as shown in SEQ ID No.1-100, or has at least 85% identity with SEQ ID No. 1-100.
4. The primer set as claimed in claim 3, wherein the primer set further comprises the extension primer shown in SEQ ID NO.101-150 or has at least 85% identity with SEQ ID NO. 101-150.
5. A product for detecting heterozygous deletion of glioma chromosome lp/19q, comprising the primer set according to any one of claims 1-4.
6. A kit for detecting heterozygous deletion of chromosome lp/19q of brain glioma, wherein the kit comprises the primer set according to any one of claims 1-4.
7. Use of the primer set according to any one of claims 1 to 4 for preparing a glioma assay product.
8. The use of claim 7, wherein said detection is carried out without detection of a control sample to determine loss of lp/19q heterozygosity; preferably, the judgment is to calculate the deletion score of the related heterozygous SNP site by (T1/T2)/(N1/N2); wherein T1/T2 represents the tumor tissue heterozygous peak SNR ratio, N1/N2 represents the blood sample heterozygous peak SNR ratio; if the site deletion score is less than 0.74, the site status is determined to be deleted; if the number of continuous deletion sites of the chr1p or chr19q in the sample is larger than that of continuous non-deletion sites and the deletion ratio of heterozygous sites is greater than 65%, judging the state of the chr1p or chr19q in the sample as deletion; and when the statuses of the chr1p and the chr19q are judged to be missing, judging the sample to be joint missing, and otherwise, judging the sample to be free of joint missing.
9. A method for detecting heterozygous deletion of chromosome lp/19q of glioma, which is characterized in that the method comprises the step of detecting the nucleotide of an SNP locus in a genome of a sample to be detected by using the primer set according to any one of claims 1 to 4 or the product or the kit according to any one of claims 5 to 6.
10. The method of claim 9, further comprising detecting the amplified and extended product using the MassARRAY system.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110946253.8A CN113462783B (en) | 2021-08-17 | 2021-08-17 | Brain glioma chromosome lp/19q detection method based on MassArray nucleic acid mass spectrum and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110946253.8A CN113462783B (en) | 2021-08-17 | 2021-08-17 | Brain glioma chromosome lp/19q detection method based on MassArray nucleic acid mass spectrum and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN113462783A true CN113462783A (en) | 2021-10-01 |
| CN113462783B CN113462783B (en) | 2022-03-22 |
Family
ID=77867939
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202110946253.8A Active CN113462783B (en) | 2021-08-17 | 2021-08-17 | Brain glioma chromosome lp/19q detection method based on MassArray nucleic acid mass spectrum and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN113462783B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN115631788A (en) * | 2022-10-20 | 2023-01-20 | 江苏先声医疗器械有限公司 | Gene pure heterozygous deletion detection method and system based on NGS platform |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109022579A (en) * | 2018-07-27 | 2018-12-18 | 北京先声医学检验实验室有限公司 | Detection method, kit and the primer sets of chromosome 1p/19q loss of heterozygosity |
| CN109666745A (en) * | 2019-02-15 | 2019-04-23 | 领星生物科技（上海）有限公司 | The detection method and kit of chromosome 1p/19q joint loss of heterozygosity |
| CN112626214A (en) * | 2020-12-29 | 2021-04-09 | 嘉兴允英医学检验有限公司 | Primer group, kit and method for detecting 1p/19q heterozygosity loss |
-
2021
- 2021-08-17 CN CN202110946253.8A patent/CN113462783B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109022579A (en) * | 2018-07-27 | 2018-12-18 | 北京先声医学检验实验室有限公司 | Detection method, kit and the primer sets of chromosome 1p/19q loss of heterozygosity |
| CN109666745A (en) * | 2019-02-15 | 2019-04-23 | 领星生物科技（上海）有限公司 | The detection method and kit of chromosome 1p/19q joint loss of heterozygosity |
| CN112626214A (en) * | 2020-12-29 | 2021-04-09 | 嘉兴允英医学检验有限公司 | Primer group, kit and method for detecting 1p/19q heterozygosity loss |
Non-Patent Citations (3)
| Title |
|---|
| CHIARA PESENTI等: "Mass spectrometry-based assay for the molecular diagnosis of glioma: concomitant detection of chromosome 1p/19q codeletion, and IDH1, IDH2, and TERT mutation status", 《ONCOTARGET》 * |
| HENDRIKUS J DUBBINK等: "Diagnostic Detection of Allelic Losses and Imbalances by Next-Generation Sequencing: 1p/19q Co-Deletion Analysis of Gliomas", 《J MOL DIAGN》 * |
| 苏江等: "实时荧光定量PCR微卫星分析技术检测少突胶质细胞肿瘤染色体1p、19q和10q杂合性缺失", 《中国康复理论与实践》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN115631788A (en) * | 2022-10-20 | 2023-01-20 | 江苏先声医疗器械有限公司 | Gene pure heterozygous deletion detection method and system based on NGS platform |
| CN115631788B (en) * | 2022-10-20 | 2023-09-29 | 江苏先声医疗器械有限公司 | Method and system for detecting gene heterozygous deletion based on NGS platform |
Also Published As
| Publication number | Publication date |
|---|---|
| CN113462783B (en) | 2022-03-22 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Søes et al. | Identification of accurate reference genes for RT-qPCR analysis of formalin-fixed paraffin-embedded tissue from primary non-small cell lung cancers and brain and lymph node metastases | |
| WO2023001211A1 (en) | Gene chip, molecular probe combination and kit for analyzing traits of sheep wool, and use | |
| WO2023001212A1 (en) | Gene chip, molecular probe combination and kit for analyzing sheep milk production performance, and use | |
| CN110577987A (en) | Detection method of CGG (glutamic acid G) repetitive sequence of FMR1 gene and application thereof | |
| CN113462783B (en) | Brain glioma chromosome lp/19q detection method based on MassArray nucleic acid mass spectrum and application thereof | |
| CN110846408A (en) | Primer combination for detecting TTN gene mutation and application thereof | |
| CN106987637A (en) | A kind of amplimer, kit and application for detecting the mutation of familial retinal pigment degeneration Disease-causing gene | |
| CN112342303A (en) | NGS-based human Y chromosome STR and SNP genetic marker combined detection system and detection method | |
| WO2017185758A1 (en) | Primer, probe, kit, and method for microchimerism assay and individual recognition | |
| CN109628559B (en) | Method and kit for detecting Y chromosome copy number variation | |
| CN115960997A (en) | Primer probe combination and kit for detecting exon14 skipping mutation of c-MET gene based on digital PCR platform | |
| CN113564266B (en) | SNP typing genetic marker combination, detection kit and application | |
| CN104450918B (en) | The method in detection FGF13 Exon 2 mutational site and test kit thereof | |
| CN114790484A (en) | MNP (MNP protein) marker site of xanthomonas oryzae, primer composition, kit and application of MNP marker site | |
| CN110305947B (en) | Detection method for chromosome long fragment insertion and long fragment insertion detection method based on MassARRAY platform | |
| CN106868128B (en) | Biomarker for auxiliary diagnosis of breast cancer and application thereof | |
| CN110423826A (en) | A kind of C57BL/6 subbreed mouse KASP genetic detection kit and primer | |
| CN111172248A (en) | General kit for verifying copy number variation based on fragment analysis technology | |
| Amr et al. | Targeted hybrid capture for inherited disease panels | |
| CN110607364B (en) | Method for determining genotype of allele by detecting SNP locus | |
| RU2795410C9 (en) | Biomarker panel and methods for detecting microsatellite instability in various types of cancer | |
| CN109609619B (en) | Method for detecting CYP11B1 gene exon copy number variation in vitro | |
| CN106119353A (en) | A kind of quick screening method of dominant family heredopathia pathogenic sites | |
| CN110616260B (en) | Deletion type beta thalassemia detection primer based on SNP analysis, kit and application | |
| CN109852704B (en) | Composite amplification kit for simultaneously detecting 32Y chromosome loci |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |