RU2795410C2 - Biomarker panel and methods for detecting microsatellite instability in various types of cancer - Google Patents

Abstract

FIELD: medical biotechnology.

SUBSTANCE: invention relates to oncology, in particular to cancers characterized by microsatellite instability (MSI) and/or mismatch repair deficiency (MMR−). A diagnostic panel of markers for the analysis of MSI loci is presented along with a method and kit for using the said panel in the detection of cancers characterized by microsatellite instability (MSI) and/or mismatch repair deficiency (MMR−). A cell derived from the HTC116 c1.110268743 cell line is presented for use as a control biological sample.

EFFECT: invention makes it possible to detect MSI in CRC even at its early stages in cancer tissue samples such as ovarian cancer, endometrial cancer and gastric cancer, the invention also can be used for prognostic and long-term studies in the context of immunotherapy.

23 cl, 7 dwg

Description

Field of invention

[0001] The present invention relates generally to the field of oncology, in particular to cancers characterized by microsatellite instability (MSI) and/or mismatch repair (MMR-) deficiency. Examples of such cancers include many colorectal tumors, stomach tumors, and endometrial tumors. Thus, the present invention provides a novel diagnostic marker panel for the analysis of MSI loci, together with methods and kits for using said panel in the detection of cancers characterized by microsatellite instability (MSI) and/or mismatch repair (MMR-) deficiency.

Background of the invention

[0002] Approximately 440,000 patients are diagnosed with colorectal cancer (CRC) each year in Europe and the United States. Recent guidelines such as the NCCN Patient Guidelines: Colon Cancer Version 1.2017 and the ESMO Clinical Practice Guidelines for Colorectal Cancer with a Familial Family History recommend screening for tumor mismatch repair (MMR) DNA deficiency and/or MSI status in all patients with CRC. However, at present, such studies are still underutilized due to the technical complexity that underlies them. In particular, it is difficult to test for all possible mutations underlying MMR deficiency, and although there are alternative approaches to screen for them, existing assays still require a long time to be manipulated in the laboratory and are therefore not suitable. to become routine in diagnosis.

[0003] The above obstacles naturally affect the management and thus potentially also the survival rates of many cancer patients. Indeed, in a significant proportion of colorectal carcinoma (CRC) cases, defects in the MMR genes have been found to be key to tumorigenesis and disease progression. For example, epigenetic silencing of the MLH1 gene involved in MMR is responsible for about 12% of CRCs. An additional 2-5% of cases are due to autosomal dominantly inherited loss-of-function mutations in one of the MLH1, MSH2, PMS2, or MSH6 genes involved in MMR. This inherited disorder of cancer predisposition is known as Lynch syndrome or hereditary non-polyposis CRC (HNPCC), which further leads to an increased risk of gastric and endometrial carcinoma (among others).

[0004] A significant number of genes are involved in the MMR pathway, and many different genetic and epigenetic disorders have been identified that affect this pathway. It is likely that a number of other violations have yet to be identified. Thus, it is more practical to diagnose defects in the MMR apparatus by screening for their direct result. The latter are the result of the accumulation of DNA replication errors throughout the genome, which can be observed as changes in the number of nucleotides due to deletion or insertion in sequences of single and double nucleotide repeats, for example (A) _n or (CA) _n . This phenomenon is known as microsatellite instability or MSI. If MMR deficiency leads to MSI in coding regions, then the most common result is promoter mutations or frameshift mutations resulting in lack of expression, expression of truncated proteins and/or proteins containing large novel sequences containing neoantigens. In addition, MSI at the intron-exon boundary regions has been shown to interfere with RNA splicing mechanisms and therefore also interfere with protein translation. In general, the MSI phenotype correlates with genomic instability, a higher mutation rate, and, as a result, with different tumor growth patterns and prognosis.

[0005] High MSI tumors (MSI-H) generally have a better prognosis and a reduced likelihood of metastasis compared to microsatellite stable tumors (MSS). Moreover, these two types of tumor also respond differently to different types of treatment. For example, early-stage CRC with MSI usually does not respond to 5-fluorouracil-based chemotherapy, which is currently the gold standard in the treatment of CRC (eg, Webber et al., 2015). On the other hand, MSI tumors exhibit elevated levels of at least five immune response checkpoint molecules, which are targets for therapeutic inhibitors currently being clinically tested (Llosa et al. 2014). For example, mismatch repair-deficient colorectal cancer patients are expected to respond particularly well to immunotherapy with anti-PD-1 antibodies, which act by blocking the interaction of PD-1 receptors on T cells and PD-L1 and PD-L2 receptors. on tumor cells, turning off their mechanisms of evasion from the immune system (Le et al., 2015). Numerous other compounds and biologically active substances, such as camptothecin or irinotecan, are also currently being tested for targeted anticancer therapies based on the unique molecular footprint of MSI.

[0006] Thus, it is already recognized that the identification of MSI status in tumors can have a huge impact on the outcome of treatment and, as a result, also on the quality of life and life expectancy of many patients with cancer. This is best demonstrated by the fact that multiple official guidelines already strongly recommend testing for MSI in colon cancer and Lynch syndrome. Such guidelines include, for example, NCCN guidelines for colon cancer, ESMO clinical practice guidelines for family history of colorectal cancer, revised Bethesda guidelines, the Amsterdam II clinical criteria, the US Common Colorectal Cancer Task Force, etc.

[0007] Currently, two methods are most commonly used for testing MSI: immunohistochemical analysis (IHC) and capillary electrophoresis. IHC is an expensive, laborious and time consuming technique with a high false negative rate. In capillary electrophoresis, fluorescent PCR is used to amplify specific genomic regions containing nucleotide repeats in tumor cells and normal cells, and then determine the presence of instability by comparing the length of the amplification products. Throughout the genome, there are hundreds of thousands of microsatellite loci that could potentially be used in MSI analysis (Ellegren, Nat Rev Genet. 2004).

[0008] For example, the MSI consensus panel, developed in 1997 and known as the Bethesda panel, includes 5 microsatellite markers, including 2 mono- or homonucleotide repeats of 25 and 26 nucleotides in length (BAT25 and BAT26, respectively) and 3 double-nucleotide repeats (D2S123, D5S346 , D17S250) (Boland et al, 1998). A sample tested with the Bethesda panel is defined as having a high frequency of MSI or an "MSI-H" phenotype if 30% or more markers (i.e., at least 2 in a 5-marker panel) are determined to be unstable. If one marker out of five (or <30% of tumor markers) is rated as MSI positive, then the sample is designated as having a low frequency of MSI or "MSI-L". Finally, if no altered markers are found, then the sample is considered MSI-stable or "MSS" (Boland et al, 1998).

[0009] However, although the Bethesda panel is the current standard for MSI testing, it has a number of disadvantages, such as uneven distribution of loci in different ethnic populations and different types of tumors. In particular, it shows low sensitivity, especially for cancers other than colorectal cancer, for which it was originally developed (Boland et al, 1998). These and other factors led to its expansion and/or diversification by individual physicians and research laboratories with additional markers, which subsequently led to a loss of standardization and poor reproducibility. Examples of the above include, for example, Murphy et al, 2006 and WO2006047412 (Promega). Alternatively, brand new microsatellite markers that do not overlap with any of the Bethesda panel have also been described in, for example, WO2013153130 (VIB) and Zhao et al, 2014 (eLife).

[0010] Another disadvantage of currently known approaches is their level of complexity, the need for specialized instruments, thermal cyclers that go beyond standard laboratory ones, as well as their limited technical capabilities in terms of automation. Bethesda classic panel testing is actually an open tube test, which increases the chances of cross-contamination. In addition, testing requires skilled laboratory personnel and is time-consuming, costly, and labor-intensive. Typically, current MSI detection techniques use one of the following principles: (i) use of fluorescently labeled primers to detect Bethesda panel markers followed by capillary electrophoresis; (ii) high resolution melt curve analysis of 5 markers from the Bethesda panel using dsDNA intercalating dye; (iii) mass spectrometric detection of alleles of different lengths and (iv) new generation sequencing (NGS) of large DNA regions (e.g. exome) followed by counting the number of mutations or the number of homopolymeric regions in a mismatched setting (Campbell et al., 2017, Cell ).

[0011] For example, in (i) Bethesda's original PCR-based screening strategy requires expert interpretation, preventing efficient and easy automation. Further, with regard to (ii), high resolution melt curve analysis using dsDNA intercalating dyes has the disadvantage of very limited multiplexing capabilities for screening several different MSI markers in one run, since the melting temperature for each amplicon of the corresponding marker must be sufficiently degrees differ so as not to receive overlapping signals. Moreover, since this strategy is based on the formation of heteroduplexes between normal and mutant length alleles, it is also less sensitive than other alternatives. Further, regarding (iii), the mass spectrometry-based method (Zhao et al, 2014) is also inherently amenable to automation, but requires specialized instrumentation and highly skilled personnel to interpret the data. Finally, with respect to (iv), although NGS certainly has the advantage of analyzing a very large number of MSI-indicating positions in the genome or exome, and not just in selectable markers, and although this method is in principle also amenable to at least partially automated, it is currently expensive and requires specialized NGS equipment. As far as homopolymer scoring is concerned, NGS is still not reliable enough for multiple scoring of individual homopolymer repeats, as it is still prone to loss of information about single nucleotide insertions/deletions in a strand of repeat nucleotides. In addition, due to the acquisition of a large amount of data, it remains time-consuming, complex and requires a highly qualified analyst.

[0012] In conclusion, MSI testing is in high demand in medicine, a need for which is currently only partially met by existing diagnostic methods due to their technical limitations. These include, in particular, limited detection capabilities, high cost and/or execution time, the need for specialized equipment, and/or the interpretation of results by a highly qualified expert. The present invention overcomes the above drawbacks by providing a highly sensitive set of only a few short MSI homopolymer markers of the type described in WO2013153130, together with an exceptionally reliable method for detecting homonucleotide insertions or deletions (inserts/deletions) in their sequences. This method is very convenient for automation, does not require specific molecular infrastructures, and can be carried out using standard laboratory equipment, such as a conventional thermal cycler connected to a computer. In addition, it allows easy duplexing or even higher level multiplexing of selected markers, which has the advantage of further limiting the required laboratory material, and thus simplifies implementation in existing PCR-based platforms. It is important to note that this method provides very reliable results and allows easy and fully automated interpretation with a direct report as output. The inventors of the present invention demonstrate that under the present conditions, after receiving a tissue sample, such complete readings of insertion/deletion statuses can be obtained in less than 3 hours. Thus, the novel panel of markers and method for their detection presented herein provides a new, highly advantageous alternative for detecting MSI in CRC even at its early stages (as will be shown below) and in other cancer tissue samples such as ovarian cancer, endometrial cancer, and gastric cancer, as well as for prognostic and long-term studies in the context of immunotherapy. These and other advantages and applications of the present invention are presented below.

Brief description of the invention

[0013] The present invention is defined in the independent claims of the appended claims. Preferred embodiments are defined in the dependent claims. In particular, the present invention relates to a panel of biomarkers for the analysis of MSI loci in a biological sample, the panel containing the following regions of homopolymer repeats that are mapped to the reference human genome GRCh38/hg38:

a homopolymer repeat containing 11 consecutive adenines located in the human DIDO1 gene and starting at position chr20:62905340;

homopolymer repeat containing 11 consecutive adenines, localized in the human MRE11 gene and starting at position chr11:94479765;

a homopolymer repeat containing 10 consecutive adenines located in the human SULF2 gene and starting at position chr20:47657577; And

homopolymer repeat containing 8 consecutive adenines, localized in the human ACVR2A gene and starting at position chr2:147926117.

[0014] It is also important that the present invention relates to a method for analyzing MSI loci in a biological sample, comprising the step of:

- determination of the number of nucleotides in the following homopolymer repeats, which are mapped to the reference human genome GRCh38/hg38:

homopolymer repeat containing 11 consecutive adenines, localized in the human DIDO1 gene and starting at position chr20:62905340;

homopolymer repeat containing 11 consecutive adenines, localized in the human MRE11 gene and starting at position chr11:94479765;

a homopolymer repeat containing 10 consecutive adenines located in the human SULF2 gene and starting at position chr20:47657577; And

homopolymer repeat containing 8 consecutive adenines, localized in the human ACVR2A gene and starting at position chr2:147926117.

[0015] Within the framework of the foregoing, the present invention also relates to a kit for the analysis of MSI loci in a biological sample, while the kit contains means for amplifying nucleic acid regions containing at least the above homopolymer repeats.

[0016] Finally, while importantly, the present invention also relates to a cell or any other material, in particular genetic material derived from the cell line HTC116 cl. in several other preferred homopolymer repeats. The cell line HTC116 cl.110268743 was successfully deposited under the Budapest Treaty with the BCCM/GeneCorner depository in Belgium under accession number LMBP 12278CB.

Brief description of graphic materials

[0017] For a more complete understanding of the essence of the present invention, reference is made to the following detailed description, considered in conjunction with the accompanying drawings, on which:

Figure 1 shows MSI status for 7 microsatellite markers (BTBD7, RYR3, SEC31A, ACVR2A, DIDO1, MRE11 and SULF2) in 128 colorectal cancer samples with MSI-H. Different panels show MSI status (white, MSS; dark grey, MSI-H) when samples are evaluated against a minimum set of A) 4 markers, and B), C) and D) - sequentially adding a marker to a minimum set of 4 markers. Marker status for individual samples is indicated as wild type (light grey) or mutant (grey);

Figure 2 shows MSI status for 7 microsatellite markers (BTBD7, RYR3, SEC31A, ACVR2A, DIDO1, MRE11 and SULF2) in 15 MSI-H gastric cancer samples and 19 endometrial cancer samples. Different panels show MSI status (white, MSS; dark grey, MSI-H) when samples are evaluated against a minimum set of A) 4 markers, and B), C) and D) - sequentially adding a marker to a minimum set of 4 markers. Marker status for individual samples is indicated as wild type (light grey) or mutant (grey) or no result (diagonal line).

Figure 3: Mutation load (measured by number of substitutions (left panel), number of insertions/deletions (middle panel) or all mutations (right panel)) at 33 s MSI-H versus 89 samples with MSS.

Figure 4: Mutation load (measured by the number of somatic events (substitutions and insertions/deletions) in MSI-H compared to samples with MSS, depending on the type of cancer. EM - endometrial, CRC - colorectal.

Figure 5A: Plot of correlation between the number of mutant microsatellite markers from 1 to 6 (BTBD7, RYR3, SEC31A, ACVR2A, DIDO1 and MRE11) and mutation load in MSI samples measured by (A) the number of somatic substitutions (correcting with the number insertions/deletions, number of substitutions, and number of mutant markers correlate with p-value = 1.92e-07) or by (B) number of somatic insertions/deletions (while adjusting for substitutions, number of insertions/deletions, and number of mutant markers correlate with p-value = 7.1e-07), (C) Correlation between somatic substitutions and insertions/deletions in MSI tumor showing high correlation between somatic substitutions and insertions/deletions in MSI-H samples. The correlation is consistent for both types of EM tumors with MSI and CRC tumors with MSI, but not for tumors with MSS.

Figure 5B: Plots of the correlation between the number of mutant microsatellite markers and mutation burden as shown in FIG. 5A above, but supplemented with data for another marker (SULF2). (A) shows a correlation with the number of somatic substitutions, with the addition of one more marker changing the p-value to 6.5e-05). (B) shows the correlation with the number of somatic insertions/deletions, with the addition of one more marker changing the p-value to 2e-16. In (C) the correlation between somatic substitutions and insertions/deletions is shown, and it can be seen that the addition of one more marker further improves the significance of the correlation in MSI-H samples.

Figure 6: Number of positive markers as a predictor for tumor mutation load (TMB). On average, more than 348 substitutions and more than 119 insertions/deletions were observed with an increase of one positive marker (data shown for 7 markers, as presented in figure 5B).

Figure 7: Overview of CRC tumor staging associated with fit, inappropriate, erroneous and mismatch results in the MSI testing method according to the present invention implemented in the Biocartis Idylla platform compared to IHC analysis.

Detailed description of the invention

[0018] The present invention generally relates to a new MSI biomarker panel, methods of using this panel, automated systems and kits for carrying out these methods, while the kits may preferably contain or may be presented in the form of a cartridge compatible with these automated systems, and contain means, and preferably a positive control material to detect insertions/deletions in the specified panel.

[0019] In a preferred embodiment, the present invention provides a panel of biomarkers for analyzing MSI loci in a biological sample, wherein the panel contains at least the following regions of homopolymer repeats or mutant forms thereof (wherein the mutation is the presence of at least one insertion/deletion in homopolymer repeat sequences) that are mapped to the reference human genome GRCh38/hg38:

a homopolymer repeat containing 11 consecutive adenines located in the human DIDO1 gene and starting at position chr20:62905340;

homopolymer repeat containing 11 consecutive adenines, localized in the human MRE11 gene and starting at position chr11:94479765;

a homopolymer repeat containing 10 consecutive adenines located in the human SULF2 gene and starting at position chr20:47657577; And

homopolymer repeat containing 8 consecutive adenines, localized in the human ACVR2A gene and starting at position chr2:147926117.

[0020] The present inventors tested a plurality of randomly selected markers of the type disclosed in WO2013153130 (VIB) which are homopolymers substantially shorter than the markers in the Bethesda panel. Random selection of fewer markers from the preferred set of 56 markers disclosed in that document did not result in a robust assay capable of repeatedly detecting the MSI-H phenotype in a wide range of human cancer samples with the minimum and most basic laboratory resources. The markers were either not detectable in the multiplex or even duplex reaction, or there was variation in the number of nucleotides among different ethnic groups of people. Random selection of an exon homopolymer repeat containing 8 contiguous adenines located in the human ACVR2A gene starting at position chr2:147926117, which is not disclosed in the preferred set of 56 in WO2013153130, and an exon homopolymer repeat containing 11 contiguous adenines located in the human MRE11 gene and starting at position chr11:94479765, which is not disclosed at all in WO2013153130, unexpectedly resulted in a highly efficient panel for detecting MSI in MMR-deficient human tumors.

[0021] The performance of the minimum panel of only 4 markers presented herein was found to exceed the minimum acceptable performance set at 95% for correctly identifying MSI-H confirmed human colorectal cancer specimens. In the Examples section below, the present inventors demonstrate that the above minimal panel of the present invention is able to successfully detect 123 MSI-H positive samples in a pool of 128 MSI-H CRC samples, representing 96% of the samples correctly identified as MSI-H. h. Thus, in a preferred embodiment, there is provided a panel having a correct identification rate of at least 90%, preferably at least 95%, of tumor samples with MSI-H.

[0022] It is logical that by adding additional markers, this efficiency can be gradually increased. Thus, in a preferred embodiment of the present invention, there is provided a panel according to the previous embodiment, further comprising any one, two, or all of the following three homopolymer repeat regions, or mutant forms thereof, that are mapped to the human GRCh38/hg38 reference genome:

a homopolymer repeat containing 10 consecutive adenines located in the human BTBD7 gene and starting at position chr14:93241685;

a homopolymer repeat containing 9 consecutive thymines located in the human SEC31A gene and starting at position chr4:82864412;

homopolymer repeat containing 10 consecutive adenines, localized in the human RYR3 gene and starting at position chr15:33865341.

[0023] The homopolymer repeat markers provided herein, which comprise the panel of biomarkers of the present invention, are only short strands of no more than 11 repeat homonucleotides, eg 11 consecutive adenines in the 3'UTR of DIDO1. One skilled in the art will appreciate that their complementary sequences, for example the 11 consecutive thymines complementary to the 11 consecutive adenines in the DIDO1 3'UTR sequence, should also be construed as falling within the scope of the above-mentioned terms used herein.

[0024] In a particularly preferred embodiment, a panel is provided containing the following five regions of homopolymer repeats, or mutant forms thereof, that are mapped to the reference human genome GRCh38/hg38:

a homopolymer repeat containing 11 consecutive adenines located in the human DIDO1 gene and starting at position chr20:62905340;

homopolymer repeat containing 11 consecutive adenines, localized in the human MRE11 gene and starting at position chr11:94479765;

a homopolymer repeat containing 10 consecutive adenines located in the human SULF2 gene and starting at position chr20:47657577;

homopolymer repeat containing 8 consecutive adenines, localized in the human ACVR2A gene and starting at position chr2:147926117; And

homopolymer repeat containing 10 consecutive adenines, localized in the human BTBD7 gene and starting at position chr14:93241685.

Using this core set of five markers, 124 out of 128, i.e. 97% of tumor samples can be identified as MSI-H.

[0025] In another preferred embodiment, a panel is provided containing the following six regions of homopolymer repeats, or mutant forms thereof, that are mapped to the reference human genome GRCh38/hg38:

a homopolymer repeat containing 11 consecutive adenines located in the human DIDO1 gene and starting at position chr20:62905340;

homopolymer repeat containing 11 consecutive adenines, localized in the human MRE11 gene and starting at position chr11:94479765;

a homopolymer repeat containing 10 consecutive adenines located in the human SULF2 gene and starting at position chr20:47657577;

homopolymer repeat containing 8 consecutive adenines, localized in the human ACVR2A gene and starting at position chr2:147926117;

a homopolymer repeat containing 10 consecutive adenines located in the human BTBD7 gene and starting at position chr14:93241685; And

homopolymer repeat containing 9 consecutive thymines, localized in the human SEC31A gene and starting at position chr4:82864412.

By further adding an additional marker located in the SEC31A gene to the core set of markers, all 128 samples can be assessed as MSI-H, making the panel even more effective in determining MSI status.

[0026] In yet another preferred embodiment, a panel is provided containing the following seven homopolymer repeat regions, or mutant forms thereof, that are mapped to the GRCh38/hg38 human reference genome:

a homopolymer repeat containing 11 consecutive adenines located in the human DIDO1 gene and starting at position chr20:62905340;

homopolymer repeat containing 11 consecutive adenines, localized in the human MRE11 gene and starting at position chr11:94479765;

a homopolymer repeat containing 10 consecutive adenines located in the human SULF2 gene and starting at position chr20:47657577;

homopolymer repeat containing 8 consecutive adenines, localized in the human ACVR2A gene and starting at position chr2:147926117;

a homopolymer repeat containing 10 consecutive adenines located in the human BTBD7 gene and starting at position chr14:93241685;

homopolymer repeat containing 9 consecutive thymines, localized in the human SEC31A gene and starting at position chr4:82864412; And

homopolymer repeat containing 10 consecutive adenines, localized in the human RYR3 gene and starting at position chr15:33865341.

The set of the above seven markers is calculated to reduce the potential false negative rate to ~ 1/1900. Thus, the addition of another marker compatible with the panels of the previous embodiments provides an additional guarantee of effectiveness, in particular in the implementation of the panel in the detection of MSI in different cancers other than colorectal, for example, in ovarian cancer, endometrial cancer and gastric cancer.

[0027] In a preferred embodiment, the biological sample is obtained from an individual with a suspected tumor. In another embodiment, the biological sample is a tumor sample, presumably fresh tissue, or a fixed tumor sample, such as a frozen sample or a FFPE sample. In a particularly preferred embodiment, the tumor is selected from a colorectal tumor, an ovarian tumor, an endometrial tumor, or a gastric tumor. In another possible embodiment, the sample is a liquid biopsy. In another possible embodiment, the sample is any tissue sample, such as peripheral blood mononuclear cells (PBMC) or other leukocytes or skin tissue from a patient suspected of having Lynch syndrome.

[0028] It is a further object of the present invention to provide a method for analyzing MSI loci in a biological sample, the method comprising the step of determining the number of nucleotides in a panel of biomarkers according to the embodiments described above.

[0029] Therefore, in one embodiment, the present invention provides a method for analyzing MSI loci in a biological sample, comprising the step of:

- determination of the number of nucleotides in the following homopolymer repeats, which are mapped to the reference human genome GRCh38/hg38:

homopolymer repeat containing 11 consecutive adenines, localized in the human DIDO1 gene and starting at position chr20:62905340;

homopolymer repeat containing 11 consecutive adenines, localized in the human MRE11 gene and starting at position chr11:94479765;

a homopolymer repeat containing 10 consecutive adenines located in the human SULF2 gene and starting at position chr20:47657577; And

homopolymer repeat containing 8 consecutive adenines, localized in the human ACVR2A gene and starting at position chr2:147926117.

[0030] For the same reasons described above, in a preferred embodiment, the method of the present invention further comprises determining the number of nucleotides in any one, two, or all of the following homopolymer repeat regions that are mapped to the human GRCh38/hg38 reference genome:

a homopolymer repeat containing 10 consecutive adenines located in the human BTBD7 gene and starting at position chr14:93241685;

a homopolymer repeat containing 9 consecutive thymines located in the human SEC31A gene and starting at position chr4:82864412;

homopolymer repeat containing 10 consecutive adenines, localized in the human RYR3 gene and starting at position chr15:33865341.

[0031] In a particular embodiment, a method is provided comprising the step of:

- determination of the number of nucleotides in the following five homopolymer repeats, which are mapped to the reference human genome GRCh38/hg38:

homopolymer repeat containing 11 consecutive adenines, localized in the human DIDO1 gene and starting at position chr20:62905340;

homopolymer repeat containing 11 consecutive adenines, localized in the human MRE11 gene and starting at position chr11:94479765;

a homopolymer repeat containing 10 consecutive adenines located in the human SULF2 gene and starting at position chr20:47657577; homopolymer repeat containing 8 consecutive adenines, localized in the human ACVR2A gene and starting at position chr2:147926117; And

homopolymer repeat containing 10 consecutive adenines, localized in the human BTBD7 gene and starting at position chr14:93241685.

[0032] In a more specific embodiment, a method is provided comprising the step of:

- determination of the number of nucleotides in the following six homopolymer repeats, which are mapped to the reference human genome GRCh38/hg38:

homopolymer repeat containing 11 consecutive adenines, localized in the human DIDO1 gene and starting at position chr20:62905340;

homopolymer repeat containing 11 consecutive adenines, localized in the human MRE11 gene and starting at position chr11:94479765;

a homopolymer repeat containing 10 consecutive adenines located in the human SULF2 gene and starting at position chr20:47657577;

homopolymer repeat containing 8 consecutive adenines, localized in the human ACVR2A gene and starting at position chr2:147926117;

a homopolymer repeat containing 10 consecutive adenines located in the human BTBD7 gene and starting at position chr14:93241685; And

homopolymer repeat containing 9 consecutive thymines, localized in the human SEC31A gene and starting at position chr4:82864412.

[0033] In another specific embodiment, a method is provided comprising the step of:

- determination of the number of nucleotides in the following seven homopolymer repeats, which are mapped to the reference human genome GRCh38/hg38:

homopolymer repeat containing 11 consecutive adenines, localized in the human DIDO1 gene and starting at position chr20:62905340;

homopolymer repeat containing 11 consecutive adenines, localized in the human MRE11 gene and starting at position chr11:94479765;

a homopolymer repeat containing 10 consecutive adenines located in the human SULF2 gene and starting at position chr20:47657577;

homopolymer repeat containing 8 consecutive adenines, localized in the human ACVR2A gene and starting at position chr2:147926117;

a homopolymer repeat containing 10 consecutive adenines located in the human BTBD7 gene and starting at position chr14:93241685;

a homopolymer repeat containing 9 consecutive thymines located in the human SEC31A gene and starting at position chr4:82864412; And

homopolymer repeat containing 10 consecutive adenines, localized in the human RYR3 gene and starting at position chr15:33865341.

[0034] In possible embodiments, the method of the present invention may further comprise the step of diagnosing MSI status in a biological sample if an insertion/deletion is detected in at least two homopolymer repeats.

[0035] Preferably, the methods of the present invention are provided wherein the biological sample obtained from the subject is a tumor or a sample of a putative tumor. In principle, the methods disclosed herein can be carried out using any confirmed or putative tumor sample. In a preferred embodiment, the tumor is a colorectal tumor, gastric tumor, ovarian tumor, or endometrial tumor.

[0036] Those skilled in the art will appreciate that the properties of the homopolymer repeat marker panel of the present invention determine that the methods of the present invention will preferably be carried out using genomic DNA present in biological samples. Depending on the type of sample, in a preferred embodiment, the method of the present invention was preceded by any of the following steps:

- extracting and/or isolating a nucleic acid potentially containing a target sequence from a nucleic acid source;

- providing said extracted and/or purified nucleic acid potentially containing a target for the step of amplifying said nucleic acid.

[0037] Because genomic DNA is a rich and complex nucleic acid material, it is advantageous for the sequences flanking the homopolymer repeat regions defined above to be amplified to the step of determining their nucleotide count. Thus, in a preferred embodiment, a method is provided further comprising the step of:

- amplification of nucleic acid regions containing the homopolymer repeats listed above. It will be apparent to one of skill in the art that such amplification will produce amplification products containing a homopolymer repeat sequence, regardless of its MSI status. That is, such amplification products may contain a wild-type (WT) variant of said homopolymer repeat or an MSI variant thereof, i.e., a mutant containing the insertion/deletion of at least one homonucleotide in the sequence of the homopolymer repeat.

[0038] Naturally, in an obvious embodiment, the amplification is preferably performed by polymerase chain reaction (PCR), for example, using means for performing PCR, such as suitable reagents and/or a thermal cycler device. However, other amplification techniques known in the art may also be used. These include, but are not limited to, isothermal loop amplification (LAMP), nucleic acid sequence based amplification (NASBA), strand displacement amplification (SDA), multiple strand displacement amplification (MDA), rolling ring amplification (RCA), ligase chain reaction (LCR), helicase dependent amplification (HDA) or ramification method amplification (RAM).

[0039] In a preferred embodiment, a method is provided wherein the amplification step involves the use of at least one primer having a sequence identified by any of the following SEQ ID NOs: 1-14:

for DIDO1 marker:

SEQ ID NO: 1 - TAGCGTGTGAATCGGACAT

SEQ ID NO: 2 - TTGACTGGGCAGATAGGGGA

For MRE11 marker:

SEQ ID NO: 3 - ATAGTTCACCCATGGAAACC

SEQ ID NO: 4 - GGAGGAGAATCTTAGGGAAA

For BTBD7 marker:

SEQ ID NO: 5 - ACTGGACTCCCGCTGG

SEQ ID NO: 6 - CGCTCAGCCTCCATAAATC

For the SULF2 marker:

SEQ ID NO: 7 - CAACTTCATTTCTTTTCAGTACCTT

SEQ ID NO: 8 - CTGTCCAGATACCATTTCTC

For ACVR2A marker:

SEQ ID NO: 9 - AGCATCCATCTCTTGAAGACAT

SEQ ID NO: 10 - GCATGTTTCTGCCAATAATCTCT

For SEC31A marker:

SEQ ID NO: 11 - CAACTTCAGCAGGCTGT

SEQ ID NO: 12-AGTCTGAGAAGCATCAATTTT

For RYR3 marker:

SEQ ID NO: 13 - CATTTTCTAAATGCCTCCCTTAAA

SEQ ID NO: 14 - GTCCATTAGGCACAAAAAG

[0040] In a more specific embodiment, the stage of amplification involves the use of at least one pair of primers selected from the following: SEQ ID NO: 1 and SEQ ID NO: 2; SEQ ID NO: 3 and SEQ ID NO: 4; SEQ ID NO: 5 and SEQ ID NO: 6; SEQ ID NO: 7 and SEQ ID NO: 8; SEQ ID NO: 9 and SEQ ID NO: 10; SEQ ID NO: 11 and SEQ ID NO: 12 or SEQ ID NO: 13 and SEQ ID NO: 14.

[0041] Any person skilled in the art will understand that depending on the amplification conditions, the above primer sequences will probably work also if 1, 2 or in some cases even possibly 3 nucleotides in them are changed, i.e. added, removed or replaced by another nucleotide or a modified nucleotide. Thus, in a possible embodiment of the present invention, at least one primer sequence is also provided, using any of the above SEQ ID NOs: 1-14, where 1, 2 or 3 nucleotides have been changed. In an alternative embodiment, the present invention also provides at least one primer sequence that is at least 80%, preferably at least 85%, more preferably at least 90%, or most preferably at least 95% identical to any from the above sequences under SEQ ID NO: 1-14. Those skilled in the art will appreciate that, in order to obtain amplicons spanning the homopolymer repeat regions of interest, alternative primers of 5, 10, 20, 50, or 100 nucleotides can be designed spanning regions above or below the positions of the primer pairs described above. Thus, such alternative primer pairs should also be considered as an alternative obvious embodiment of the present invention.

[0042] The method presented here has the advantage of being fully automated and adaptable to any standard quantitative PCR thermal cycler, allowing it to be performed by normal laboratory personnel without the need for special training. In addition to the above, the method is highly sensitive, suitable for multiplexing, can provide an estimate of the relative amounts of detected sequences of homopolymeric nucleotide repeats and their variants. Therefore, in a possible embodiment, the PCR may be quantitative or semi-quantitative PCR

[0043] Because the methods of the present invention are concerned with detecting changes in the number of homonucleotides in a strand of very short (ie < 12 nt) homonucleotide repeat sequences, it is preferred that they be highly specific. For example, during amplification of homopolymer repeat regions, polymerase slippage occurs. This leads to errors in copying the initial number of repeated nucleotides, which causes the accumulation of artificial deletions or insertions in the amplified PCR product. Therefore, in a preferred embodiment, the amplification step is carried out using a corrective polymerase, ie a polymerase having 3'-5' exonuclease activity. Many such PCR polymerases are known and commercially available. Examples include, without limitation, polymerases such as Q5, Pfx, Pfu, Ex Taq, etc.

[0044] In more preferred embodiments, analysis of the melting curve of nucleic acid amplification products is used in the step of determining the number of nucleotides. Therefore, in a particularly advantageous embodiment of the methods of the present invention, the amplification step provides melt curve data.

[0045] Melting or melting curve analysis is an evaluation of the dissociation or association characteristics of a double-stranded nucleic acid molecule during temperature changes. Therefore, melt curve data is to be understood as any data representing either the dissociation characteristics or the association characteristics of a nucleic acid molecule obtained by assaying, for example, a target nucleic acid amplification product. Melting curve data can be obtained by incorporating suitable fluorescent fragments into test samples that are processed with any amplification instrument or method such as thermal cycling, PCR, quantitative PCR, etc. These data can be obtained using any apparatus that is equipped with the means bringing the temperature of the sample to a temperature above the melting point of the DNA sample, and which is equipped with known fluorometric or spectrophotometric means. Examples of such instruments include, without limitation, standard optical thermal cyclers commonly used for qPCR or temperature controlled fluorometers, etc.

[0046] Melt curve analysis and high resolution melt analysis (HRM) are methods commonly used to detect and analyze the presence of nucleic acid sequences in a sample. One way to control the dissociation and association characteristics of a nucleic acid is with dyes. The detection chemistries used for qPCR and melt curve analysis are based on (a) chemistries that typically detect the fluorescence of a target-binding dye, e.g., a DNA-binding fluorophore such as LC Green, LC Green+, Eva Green, SYTO9 CYBR Green, or (b) targeted chemistry reactions that typically use fluorophore labeled DNA probes such as beacon probes and/or primers such as scorpion primers. It is well known in the art that other detection chemistries can be used in melt curve analysis.

[0047] In one embodiment of the present invention, the amplification products are heated in the presence of one or more intercalating dyes during a melt curve test procedure. DNA dissociation during heating can be measured by a significant reduction in the resulting fluorescence. In another specific embodiment, the amplification products are heated in the presence of one or more dye-labeled nucleic acids, such as one or more probes, during a melt curve procedure. In the case of probe-based fluorescent melt curve analysis, the variability in nucleic acid detection is based on the melt temperature obtained from thermal denaturation of the probe-target hybrid. As heating of the resulting amplicons continues, changes in signal strength are detected as a function of temperature, typically within a temperature range, to provide baseline melt curve data.

[0048] In preferred embodiments of the methods of the present invention, amplification involves the use of a probe. In principle, any target-specific oligonucleotide probe suitable for performing melt curve analysis can be used in possible embodiments. Preferred known probes may include a pair of fluorophore and quencher, and may also preferentially form secondary structures such as loops or hairpins.

[0049] In particular, "molecular beacon" or "molecular beacon" probes are preferred, which are hairpin-shaped molecules with an internally quenched fluorophore that regain fluorescence when they bind to a target nucleic acid sequence. In this regard, "molecular beacons" are not destroyed by the action of polymerase and can be used in the study of the kinetics of hybridization with their target by determining the melting curve. The length of a typical molecular beacon probe is about 20, preferably 25 nucleotides or more. Typically, the length of the region that is complementary to and binds to the target sequence is 18-30 base pairs. The structure and mechanism of action of "molecular beacons" are widely known in the art.

[0050] Therefore, in a particularly preferred embodiment, a method is provided wherein the amplification step involves the use of at least one molecular beacon probe.

[0051] In a preferred embodiment of the above embodiments, the molecular beacon probe contains a sequence identical or complementary to a mutant homopolymer nucleotide repeat sequence characterized by a deletion of at least one homonucleotide in the target homopolymer repeat sequence. This "molecular beacon" structure provides highly sensitive and specific detection of the selected MSI mutant marker while remaining sufficiently sensitive to the wild-type (i.e. putative) marker. It should be noted that the term "target sequence of homopolymeric nucleotide repeats" means the sequence of homopolymeric repeats of the wild type or the reference sequence of homopolymeric repeats expected in the absence of MSI. Conversely, by "mutant homopolymeric nucleotide repeat sequence" is meant a homopolymeric nucleotide repeat sequence characterized by the insertion or deletion of at least one homonucleotide in the homopolymeric repeat sequence. The difference between the original melting data for the wild type and for the mutant form will then be measured, which will be a characterization of the original melting curve data.

[0052] In a specific embodiment, a method is provided wherein at least one molecular beacon probe has a sequence identified in any of the following SEQ ID NOs:

[0053] In an exemplary embodiment, at least one molecular beacon probe is provided that has a certain degree of sequence variability relative to the above sequences under SEQ ID NO. 15-21. The reason for this variability may be the use of a different stem type sequence of the molecular beacon (highlighted in italics above) or deletion or addition of nucleotides to the beacon hybridizing portion that is specific for the sequence to be detected (indicated in bold above). The latter may include the addition or deletion of 1 or 2 nucleotides in homopolymer repeat sequences, or include more or less nucleotides in said flanking repeat sequence.

[0054] Due to the specificity thus imparted to said probe of the "molecular beacon" type for one marker of homopolymer repeats and its unstable (mutant) variants, it is also possible to develop a multiplex analysis in which at least two probes, and presumably more, of the type " molecular beacon" is used in one reaction tube or in one compartment.

[0055] Thus, in another preferred embodiment, a method is provided wherein the amplification step comprises at least one duplex amplification of a pair of homopolymer repeats, said pair being selected from the following combinations:

- duplex amplification of a homopolymer repeat containing 11 consecutive adenines located in the human DIDO1 gene and starting at position chr20:62905340, together with a homopolymer repeat containing 11 consecutive adenines located in the human MRE11 gene and starting at position chr11:94479765;

- duplex amplification of a homopolymeric repeat containing 8 consecutive adenines located in the human ACVR2A gene and starting at position chr2:147926117, together with a homopolymeric repeat containing 9 consecutive thymines located in the human SEC31A gene and starting at position chr4:82864412; And

- duplex amplification of a homopolymer repeat containing 10 consecutive adenines located in the human BTBD7 gene and starting at position chr14:93241685, together with a homopolymer repeat containing 10 consecutive adenines located in the human SULF2 gene and starting at position chr20:47657577.

[0056] In a particularly advantageous embodiment, which greatly improves the robustness of the methods of the present invention, in particular when using multiplexing, a novel approach is adopted that uses a wavelet transform function on the original melt curve data.

[0057] Wavelets are mathematical functions that separate data into different frequency components, and then each component is analyzed with a resolution comparable to its scale. Such basis functions are short waves with limited duration. The basis functions of the wavelet transform lead to the frequency. There are many different wavelets that can be used as basis functions. The basis function ~(t), also called the mother wavelet, is the transformation function. The term "mother" implies that the features with a different feature carrier portion that is used in the transform method are derived from one main feature or mother wavelet. In other words, the mother wavelet is a prototype for creating other window functions. In general, the wavelet ψ(t) is a complex-valued function. The general wavelet function is defined as:

This shift parameter 'τ' determines the position of the window in time, and thus it determines which part of the signal x(t) is analyzed. In the wavelet transform analysis, the frequency variable 'ω' is replaced by the scale variable 's', and the time shift variable is represented by 'τ'.

[0058] The wavelet transform uses these mother wavelet functions and decomposes the signal x(t) into a weighted set of scaled wavelet functions ψ(t). The main advantage of using wavelets is that they allow the characteristic and unique signature of a given larger and more complex data set to be captured without resulting data loss.

[0059] For example, two large initial melt curve datasets obtained for two amplification products differing in length by only one nucleotide are highly similar, but after using the wavelet transform, two different signatures will be obtained. Such signatures will then be easier to compare with each other in order to logically conclude that an insertion or deletion was present in one of the amplification products. Finally, the use of the wavelet function results in noise reduction and increased computational efficiency and speed when working with large and similar datasets. Therefore, wavelet-processed data is particularly suitable for classifying samples using composite analysis of multiple multiplex targets within a single experiment, especially when there are large initial datasets obtained that require little data scatter to be extracted.

[0060] Currently existing methods for detecting MSI are characterized by the following disadvantages:

(a) repeat length determination requires additional specialized post-PCR assay equipment and/or the assay usually requires interpretation by a highly skilled person; or (b) in the case of high resolution melt curve analysis using dsDNA intercalating dyes, the disadvantage is very limited multiplexing capability to avoid overlap of melt signals from different amplicons, and furthermore, it does not provide the ability to quantify unstable (mutant) sequences by compared to stable (wild-type) sequences. The present inventors have found that the use of a discrete wavelet transform on melt curve data leads to a reliable and correct interpretation of the results in a fully automated manner, thereby overcoming these shortcomings.

[0061] Thus, in a preferred embodiment, the method of the present invention further comprises the steps of:

(a) applying a wavelet transform to the melt curve data, and

(b) applying the results obtained in (a) in determining the number of nucleotides in any of the homopolymer repeats listed above. In other words, in one embodiment, methods are provided that use a wavelet transform function to analyze nucleic acid melt curve data from a test sample to determine the presence or absence of an insertion/deletion in each of the homopolymer repeats from a selected panel of biomarkers, then this information can be used to determine said test sample as characterized or not characterized by MSI.

[0062] In a preferred embodiment, the melt curve data is the raw melt curve data, i.e., data representing the raw signal parameters obtained in a nucleic acid dissociation or association assay. In other words, such initial parameters are not subjected to mathematical processing by, for example, using the first or second derivative of the analysis of the melting curve, as is often done in the art, but after being obtained using a detector, they are transferred to a computer, where a wavelet function is applied to them. -conversions.

[0063] In the most preferred embodiment, the wavelet transform is a discrete wavelet transform or "DWT". A DWT is any wavelet transform for which wavelets are sampled discretely. As with other wavelet transforms, the key advantage it has over Fourier transforms is time resolution: it captures the frequency and position of the information (position in time). Using the discrete wavelet transform on the original parameters yields a set of transformed output wavelet coefficients on different scales: (a) one is the result of an approximation of the output signal, which is the low-frequency content of the input signal component, and (b) the other is the complex result, which gives the high-frequency components that are elements of the input signal at different levels. These coefficients are hereinafter referred to as discrete wavelet transform coefficients or dwt coefficients. Separating the features into different scales (or frequencies) allows the operator or computer algorithm to choose the most appropriate dwt coefficients for some decision or analysis, a process often referred to as wavelet filtering. This process can be reused by dividing the signal into multiple frequency bands. When used on melt curve data, the highest frequency wavelet coefficients are predominantly noise, with the lowest resolution factors capturing information related to instrument gain or amplification efficiency in a previous amplification reaction. Both have no or low utility for identifying a specific oligonucleotide in a sample subjected to melt curve analysis, but have potential utility given the reliability of such identification. Packages containing all the functions required for data processing and plotting DWT have already been described (Aldrich, 2015) and known to experienced programmers and mathematicians.

[0064] In a preferred embodiment of the method, at the stage of performing a discrete wavelet transform on the melt curve data to obtain dwt coefficients at specific settings, a one-dimensional (1D) wavelet transform will be calculated from the original data or processed data using the mother wavelet from the Daubechies family. The mother wavelet is an unmodified wavelet chosen as the basis for the discrete wavelet transform (Daubechies, 1992). Good results were obtained using the mother wavelet DB8. Additional tests with DB4 and Haar mother wavelets also provided very good performance, the results of which are available upon request. Based on the latter, the authors of the present invention believe that other existing mother wavelets may also be suitable. The mother wavelet can be, and preferably is, successively enlarged, shifted and scaled using the dwt pyramid algorithm to create a set of child wavelets that best represent the analyzed melt curve fluorescence signal; in this case, the set of wavelets and the scale factors obtained from the algorithm are the result of a discrete wavelet transform. In this example, the boundary conditions for DWT are periodic. Input of initial data for transformation can be for all measured data or their subgroup, which covers all significant events of the specified experiment.

[0065] In accordance with the above, in order to obtain dwt coefficients, the methods of the present invention can use a discrete wavelet transform of the original melt curve data or mathematically transformed or processed melt curve data, i.e., only on selected source data.

[0066] In addition, it is not always necessary to use all the dwt coefficients for the final determination of the number of nucleotides. To increase the calculation speed, it is quite sufficient to select only the coefficients dwt. Preferably, the discrete wavelet transform is performed on the original melt curve data. However, it is not necessary to process the raw data in accordance with any mathematical method known in the art to obtain a sample of the raw data. In the latter case, the discrete wavelet transform will be used on the specified source data sample also to obtain the dwt coefficients. Thus, in a particular embodiment, the results obtained in (a) may be the dwt coefficients obtained from the raw melt curve data. In an alternative embodiment, the results obtained in (a) may be dwt coefficients obtained from a sample of raw melt curve data. In yet another specific embodiment, the results obtained in (a) may be a sample of the dwt coefficient obtained from the above alternative embodiments.

[0067] In one particular embodiment, the discrete wavelet transform is a 1D discrete wavelet transform. In an even more specific embodiment, the 1D discrete wavelet transform is a 1D Daubechies wavelet transform.

[0068] To use the discrete wavelet transform, the mother wavelet must be selected. In a further preferred embodiment, a discrete Daubechies wavelet transform is used that uses a Daubechies family of mother wavelets, most preferably a DB8 mother wavelet or a DB4 or Haar mother wavelet.

[0069] In principle, in an alternative possible embodiment, the method of the present invention may use any wavelet transform function suitable to generate meaningful coefficients that capture information allowing differences to be determined at the single nucleotide level. Examples may include the Haar wavelet (which can also be considered part of the Daubechies family), the least asymmetric, the Coiflet wavelet, or the best localized. In alternative embodiments, alternative algorithms may be used to calculate dwt, including a lifting algorithm or a dual decomposition using a complex wavelet transform. Other forms of discrete wavelet transform include undecimated wavelet transform or non-decimated wavelet transform where downsampling is eliminated, or Newland transform where an orthonormal wavelet basis is formed from appropriately designed "top of the hat" filters in the frequency range. Possibly other examples exist and will be readily applicable to the methods disclosed herein by the person skilled in the art.

[0070] One of the main advantages of the methods of the present invention is their direct automation and adaptation, in particular, to known standard systems for qPCR. Therefore, in a specific embodiment, a method is provided wherein the determination of the number of nucleotides in the above homopolymer repeats is carried out in an automated manner, for example, using software. This can be carried out in an automated system, for example, equipped with suitable hardware and software, which can read the signals obtained using the methods of the present invention, analyze them and provide a conclusion based on the presence or absence of insertions / deletions in a selected marker from a specified sample. . A particularly suitable system for such automation is the Biocartis Idylla™ platform, which, in addition to performing PCR and providing interpretation of its results, also fully automates the entire workflow of sample processing and nucleic acid extraction. Therefore, in an exemplary embodiment, the present invention provides a fully automated, from sample to result, method for analyzing MSI loci.

[0071] In another promising embodiment, the present invention performs a method, where the determination of the number of nucleotides in any of the above homopolymer repeats is also additionally carried out in a control biological sample. This control or reference sample can be, for example, an MSI-H tumor-derived material with confirmed insertion/deletion in any of the above selected homopolymer repeats, or a synthetic or isolated nucleic acid construct, such as a plasmid. A particularly preferred reference sample may be, for example, one of the Acrometrix standards, which contains a mixture of both synthetic and genomic DNA. The technology uses a thoroughly characterized and sequenced GM2438 cell line as a genomic DNA background, into which sequenced synthetic targets are introduced. In the Acrometrix approach, such targets are linear synthetic DNA molecules containing a sequence that mimics the change associated, for example, with a selected biomarker, which in the context of the present invention can be a sequence of any of the insertion/deletion-containing homopolymer repeats described above, preferably for purposes PCR along with their flanking sequences. The targets further comprise a "tail" sequence linked to the mimic change sequence described above, which further serves to identify and quantify the targets. The resulting sequence is considered to be a hybrid sequence containing a sequence mimicking the change and a tail sequence. For example, a tail may mimic a known change in a gene such as a SNP for which assays are available for detection, and therefore may provide additional means to indirectly absolute quantify the sequence that mimics the change, such as in this case an insertion/deletion in a selected marker or markers. Such a standard, for example, may be applicable for verification and validation purposes, for example, it may be provided in the case of additional research by NGS, in particular because existing NGS-based approaches are still prone to loss of information about inserts. /deletions in sequences of homopolymer repeats.

[0072] Alternatively, in a preferred embodiment of the present invention, the control biological sample contains material derived from the cell line HTC116 cl. GeneCorner in Belgium under accession number LMBP 12278CB. The cell line contains one homonucleotide deletion in each of the above homopolymer repeats. This means that the genome of the cell line contains the following mutant (i.e. MSI variant) homopolymer repeats:

10 adenines located in the human DIDO1 gene and starting at position chr20:62905340;

10 adenines located in the human MRE11 gene and starting at position chr11:94479765;

9 adenines located in the human SULF2 gene and starting at position chr20:47657577;

7 adenines located in the human ACVR2A gene and starting at position chr2:147926117;

9 adenines located in the human BTBD7 gene and starting at position chr14:93241685;

8 thymines located in the human SEC31A gene and starting at position chr4:82864412; And

9 adenines located in the human RYR3 gene and starting at position chr15:33865341.

In addition, the cell line also features the insertion/deletion of several other MSI-associated repeats, such as BAT25 and BAT26 from the Bethesda panel, which can be used in comparative studies.

[0073] In a related aspect of the present invention, a cell or any other material, in particular genetic material, is also provided, which is derived from the cell line HTC116 cl.110268743. Such material can be isolated genomic DNA or cell lysate. Other suitable forms of such material will be apparent to those skilled in the art, depending on the end use of the methods presented herein and kits based on said methods.

[0074] In a further aspect of the present invention, kits are also provided for detecting insertions/deletions in an MSI biomarker panel of the present invention or for carrying out a method in accordance with the present invention. In a particular embodiment, the present invention provides a kit for the analysis of MSI loci in a biological sample, which kit contains means for detecting nucleic acid regions containing the homopolymer repeats described above, presented in the panel of biomarkers of the present invention. Preferably, said agents are sequence specific, i.e., designed to specifically recognize in sequence said homopolymer repeats with their flanking portions of selected length. In a preferred embodiment, the sequence-specific agents provide a primer, or a pair of primers, or a probe capable of hybridizing to a region containing a homopolymeric repeat. For example, such agents may preferably provide a primer that hybridizes upstream or downstream of the repeat and is designed to produce, in an amplification reaction, an amplification product containing at least one of said homopolymer repeats or mutant variants thereof, e.g. or more compared to the wild-type homopolymer repeat variant. In another example, the means may provide a probe capable of hybridizing to any of the indicated sequences of homopolymer repeats (or insertion/deletion mutants thereof) and to at least one immediately flanking region (i.e., above or below, but preferably both variant) of the specified repetition sequence. In a specific embodiment, the means provide at least one primer or a pair of primers selected from SEQ ID NO: 1-14. In an alternative specific embodiment, the means provide at least one molecular beacon probe selected from SEQ ID NOs: 15-21. In an exemplary embodiment, the means comprise at least one primer or primer pair selected from SEQ ID NOs: 1-14 and at least one molecular beacon probe selected from SEQ ID NOs: 15-21. The means may additionally provide, for example, corrective polymerase, suitable buffer systems, dNTPs, selected dyes, optionally compatible quenchers, etc. from cell line HTC116 cl.110268743

[0075] In a preferred embodiment, a kit further comprising a cartridge is provided. Optionally, the kit may be in the form of a cartridge. Thus, advantageously, the present invention provides a kit wherein said means for detecting nucleic acid regions comprising the panel of homopolymer repeat biomarkers described above are presented in a cartridge capable of interacting with an automated system. As described above, a suitable example of a cartridge and an automated system capable of interacting with it is the Biocartis Idylla™ platform. Additional details regarding this and similarly applicable systems in the present invention can be found in WO2007004103, EP1896180, EP1904234 and EP2419705. From the documents cited herein, it can be understood that the preferred cartridges contain not only the means for performing PCR, but can also be configured to directly receive a nucleic acid source or sample, perform isolation or extraction of nucleic acids from said nucleic acid source, and provide (for example, by pumping) the thus extracted nucleic acid for subsequent analysis based on PCR.

[0076] In a preferred embodiment, tools such as primers, probes, and/or other reagents, including corrective polymerase, can be provided in said cartridge in a coated format that promotes extended shelf life.

[0077] In a further related aspect of the present invention, automated systems are also provided for detecting insertions/deletions in an MSI biomarker panel in accordance with the methods of the present invention and/or for performing analysis with kits in accordance with the present invention.

[0078] In an exemplary embodiment, such an automated system may comprise a control panel and instrument compatible with the refillable cartridges of the present invention. The device contains control modules for analysis. The control panel is a computer to control and monitor the operation of the instrument and the status of the cartridge during the analysis. Preferably, the assay will be carried out entirely within the cartridge and may include, for example, real-time PCR. After introducing a sample into such a cartridge of the present invention, which is pre-filled with the reagents described above, the cartridge is inserted into the instrument and the instrument controls the analysis that is automatically carried out in the cartridge. After the analysis, the control desk software processes the results and generates a report available to the end user of the automated system.

[0079] The automated system may be an open or closed type automated system. After the sample has been deposited or placed in the cartridge, the cartridge is inserted into the system, which is then closed and left closed during operation of the system. In a closed system, all necessary reagents are built in, so the closed configuration provides the advantage of carrying out detection without contamination. Alternatively, an open accessible cartridge may be used in an automated system. Required reagents are added to the open cartridge as needed, after which the sample can be placed in the open cartridge and the cartridge can be entered into the assay in a closed automated system.

[0080] Preferably, cartridge based systems are used, comprising one or more reaction chambers and one or more fluid chambers. Some fluid chambers may contain fluid that is used to prepare the sample lysate. Other chambers may contain liquids such as reaction buffers, washes, and amplification solutions. Reaction chambers are used for various detection steps such as washing, lysis and amplification.

[0081] In a particularly desirable embodiment, in accordance with the above embodiments, in order to simplify and facilitate the interpretation of the results of the method in accordance with the present invention, the analysis of the melting curve is also carried out in an automated manner by a computerized method.

[0082] Finally, it is also an object of the present invention to provide the use of biomarker panels, methods, kits including cartridges, and automated systems in accordance with the present invention for the analysis of MSI loci in a tumor sample or biological sample that is suspected to contain tumor material. .

[0083] In a preferred embodiment, the tumor is colorectal cancer (CRC). In an alternative embodiment, the tumor is ovarian cancer or endometrial cancer. In yet another embodiment, the tumor is gastric cancer.

[0084] In an exemplary embodiment, the present invention also provides the use of panels of biomarkers, methods, kits including cartridges, and automated systems in accordance with the present invention to analyze MSI loci in a tumor sample and to predict the response of the subject to immunotherapy from which the sample was obtained. tumors, based on the analysis. The latter application can be envisaged in view of recent reports from the literature, in particular, Turajlic et al., 2017, Lancet Oncology, where it was shown that increased accumulation of insertions / deletions in the genome correlates with the formation of new open reading frames encoding a large number of neoantigenic sequences. Along with this, the present inventors further demonstrate that the detection of at least 2 or 3 insertions/deletions in the panel of biomarkers of the present invention correlates significantly with the total number of insertions/deletions and neoantigens when assessing each sample. The data of the present inventors further demonstrate that a different immunogenic tumor phenotype can be predicted using the methods and/or kits of the present invention. The latter is promising for the following reasons. Immune checkpoint blocking has been previously approved for the treatment of unresectable or metastatic tumors with high microsatellite instability (MSI-H) regardless of their site or histological characteristics. The observed response rate was ~40%. There is currently no FDA-approved test to detect MSI status. A tumor with MSI-H is characterized by histopathological characteristics such as high lymphocyte infiltration and high tumor mutation load. In particular, such tumors are characterized by a high number of insertion/deletion mutations, which are known to be highly immunogenic leading to an excess of neoantigens. It follows from the results of our study that MSI-H tumors having a high insertion/deletion rate are likely to be highly responsive to immunotherapy with antibodies targeting immune response checkpoint molecules, such as PD-1, PD-L1, or PD. -L2. Therefore, in another possible embodiment, a method for analyzing MSI loci according to the present invention is provided, which includes the step of using the obtained information on the number of homopolymer repeats to make a decision on the administration of immunotherapy in the subject from which the biological sample is obtained. In possible embodiments, the method may include the step of using the obtained information about the number of homopolymer repeats to establish the mutation load of the tumor or the insertion/deletion load of the tumor. In preferred embodiments, the established tumor mutation load or insertion/deletion tumor load is presented as an estimate of the total number of mutations or is presented as a score. In a specific embodiment, the methods of the present invention may include the step of using the obtained information about the number of homopolymer repeats, or about the mutation load of the tumor, or about the load of the tumor with insertions/deletions, or about the estimation of the total number of mutations, or about the scoring to decide on the administration of immunotherapy. in the subject from which the biological sample was obtained. As explained above, in preferred embodiments of such methods, immunotherapy involves treatment with an antibody targeting a checkpoint factor of the immune response, most preferably said antibody being an antibody specific for any of the following targets: PD-1, PD- L1 or PD-L2. In a further aspect, the present inventors' data also indicate that tumors rich in neoantigens will also be susceptible to specific targeting approaches to neoantigens generated by chimeric antigen T cells or therapeutic vaccine therapy. Thus, possible embodiments of the methods of the present invention in which said methods are implemented can also be presented. In addition, these and other uses of the present invention in the diagnosis, prognosis, and clinical follow-up of subjects will be readily available to those skilled in the art.

Examples

1. Detection of microsatellite instability (MSI) in cancer samples using a new set of highly sensitive markers

[0085] Obtaining a minimum set of 4 tokens from any given set of tokens is not straightforward. For example, described by Zhao et al, 2014, an eLife analysis with Sequenom of 18 samples with MSI-H using a panel of 59 markers showed that the marker was determined to be mutated in 44.26% of the samples on average. Although this large panel of markers is highly effective in detecting MSI status, randomly derived sets of 4 selected markers show a significantly lower theoretical performance compared to the core set proposed in this document containing ACRV2A, DIDO1, MRE11, SULF2. In addition, these randomly selected panels have a number of disadvantages in that they may contain markers showing ethnically dependent differences in the homopolymer region, such as those observed with the TMEM65 marker for Caribbean subpopulations. These differences make it extremely difficult to design a reliable and efficient panel with a low number of markers, since they can reduce the accuracy of interpreting changes made by MSI. The latter becomes especially important when a small number of different markers and/or in the absence of appropriate controls, which is usually observed in the case of, for example, the classic MSI Bethesda biomarker set, which has a wide range of individual variability and multiple variant alleles, especially in African populations (Buhard et al ., 2006).

MSI profiling in CRC, gastric and endometrial cancer

[0086] The status profile was determined by 7 microsatellite markers (BTBD7, RYR3, SEC31A, ACVR2A, DIDO1, MRE11 and SULF2) in 128 MSI-H colorectal cancer samples. Several clinical sites and different ethnic groups were included to assess the reliability of the choice of markers. In addition, the status of 7 markers was checked in 15 MSI-H gastric cancer samples and 19 MSI-H endometrial cancer samples. Repeat length was determined from FFPE DNA by PCR followed by characterization of the amplification product by molecular beacons.

Materials and methods

[0087] Samples. A total of 128 FFPE human CRC samples with MSI-H were obtained from various sources including the University of Cambridge, the Portuguese Cancer Institute in Porto, Cureline, Boca Biolistics, Trans-Hit, Geneticist Inc, Righshospitalet, Origene and Asterand. 15 MSI-H human stomach samples were obtained from Cureline and Trans-Hit and 19 MSI-H human endometrial samples were obtained from IDIBELL.

[0088] Sample processing. Each FFPE sample with MSI-H was placed in an ink cartridge developed by Biocartis Idylla™. The cartridges were capped and loaded into the Idylla™ platform for automated PCR-based genetic analyzes, after which fully automated sample preparation began. Briefly, DNA was extracted from FFPE samples according to the FFPE Biocartis liquefaction protocol and then pumped into cartridge PCR wells according to the standard protocol for Idylla™.

[0089] PCR. The PCR cartridge compartments were loaded to contain the following PCR mixtures per primer pair or primer pair duplex as follows:

The primer pair sequences and probes for each marker are shown below:

Conditions for PCR are presented below:

[0090] Amplicon melting. The PCR products were denatured in cartridges for 2 minutes at 92°. Melting curve data were then obtained from fluorescence intensity by heating the mixture from 40 C to 76.6 C in 0.3 C increments (12 sec per cycle), with fluorescence signals monitored after each 0.3 C increase.

[0091] Post-processing. In the first step of data analysis, the initial fluorescence measurements for the melt curve were downloaded from the Idylla™ instrument. In the next step, only the first 64 cycles were saved from the vector of measured values. This subgroup is referred to as the "region of interest" or ROI because the most important signal changes are observed within this window. In later cycles, the melting of "lighthouses" is mainly observed. The next step in the post-processing algorithm is to apply the discrete wavelet transform (DWT) to the measurement vector (ROI). Wavelets are particularly well suited to the analysis of melt curves because they are a low frequency phenomenon that occurs in a particular temperature zone. Wavelets are capable of simultaneously performing time and frequency analysis. This means that they can interpret both what happens in terms of low frequency changes and when it happens. Thus, wavelets briefly generalize the way to analyze the melting curve. In this particular case, the DB8 wavelet is used and the coefficients of the third level are stored. After this transformation, both the scale and the wavelet coefficients are preserved, resulting in two sets of 8 coefficients. One set of 16 wavelet coefficients is calculated for each marker presented in this analysis. This set of wavelet coefficients per marker is called the post-processing results for each marker.

[0092] A decision tree. The second step in analyzing melt curve data is called a decision tree. At this stage, the pattern recognition algorithm is used to classify valid samples based on the results of post-processing. To do this, the classification algorithm, which is a neural network, is used in relation to the results of post-processing of each marker. This network was trained using labeled data for which the introduced genotype is known. In the case of reference data, this labeling is based on the introduced genotype that has been presented. In the case of clinical data, this labeling is obtained by visual scoring of the melting profiles by experts on the melting curve. By iteratively optimizing the weights within the neural network, the algorithm can learn to recognize differences between the wild-type (WT) curve and the mutant-type curve. The algorithm provides a probability score as an output for each marker gene, which reflects the validity of the decision (1 for mutant type and 0 for WT). A sample is scored as MSI-H if at least two markers have a probability score greater than 0.5.

results

1. Determination of the MSI profile at CRC

[0093] First analysis. A core set of four markers including ACVR2A, DIDO1, MRE11 and SULF2 were evaluated for their ability to detect MSI-H positive samples in a pool of 128 MSI-H samples. A sample was scored positive when the post-processed melt curve data decision tree yielded at least two markers identified as having an insertion/deletion. Using this basic set of four markers, 96% of samples can be identified as MSI-H. Since the minimum acceptable potency was set to account for at least 95% of the samples, the sampling above was taken as the core set of MSI markers.

[0094] To provide further evaluation of the efficacy of these markers, all possible permutations of 3 markers from the main panel of 4 were subjected to the same efficacy analysis. The results indicate that performance degrades for every possible subsample, ranging from 83% to 93%. In order to make the analysis more reliable among different types of cancer, a scheme with at least four markers is preferred.

[0095] Second analysis. By adding an additional marker (BTBD7) to the main set of four markers, one more sample can be scored as MSI-H, resulting in 97% of correctly scored samples, thus making the panel more efficient in determining MSI status.

[0096] Third analysis. By adding an additional marker (SEC31A) to the set of five markers, all samples in the limited set of samples tested can be evaluated as MSI-H, providing even greater efficiency.

[0097] Fourth analysis. By adding an additional marker (RYR3) to the set of six markers, as expected, all samples were also scored as MSI-H. Although it is not immediately apparent from the data presented, theoretically the addition of a 7th marker still seems to increase the efficiency of the analysis in the case of analyzing large sets of samples. In theory, given the observed mutation rates of these markers in MSI-H samples, for 7 markers the false negative rate is predicted to be no greater than ~1/1900, which for larger sample sets may become significant.

[0098] The results of the CRC sample analysis are shown in Figure 1.

2. MSI profiling in gastric and endometrial cancer

[0099] First analysis. A core set of the four most effective markers for CRC (ACVR2A, DIDO1, MRE11 and SULF2) was then also evaluated in a pool of 34 cancer samples, specifically 15 gastric cancer samples and 19 endometrial cancer samples (EN).

The results indicate that the homopolymer repeat in ACVR2A is a much more effective marker for CRC than for other types of cancer. However, despite the very small sample pool, the results for the core set in gastric cancer and EN cancer are very close to the acceptable threshold of 95%, which is a good indication that in the case of a larger sample pool, the set of 4 core markers represented by herein, can generally be applied to tumor types other than CRC, MMR deficient, or microsatellite unstable tumor types. In order to get a better idea of the effectiveness of the main panel, a larger number should be profiled.

[0100] Second analysis. By adding an additional marker (BTBD7) to the main set of four markers, one more sample can be assessed as MSI-H, which, with such a small set of samples, already brings the efficiency of such a panel of five markers to the most optimal value, which is 97% of correctly evaluated samples.

[0101] Third analysis. By adding an additional marker (SEC31A) to the set of five markers, all samples can be evaluated as MSI-H.

1. Automated 7 marker MSI profiling with the Idylla™ MSI test

[0102] Background: detection of microsatellite instability (MSI) was recommended for all patients with colorectal cancer (CRC). Currently, the clinical gold standard is immunohistochemical staining of proteins involved in mismatch repair and/or PCR analysis of frequently mutating short tandem repeats in DNA. The Idylla™ MSI assay, designed using a new set of short homopolymers selected from full exome sequence data via a no-bias method (Zhao et al. 2014; eLife), is capable of faster detection with higher specificity and selectivity than existing ways.

[0103] Methods: Prototype cartridges for the Idylla™ MSI test were developed to final design. The repeat length of the new set of 7 biomarkers was determined on 348 formalin-fixed and paraffin-embedded (FFPE) CRC samples, using such advanced tests that allow for a fully automated workflow, including sample acquisition, DNA amplification, followed by melting curve analysis and automated data interpretation. Several clinical sites and different ethnic groups of patient samples were included to assess the reliability of the choice of markers. All samples were further screened with the MSI Reference Detection Method (MSI Promega Assay System).

[0104] Results: one hundred and twenty-seven (36.5%) and 116 (33.3%) samples were classified as high MSI (MSI-H), and 209 (60.1%) and 220 (57.3%) samples were classified as microsatellite stable (MSS) by Idylla™ and Promega, respectively, while 12 samples (3.4%) could not be classified by any method. The match analysis revealed an overall match of 96.1% (93.4% - 97.7%, 95% CI). 14 cases were classified as MSI-H by Idylla™ but with MSS (11) or invalid (3) by Promega; while the median rate of positive markers based on Idylla™ was 3/7.

[0105] Conclusions: New MSI biomarkers were validated in this study for their ability to discriminate between MSI-H and MSS status in a large and diverse set of CRC samples. Also demonstrated the possibility of fully automated analysis for testing MSI. Idylla™'s mature MSI test is compatible with the fully integrated Idylla™ platform, providing accurate and reliable results within 150 minutes using only a single FFPE tumor slice (no reference sample required).

General conclusions

[0106] Presented herein, a panel of only four major markers, including homopolymer repeats in the ACVR2A, DIDO1, MRE11 and SULF2 genes, demonstrates adequate performance in the analysis of CRC samples. It has also been shown to be highly effective with gastric and endometrial cancer samples, despite the fact that the present inventors were able to access and profil only a small number of these samples. The profiling of more non-CRC MSI-H samples strongly supports the applicability of a minimum core panel of two markers to a wider range of cancers. It is now apparent that the homopolymer in the ACVR2A gene is a particularly efficient and quite specific MSI marker for CRC. Therefore, for other types of cancer, other minimum core panels may be proposed and tested as an alternative embodiment of the present invention. From the preliminary data presented in this document, it appears that the following three panels can be proposed - out of 4 main markers: (1) DIDO1, SULF2, BTBD7 and SEC31A; (2) DIDO1, SULF2, BTBD7 and ACVR2A; and (3) DIDO1, SULF2, SEC31A and RYR3. Regardless of the types of MMR-deficient specimens, a panel of 5 major markers containing ACVR2A, DIDO1, MRE11, SULF2 and BTBD7 has been shown to be generally suitable for diagnosis in case of specimens of different origins and therefore constitutes a particularly attractive option. implementation of the present invention.

2. A novel set of 7 insertion/deletion homopolymers to detect MSI associated with high tumor mutation load and total insertion/deletion load in endometrial and colorectal cancer

[0107] BACKGROUND: Blocking of immune response checkpoints has been previously approved for the treatment of unresectable or metastatic tumors with high microsatellite instability (MSI-H) regardless of their site of localization or histological characteristics. The observed response rate was ~40%. There is currently no FDA-approved test to detect MSI status. A tumor with MSI-H is characterized by histopathological characteristics such as high lymphocyte infiltration and high tumor mutation load. In particular, such tumors are characterized by a high number of insertion/deletion mutations, which are known to cause a frameshift compared to single nucleotide variants and, as a result, lead to an excess of neoantigens, which are highly immunogenic. Therefore, a high insertion/deletion rate in MSI-H tumors may be a predictor of response to anti-PD1 antibody therapy.

[0108] Methods. The present inventors selected tumors with MSI and MSS for which whole exome sequencing data were available from a previous report by the present inventors (Zhao et al., eLife 2014). They include 11 endometrial cancer samples with MSI, 22 colorectal cancer samples with MSI, and 89 samples with MSS. The present inventors then determined the stratified mutation load by substitutions and insertions/deletions from the whole exome sequencing data. The seven markers described herein were amplified and amplicon sequencing of paired end tags was performed using an Illumina HiSeq 4000. Amplicons were sequenced at a minimum coverage of 5000x and an average coverage of 87000x. Samples with MSS were used to calculate the average percentage of reads with deletions. The marker was considered positive if the percentage of mutant reads was greater than 6 SD (corresponding to a P-value of <1.0e ^-5 ). A number of markers gave high rates of background mutations due to polymerase slippage in the homopolymeric region. These figures ranged from 6.6% (for ACVR2A) to 36.0% (for BTBD7).

[0109] Results. Nineteen tumors with MSI-H were positive for insertion/deletion in at least 2 of the 6 markers initially screened due to technical difficulty (shown in Fig. 5A) and then completely in 7 (shown in Fig. 5B) markers, while tumors with MSS were not positive for any of them. Additionally, the authors of the present invention determined the correlation between the number of positive insertions/deletions in all available tumors with MSI-H (n=19+14) with mutation load. This revealed a positive correlation for both non-synonymous mutation load and insertion/deletion mutation load (values for all 7 insertions/deletions are correlated: r=0.68, p<6.5e ^-05 , and r=0.75, p <2e ^-16 respectively). With regard to additional insertion/deletion markers that were positive, the present inventors found an increase in insertion/deletion mutation rate of 119 insertions/deletions starting from a median of ~250 insertions/deletions per 3 positive markers. The results are shown in the attached figures 3-6.

[0110] Conclusion. A sample of 7 inserts/deletions reliably detects MSI-H in endometrial and colorectal cancers, while the number of positive inserts/deletions serves as an indicator of tumor mutation load as well as total tumor load of inserts/deletions, and thus can be used as a tumor loading test with neoantigens, which is a predictor of the response of MSI-H tumors to anti-PD-1 antibody therapy. These 7 markers will be available as a fully automated Idylla™ MSI test to detect MSI status and can be used as a companion diagnostic to predict the outcome of tumor immunotherapy with MSI-H.

3. Overview of CRC Tumor Staging Associated with Pass, Fail, Mismatch, and Mismatch Results in Idylla™ MSI Test and IHC Analysis

[0111] Materials. The study was carried out with 330 remaining FFPE samples obtained as a result of routine diagnostics in two university clinics: Aarhus University Hospital (Clinical Base 1) and Antwerp University Hospital (Clinical Base 2). Samples were obtained from patients with CRC and were representative of all stages of CRC, including stage I. IHC data for MSI were provided by both study centers and were based on the results of IHC analysis of retrospective FFPE sections (retrospective histopathological data) according to the clinical standard. practices (SoC). Both sites tested for MSI using the Idylla™ MSI test, which includes the 7 markers described in this document. The tests were performed at the location of both clinical sites on sets of 150 and 180 samples, respectively. For informational purposes, the correspondence between the Idylla™ MSI test data and retrospective MSI immunohistochemical (IHC) data was determined. Of the 330 samples, staging information was not available for 16 samples (see also the table in Figure 7) and was based on the data available in the histopathological analysis report. In a number of cases, Tumor, Nodules, and Metastases (TNM) staging results (according to the ^7th edition of the American Joint Committee on Cancer) were derived from the T and N parameters only due to source limitations in the histopathological examination report. In this study population, 6.7% (N=22), 19.4% (N=64), 43.3% (N=143) and 25.8% (N=85) had stage I, stage II, stage III and stage IV, respectively, as shown in the first column in figure 7.

[0112] Methods. The Idylla™ MSI test was performed on FFPE samples in an automated manner using the Idylla™ cartridge and platform system developed by Biocartis. The FFPE samples were placed in separate cartridges containing the reagents described above, after which the cartridges were processed and analyzed using an automated platform in accordance with the protocols described above. The results from the Idylla™ MSI test were then combined with the MSI status of the FFPE samples, which were evaluated by IHC. The invalid result for the two FFPE samples was confirmed by cross-testing with the MSI Analysis System v 1.2 analysis system based on the Bethesda Promega panel, according to the manufacturer's approved protocol.

[0113] Results. A comparison of Idylla™ MSI test data and MSI retrospective immunohistochemistry (IHC) data is provided for informational purposes only and is shown in Figure 7. These results indicate that only two of a total of 330 samples were scored as invalid in the Idylla™ MSI test. , and that the test is reliable because there were no errors in all 330 tests performed. The invalidity of the test result for two samples was probably due to their low quality, which was confirmed by Promega MSI Analysis System v 1.2, which also failed to analyze these samples (data not shown). These results generally show good agreement between the results of the Idylla™ MSI test and the results of the IHC assay. Importantly, along with the IHC results, the Idylla™ MSI test also correctly identified the MSI-H phenotype in two stage I CRC samples. in the MMR pathway at the protein level, but the signature of microsatellite instability at the DNA level can also be detected.

[0114] Output. The results confirmed the robustness of the MSI assay methods of the present invention and provided the first, to the present inventors' knowledge, clinical evidence that the MSI molecular signature test can correctly detect MSI-H status in stage I CRC. This also indicates that the test will most likely be able to correctly identify MSI-H status also in other types of stage I cancer.

Definitions

[0115] As used herein, the term "biological sample" or simply "sample" is intended to include a range of biological sources that contain nucleic acid and/or cellular material, regardless of whether it was directly obtained from the body (i.e., fresh tissue sample) or preserved by any method known in the art (eg frozen sample or FFPE sample). Examples of biological specimens include cell cultures such as mammalian and eukaryotic cells, biological fluids, biological fluid pellets, lavage specimens, fine needle aspiration biopsy specimens, biopsy specimens, tissue specimens, cancer cells, other cell types obtained from a patient , tissue culture cells or in vitro grown cells from an individual being tested for and/or being treated for a disease or infection, or forensic samples. Non-limiting examples of body fluid samples include whole blood, bone marrow, cerebrospinal fluid (CSF), peritoneal fluid, pleural fluid, lymphatic fluid, serum, plasma, urine, chyle, stool, ejaculate, sputum, nipple aspirate, saliva, samples swabs, liquid samples obtained by flushing or rinsing, and/or samples obtained with a brush.

[0116] As used herein, the term "nucleic acid" and its equivalent "polynucleotide" means a polymer of ribonucleotides or deoxyribonucleotides linked together by phosphodiester bonds between nucleotide monomers. (Deoxy)nucleotides are phosphorylated forms of (deoxy)nucleosides which most commonly include adenosine, guanosine, cytidine, thymidine, or uridine. Such nucleosides are composed of a pentose sugar, which is either ribose or deoxyribose, and a nitrogenous base ("nucleic base" or simply "base"), which is either adenine, guanine (which are purines), cytosine, thymine, or uracil (which are to the pyrimidines). The sequence in which such bases (or their nucleosides, or the latter's nucleotides) are arranged in a nucleic acid strand is referred to as the "nucleic acid sequence", and they are traditionally given in the direction from the so-called 5' end to the 3' end, referring to the chemical orientation of the nucleic acid strand. "5'" originates from the 5'-carbon of the first (deoxy)ribose ring, from which the reading of the nucleic acid sequence begins, and "3'" originates from the 3'-carbon of the last (deoxy)ribose ring, from which the reading of the nucleic acid sequence acid ends. Nucleic acid sequences may, for example, be ATATGCC, which should be interpreted herein as a 5'-ATATGCC-3' nucleic acid sequence. By the same rule, the last sequence will be complementary to the sequence 5'-GGCATAT-3' or simply GGCATAT. The nucleic acid sequence may be a homopolymer repeat sequence, ie, a sequence derived from a certain number of consecutive nucleotides that contain the same nitrogenous base, also referred to herein as a "homonucleotide". For example, the term "homopolymer repeat containing 8 consecutive adenines" should be interpreted as referring to at least a portion of a nucleic acid, said portion consisting of a chain containing 8 consecutive nucleotides, where each of said nucleotides contains adenine as the nitrogenous base. Such a sequence will be designated as 5'-AAAAAAAA-3' (or simply AAAAAAAA), while its complementary sequence will be designated as 5'-TTTTTTTT-3' (or TTTTTTTT). The terms "mutant form of a homopolymer repeat" or "mutant forms thereof" are to be construed herein as referring to MSI variants of said homopolymer repeat that involve the insertion or deletion (i.e., "insert/deletion") of at least one homonucleotide. For example, a mutant form of a homopolymer repeat containing 8 consecutive adenines would be a homopolymer repeat containing 7 consecutive adenines or a homopolymer repeat containing 9 consecutive adenines. Nucleic acids include, without limitation, DNA and RNA, including, for example, genomic DNA, mitochondrial or mtDNA, cDNA, mRNA, rRNA, tRNA, heterogeneous nuclear RNA, microRNA, long non-coding RNA, miRNA, and various modified variants thereof. Nucleic acids can generally be obtained from natural sources, such as biological samples obtained from different types of organisms. On the other hand, nucleic acids can also be synthesized, produced by recombination, or by any of the known man-made methods (eg, PCR).

[0117] The term "quantitative PCR" or simply "qPCR" as used herein defines a polymerase chain reaction (PCR) based laboratory technique that is used to amplify and simultaneously detect or quantify a target DNA molecule. Unlike standard PCR, where the reaction product is detected at its completion, i.e. after the end of thermal cycling, the key characteristic of qPCR is that the DNA product is detected during thermal cycling as the reaction progresses "in real time"; therefore, the alternative name for qPCR is "real-time PCR". There are currently many different types of qPCR. For example, if starting from a reverse transcription (RT) step, then qPCR can be used to quantify the number of messenger RNAs, in which case it is called reverse transcription qPCR or RT-qPCR. As used herein, the terms "quantitative PCR" or simply "qPCR" will be used in preference to the terms "real-time PCR" or "RT-PCR" to avoid confusion with "reverse transcription PCR", which is also often abbreviated as RT-PCR. Most qPCR assays use one of the two most common real-time amplification product detection techniques: (a) intercalation of non-specific fluorescent dyes from any double-stranded DNA, or (b) use of sequence-specific DNA probes consisting of oligonucleotides that are fluorescently labeled. reporter, which provides the possibility of detection only after hybridization of the probe with its complementary target sequence. Fluorescent signals generated during thermal cycling are detected with an appropriate optical detection system and monitored from the moment they pass the background threshold until the reaction reaches a plateau. The copy number of target sequences can be estimated using either relative or absolute quantification strategies, usually by analyzing the shape of the resulting amplification curve (standard curve strategy) or by determining when the signal exceeds some threshold value (often called the Ct value, but sometimes also the Cp value). or the value of Cq). In relative quantitation, levels of target nucleic acid assessed in a particular sample using Ct or standard curve analysis are expressed relative to values obtained for the same target in another reference sample, such as an untreated control sample. Conversely, in absolute quantification, the qPCR signal is compared to the original number of copies using a standard curve, or it can also be calculated according to the more modern digital PCR technique. At present, the first strategy is still more common and is based on estimating the amount of target DNA by comparing the obtained values with a pre-built standard curve. These and other qPCR quantification strategies are well known in the art and their characteristic calculation may vary to a greater or lesser extent depending on the particular qPCR application and system.

[0118] As used herein, the term "quantitative PCR tools" should be understood as the minimum required set of reagents and elements for qPCR. Typically, they include any reagents that allow real-time PCR detectable thermal cycling of a nucleic acid template derived from a source of nucleic acid. Depending on the type of qPCR, such reagents include, but are not limited to, PCR polymerase, at least one primer set, a detectable dye or probe, dNTP, PCR buffer, etc. In addition, "quantitative PCR tools" are usually will also include any standard minimum assembly of parts known in the art, which typically includes, without limitation, the following: (1) a suitable compartment (hereinafter referred to as "qPCR thermal cycling compartment") where real-time detectable thermal cycling occurs . Such compartments may, for example, be formed by a chamber suitable for nucleic acid amplification, i.e. made of an appropriate material and allowing sufficient regulation of the internal temperature, and also containing at least one partition, allowing real-time detection of signals generated by during such amplification, for example, a translucent septum. In addition, (2) means for changing the temperature in a given chamber or other compartment are widely known from various existing thermal cycling plants. Then (3) means for detecting the signals generated during qPCR thermal cycling, such as an optical detector connected to a computer, etc. In short, such a minimum assembly will usually include any system or systems known in the art, capable of initiating and maintaining a thermal cycling reaction in the qPCR thermal cycling compartment, adjusting and regulating the temperature to ensure stable thermal cycling conditions therein, etc. In addition, it will also provide for any appropriate device or devices for detection, means for data processing ( for example, a computer, alternatively connected to a database) and output systems that allow real-time reading and monitoring of thermal cycling during a qPCR reaction (using a computer screen displaying the progress of the reaction in an appropriate graphical user interface). In addition, it will also contain any software packages suitable for operating the apparatus and/or displaying the results obtained, and which, if necessary, assist in their interpretation.

[0119] As used herein, the term "cartridge" should be understood as a closed assembly of chambers and / or channels, which is formed as a single object that can be carried or moved as such, attached to the inside or outside of a larger device, suitable to receive or connect to such a cartridge. Some parts contained in the cartridge may be firmly connected, while others may be flexibly connected and move relative to other components of the cartridge. Similarly, the term "inkjet cartridge" as used herein should be understood to mean a cartridge that includes at least one chamber or one channel suitable for processing, preparing, discharging, or analyzing a fluid, preferably a liquid. An example of such a cartridge is presented in WO2007004103. Preferably, the inkjet cartridge may be a microjet cartridge. In the context of inkjet cartridges, the terms "above" and "below" may be defined as referring to the direction in which fluids flow in such a cartridge. Namely, the section of the jet path in the cartridge, from which the fluid flows into the second section in the same cartridge, should be interpreted as established above in relation to the latter. Similarly, the segment to which the fluid arrives later is located below the segment that was passed by the specified fluid earlier.

[0120] As used herein generally, the terms "fluidic" or sometimes "microfluidic" refer to systems and structures related to the character, control, and manipulation of fluids that are geometrically constrained on a small, typically less than a millimeter, scale of at least one or two dimensions (eg width and height or channel). Such low volume fluids are moved, mixed, separated, or otherwise processed on a micro scale requiring small size and low energy consumption. Microfluidic systems include structures such as micropneumatic systems (pressure sources, fluid pumps, microvalves, etc.) and microfluidic structures for manipulations in micro-, nano-, and picoliter volumes (microfluidic channels, etc.). Exemplary inkjet systems have been described in EP1896180, EP1904234, and EP2419705 and, accordingly, may be used in certain embodiments of the invention presented herein.

[0121] As used herein, the term "DWT" refers to the discrete wavelet transform; the term "coefficient dwt" denotes the coefficient of the discrete wavelet transform. Wavelet transform means a calculation using a program or subroutine using the original data. Thus, the set of coefficients dwt is a set of values transformed using the wavelet transform. The most appropriate dwt coefficients for nucleic acid analysis are those coefficients that capture the significant events of the experiment, for example, in the case of a double-stranded nucleic acid molecule melt experiment, the most appropriate dwt coefficients may be peaks or peak shifts in the original melt curve data.

[0122] As used herein, the terms "melt curve baseline", "melt curve baseline", and "melt curve baseline" are equivalent and are used interchangeably. They denote characteristics obtained from experiments on the dissociation or association of nucleic acids.

--->

SEQUENCE LIST

<110> Biokartis NV

<120> BIOMARKER PANEL AND METHODS FOR DETECTION OF MICROSATELLITE INSTABILITY

FOR DIFFERENT TYPES OF CANCER

<130> BCT-094

<150>EP18168304.6

<151> 2018-04-19

<150>EP18153059.9

<151> 2018-01-23

<160> 21

<170> BiSSAP 1.3.6

<210> 1

<211> 19

<212> DNA

<213> Homo sapiens

<400> 1

tagcgtgtga atcggacat 19

<210> 2

<211> 20

<212> DNA

<213> Homo sapiens

<400> 2

ttgactggggc agatagggga 20

<210> 3

<211> 20

<212> DNA

<213> Homo sapiens

<400> 3

atagttcacc catggaaacc 20

<210> 4

<211> 20

<212> DNA

<213> Homo sapiens

<400> 4

ggaggagaat cttagggaaa 20

<210> 5

<211> 16

<212> DNA

<213> Homo sapiens

<400> 5

actggactcc cgctgg 16

<210> 6

<211> 19

<212> DNA

<213> Homo sapiens

<400> 6

cgctcagcct ccataaatc 19

<210> 7

<211> 25

<212> DNA

<213> Homo sapiens

<400> 7

caacttcatt tcttttcagt acctt 25

<210> 8

<211> 20

<212> DNA

<213> Homo sapiens

<400> 8

ctgtccagat accatttctc 20

<210> 9

<211> 22

<212> DNA

<213> Homo sapiens

<400> 9

agcatccatc tcttgaagac at 22

<210> 10

<211> 23

<212> DNA

<213> Homo sapiens

<400> 10

gcatgtttct gccaataatc tct 23

<210> 11

<211> 17

<212> DNA

<213> Homo sapiens

<400> 11

caacttcagc aggctgt 17

<210> 12

<211> 21

<212> DNA

<213> Homo sapiens

<400> 12

agtctgagaa gcatcaattt t 21

<210> 13

<211> 24

<212> DNA

<213> Homo sapiens

<400> 13

cattttctaa atgcctccct taaa 24

<210> 14

<211> 19

<212> DNA

<213> Homo sapiens

<400> 14

gtccattagg cacaaaaag 19

<210> 15

<211> 34

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic DNA

<400> 15

cgcacgacat ggaaaaaaaa aatccgtgcg taaa 34

<210> 16

<211> 33

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic sequence

<400> 16

cgtcgaacct taaaaaaaaa agttaccgac gaa 33

<210> 17

<211> 36

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic DNA

<400> 17

cgcacgactt attaaaaaaa aatgacagtg cgtaaa 36

<210> 18

<211> 33

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic DNA

<400> 18

cgtcggtacc ttaaaaaaaa acatcacgac gaa 33

<210> 19

<211> 23

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic DNA

<400> 19

gtgcataaaa aaagagcact aaa 23

<210> 20

<211> 33

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic DNA

<400> 20

cgcacttgcc aaaaaaaatt gatggtgcgt aaa 33

<210> 21

<211> 30

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic DNA

<400> 21

cgtcgccctt aaaaaaaaac tgccgacgaa 30

<---

Claims (58)

1. Panel of biomarkers for the analysis of MSI loci in a biological sample of a colorectal tumor, endometrial tumor or stomach, while the panel contains the following sections of homopolymer repeats that are mapped to the reference human genome GRCh38/hg38: a homopolymer repeat containing 11 consecutive adenines located in the human DIDO1 gene and starting at position chr20:62905340; homopolymer repeat containing 11 consecutive adenines, localized in the human MRE11 gene and starting at position chr11:94479765; a homopolymer repeat containing 10 consecutive adenines located in the human SULF2 gene and starting at position chr20:47657577; And homopolymer repeat containing 8 consecutive adenines, localized in the human ACVR2A gene and starting at position chr2:147926117. 2. The panel of claim 1, further comprising any one, two, or all of the following homopolymer repeat regions that are mapped to the GRCh38/hg38 human reference genome: a homopolymer repeat containing 9 consecutive thymines located in the human SEC31A gene and starting at position chr4:82864412; a homopolymer repeat containing 10 consecutive adenines located in the human BTBD7 gene and starting at position chr14:93241685; homopolymer repeat containing 10 consecutive adenines, localized in the human RYR3 gene and starting at position chr15:33865341. 3. A method for analyzing MSI loci in a biological sample of a colorectal tumor, an endometrial tumor or a stomach tumor, comprising the steps: - amplification of nucleic acid regions containing homopolymer repeats that are mapped to the reference human genome GRCh38/hg38: a homopolymer repeat containing 11 consecutive adenines located in the human DIDO1 gene and starting at position chr20:62905340; homopolymer repeat containing 11 consecutive adenines, localized in the human MRE11 gene and starting at position chr11:94479765; a homopolymer repeat containing 10 consecutive adenines located in the human SULF2 gene and starting at position chr20:47657577; And homopolymer repeat containing 8 consecutive adenines, localized in the human ACVR2A gene and starting at position chr2:147926117; And - determining the number of nucleotides in these homopolymer repeats. 4. The method of claim 3, further comprising determining the number of nucleotides in any one, two or all of the following regions of homopolymer repeats that are mapped to GRCh38/hg38: a homopolymer repeat containing 9 consecutive thymines located in the human SEC31A gene and starting at position chr4:82864412; a homopolymer repeat containing 10 consecutive adenines located in the human BTBD7 gene and starting at position chr14:93241685; homopolymer repeat containing 10 consecutive adenines, localized in the human RYR3 gene and starting at position chr15:33865341. 5. The method according to any one of paragraphs. 3, 4, where the result of the amplification step is to obtain melting curve data. 6. The method according to claim 5, further comprising the steps of: (a) applying a wavelet transform to the melt curve data, and (b) applying the results obtained in (a) in determining the number of nucleotides in any of the homopolymer repeats listed in paragraphs. 3-4. 7. The method according to any one of paragraphs. 3-6 wherein the amplification step involves the use of at least one molecular beacon probe, where the molecular beacon probe is selected from SEQ ID NOs: 15-21. 8. The method according to any one of paragraphs. 3-7, wherein the amplification step involves the use of at least one primer having the sequence identified by any of the following SEQ ID NOs: 1-14. 9. The method according to any one of paragraphs. 3-8, where the amplification step involves at least one duplex amplification of a pair of homopolymer repeats, said pair being selected from the following combinations: - duplex amplification of a homopolymer repeat containing 11 consecutive adenines located in the human DIDO1 gene and starting at position chr20:62905340, together with a homopolymer repeat containing 11 consecutive adenines located in the human MRE11 gene and starting at position chr11:94479765; - duplex amplification of a homopolymer repeat containing 8 consecutive adenines located in the human ACVR2A gene and starting at position chr2:147926117, together with a homopolymer repeat containing 9 consecutive thymines located in the human SEC31A gene and starting at position chr4:82864412; And - duplex amplification of a homopolymer repeat containing 10 consecutive adenines located in the human BTBD7 gene and starting at position chr14:93241685, together with a homopolymer repeat containing 10 consecutive adenines located in the human SULF2 gene and starting at position chr20:47657577. 10. The method according to any one of paragraphs. 3-9, where the determination of the number of nucleotides in any of the homopolymer repeats listed in paragraphs. 3-4 are also additionally performed in a control biological sample containing material derived from the cell line HTC116 c1.110268743. 11. The method according to any one of paragraphs. 3-10, wherein the tumor sample is a stage I tumor, preferably a stage I colorectal tumor. 12. The method according to any one of paragraphs. 3-11, further comprising the step of using the obtained information about the number of homopolymer repeats to establish the mutation load of the tumor or the tumor load of insertions/deletions. 13. The method of claim 12, wherein the established tumor mutation load or insertion/deletion tumor load is presented as an estimate of the total number of mutations or is presented as a score. 14. The method according to any one of paragraphs. 3-13, further comprising the step of applying the obtained information on the number of homopolymer repeats, or on the mutational burden of the tumor, or on the burden of the tumor with insertions/deletions, or on the assessment of the total number of mutations, or on the scoring to decide whether to conduct immunotherapy in the subject, from from which the biological sample was obtained. 15. A kit for the analysis of MSI loci in a biological sample of a colorectal tumor, an endometrial tumor or a stomach, while the kit contains primers or probes made with the ability to specifically hybridize with nucleic acid regions or amplify them, while the nucleic acid regions contain the following homopolymer repeat regions, which are mapped to the reference human genome GRCh38/hg38: a homopolymer repeat containing 11 consecutive adenines located in the human DIDO1 gene and starting at position chr20:62905340; homopolymer repeat containing 11 consecutive adenines, localized in the human MRE11 gene and starting at position chr11:94479765; a homopolymer repeat containing 10 consecutive adenines located in the human SULF2 gene and starting at position chr20:47657577; And homopolymer repeat containing 8 consecutive adenines, localized in the human ACVR2A gene and starting at position chr2:147926117. 16. The kit according to claim 15, further comprising primers or probes configured to specifically hybridize to or amplify nucleic acid regions, wherein the nucleic acid regions contain one, two, or all of the following homopolymer repeats that are mapped to the reference human genome GRCh38 /hg38: a homopolymer repeat containing 9 consecutive thymines located in the human SEC31A gene and starting at position chr4:82864412; a homopolymer repeat containing 10 consecutive adenines located in the human BTBD7 gene and starting at position chr14:93241685; homopolymer repeat containing 10 consecutive adenines, localized in the human RYR3 gene and starting at position chr15:33865341. 17. The kit according to claim 15 or 16, where the primers contain at least one primer or a pair of primers selected from SEQ ID NO: 14. 18. A kit according to claim 15 or 16, wherein the probes comprise a molecular beacon probe. 19. The kit of claim 18 wherein the molecular beacon probe is selected from SEQ ID NOs: 15-21. 20. Set according to any one of paragraphs. 15-19, additionally containing material derived from the cell line HTC116 c1.110268743. 21. Set according to any one of paragraphs. 15-20 further comprising a cartridge. 22. A cell derived from the cell line HTC116 c1.110268743, for use as a control biological sample in the method according to any one of paragraphs. 3-14 containing nucleic acid regions containing the following regions of homopolymer repeats that are mapped to the reference human genome GRCh38/hg38: a homopolymer repeat containing 10 consecutive adenines located in the human DIDO1 gene and starting at position chr20:62905340; a homopolymer repeat containing 10 consecutive adenines located in the human MRE11 gene and starting at position chr11:94479765; a homopolymer repeat containing 9 consecutive adenines located in the human SULF2 gene and starting at position chr20:47657577; And homopolymer repeat containing 7 consecutive adenines, localized in the human ACVR2A gene and starting at position chr2:147926117. 23. A cell according to claim 22, additionally containing nucleic acid regions containing one, two or all of the following homopolymer repeat regions that are mapped to the reference human genome GRCh38/hg38: a homopolymer repeat containing 8 consecutive thymines located in the human SEC31A gene and starting at position chr4:82864412; a homopolymer repeat containing 9 consecutive adenines located in the human BTBD7 gene and starting at position chr14:93241685; homopolymer repeat containing 9 consecutive adenines, localized in the human RYR3 gene and starting at position chr15:33865341.

Images