CN113461808A - Competitive ELISA antibody detection kit for infectious bovine rhinotracheitis virus and application thereof - Google Patents

Abstract

The invention relates to antibody detection of infectious bovine rhinotracheitis virus, in particular to a competitive ELISA antibody detection kit of infectious bovine rhinotracheitis virus and application thereof. The invention provides a monoclonal antibody for resisting infectious bovine rhinotracheitis virus, which is secreted by hybridoma with the preservation number of CGMCC No. 23005. Also provides an antibody detection kit of the infectious bovine rhinotracheitis virus, which comprises the monoclonal antibody. The invention establishes an antibody detection method of the infectious bovine rhinotracheitis virus based on the monoclonal antibody and the truncated infectious bovine rhinotracheitis virus gB protein designed and expressed by the invention. The method has the advantages of strong specificity, good sensitivity, simple operation and high speed.

Description

Competitive ELISA antibody detection kit for infectious bovine rhinotracheitis virus and application thereof

Technical Field

The invention relates to antibody detection of infectious bovine rhinotracheitis virus, in particular to a competitive ELISA antibody detection kit of infectious bovine rhinotracheitis virus and application thereof.

Background

Infectious Bovine Rhinotracheitis Virus (IBRV), also known as Bovine herpes virus type I (BHV-1), belongs to the family of herpesviridae, is an important pathogen of cattle and can cause Infectious Bovine Rhinotracheitis (IBR). Infectious bovine rhinotracheitis is an infectious disease with strong heat, acute and latent properties. Since Miller first reported the disease in the United states in 1995, IBR has assumed a global epidemic situation, which causes enormous economic losses to the world cattle industry. The main hazard of the IBRV is that the virus can potentially infect ganglia of a host after invading the host, so that the sick cattle are finally infected with the virus, and great challenge is brought to the prevention and control of the disease. In view of its harmfulness, the world animal health Organization (OIE) ranks it as a B-type infectious disease, and China also ranks it as a second-type infectious disease. Clinical diagnosis is an essential means for assessing immune efficacy, monitoring the health of cattle and diagnosing disease, and therefore, research related to the enhancement of diagnostic techniques is imperative and also crucial.

The IBRV genome can encode approximately 70 proteins, the structure and function of which are currently largely known, and four major protein genes gB, gC, gD and gE present in the viral envelope have been sequenced. Among them, protein B (gB) is one of the major structural proteins and immune proteins of IBRV, is composed of 932 amino acid residues, and plays an important role in virus replication, adsorption and invasion into host cells. The gB protein is one of the main proteins for stimulating the body to generate neutralizing antibodies, and has important significance in the aspects of disease prevention and treatment and clinical diagnosis.

To effectively control IBR, a number of diagnostic techniques for IBRV have been developed, which can be broadly summarized as pathogenic diagnostics and serological testing, with serological testing being the most widely used diagnostic technique. The serological detection technology mainly comprises a neutralization test, ELISA and the like. The neutralization test is a method specified by international trade for diagnosing infectious bovine rhinotracheitis, and has the defects of high specificity, multiple influencing factors, complex operation, long time consumption, high-level operation of inspectors and the like. The ELISA method is widely applied to detection of clinical samples due to its advantages of high sensitivity, specificity, simplicity and rapidity of operation, and the like. At present, no report related to a competitive ELISA antibody detection method of the infectious bovine rhinotracheitis virus exists.

Disclosure of Invention

In order to improve the detection efficiency of the IBRV, the gB gene sequence of the IBRV is analyzed, a truncated gB gene (the nucleotide sequence of which is shown as SEQ ID NO: 1) is designed and secreted and expressed by an insect cell-baculovirus expression system, and a truncated gB protein (the amino acid sequence of which is shown as SEQ ID NO: 2) is obtained. Then, a monoclonal antibody (number 1F 24) which can be matched with the truncated gB protein and used for competitive ELISA detection of the IBRV antibody is screened by using the truncated gB protein, and thus, a high-efficiency and accurate competitive ELISA method for detecting the IBRV antibody is established.

The invention provides a monoclonal antibody for resisting infectious bovine rhinotracheitis virus, which is secreted by hybridoma with the preservation number of CGMCC number 23005.

The invention also provides a hybridoma cell strain secreting the monoclonal antibody, and the preservation number of the hybridoma cell strain is CGMCC number 23005.

The invention also provides an antibody detection kit for the infectious bovine rhinotracheitis virus, which comprises the monoclonal antibody for resisting the infectious bovine rhinotracheitis virus.

Preferably, the kit also comprises a truncated infectious bovine rhinotracheitis virus gB protein, and the amino acid sequence of the truncated infectious bovine rhinotracheitis virus gB protein is shown as SEQ ID NO. 2.

Preferably, the kit further comprises an elisa plate; the truncated bovine infectious rhinotracheitis virus gB protein is coated on an enzyme label plate in advance or coated on the enzyme label plate before use.

Preferably, the coating amount of the truncated bovine infectious rhinotracheitis virus gB protein on the ELISA plate is 0.1-5 mug/hole; the working concentration of the monoclonal antibody is 0.2-2 mug/mL.

Preferably, the kit further comprises an antigen coating solution; the antigen coating solution is 0.02mol/L, pH value of 6.5 +/-0.2 phosphate buffer solution.

Preferably, the kit further comprises a blocking solution; the blocking solution was a PBS solution containing 0.1% Casein and 5% sucrose.

Preferably, the kit further comprises a sample diluent; the sample dilution was 1.5% BSA in PBS.

The invention also provides a non-diagnostic purpose method for detecting the antibody of the infectious bovine rhinotracheitis virus, which is characterized by comprising the following steps: the kit is used for detection, and comprises the following steps:

(1) coating the truncated bovine infectious rhinotracheitis virus gB protein on an enzyme label plate by using a phosphate buffer solution with the value of 0.02mol/L, pH of 6.5 +/-0.2, wherein the coating amount is 0.1-5 mu g/hole, and incubating; washing an enzyme label plate;

(2) adding PBS solution containing 0.1% Casein and 5% sucrose, and sealing; washing an enzyme label plate;

(3) setting a sample hole, a negative control hole and a positive control hole; diluting a sample to be detected by using a PBS (phosphate buffer solution) containing 1.5% BSA (bovine serum albumin) according to a ratio of 1:2, and adding the sample to a sample hole; adding an enzyme-labeled monoclonal antibody solution with the concentration of 0.2-2 mug/mL into all the holes, and incubating; washing an enzyme label plate;

(4) adding a color development solution, and incubating;

(5) adding a stop solution, slightly and uniformly mixing, and reading a light absorption value at 450nm in an enzyme-linked immunosorbent assay;

(6) the S/N value, which is the OD of the sample well, was calculated_450nmvalue/OD of negative control well_450nmA value; if the S/N value is greater than 0.7, the sample isThe antibody of the infectious bovine rhinotracheitis virus is not contained in the medicine; if the S/N value is less than or equal to 0.7, the sample contains the antibody of the infectious bovine rhinotracheitis virus.

The invention adopts IBRV recombinant gB protein and anti-IBRV monoclonal antibody (1F 24) which are screened and identified as specific coating antigen and monoclonal antibody, and develops a competitive ELISA antibody detection kit (the kit is simply called as the kit) for the infectious bovine rhinotracheitis virus by optimizing the antigen coating amount, coating liquid, confining liquid, antibody using amount, sample diluent and sample diluent. 460 bovine serum samples with known backgrounds are detected by using the kit, the results are statistically analyzed, and the critical value and the judgment standard of the kit are determined by using an ROC (receiver operating characteristic curve) method, so that the competitive ELISA antibody detection method of the infectious bovine rhinotracheitis virus (the method is simply referred to as the method of the invention) is established. Experiments prove that the kit and the method have the following advantages:

(1) the specificity is strong: the monoclonal antibody (1F 24) prepared and screened by the invention can specifically recognize the infectious bovine rhinotracheitis virus Bartha Nu/67 strain and the infectious bovine rhinotracheitis virus gB protein, and does not react with mycoplasma bovis PD strain, bovine pasteurella multocida A Pm1 strain, bovine multocida B Pm572 strain, bovine viral diarrhea/mucosis virus Oregon C24V strain and wild-type baculovirus rBV-null strain.

(2) The sensitivity is good: 30 parts of IBRV antibody weak positive serum samples identified by a neutralization test are detected by adopting the kit. The results show that the S/N values of 29 serum samples are all between 0.400 and 0.700, and the S/N value of only 1 serum sample is 0.722. The positive coincidence rate of the kit disclosed by the invention and a neutralization test is 96.67%.

(3) The sensitivity is high: the IBRV standard positive serum is diluted according to the ratio of 1:8, the ratio of 1:16, the ratio of 1:32, the ratio of 1:64, the ratio of 1:128, the ratio of 1:256, the ratio of 1:512 and the ratio of 1:1024, and the competitive ELSIA method and the neutralization experiment are adopted for simultaneous detection, wherein the sensitivity of the method can reach the dilution of 1:256, and the neutralization experiment can detect the dilution of 1: 32.

(4) The consistency of the detection result with other methods is good: 170 bovine serum samples were simultaneously detected by using the kit of the present invention, a neutralization test, and an infectious bovine rhinotracheitis virus gB antibody detection kit (IDEXX kits for short) of idex Laboratories, Inc, respectively, and the coincidence rates between the three detection methods were compared. The results show that: the positive coincidence rate of the kit and a neutralization test is 92.77%, the negative coincidence rate is 100%, and the total coincidence rate is 96.47%; the positive coincidence rate of the IDEXX kit and the neutralization test is 93.98%, the negative coincidence rate is 97.70%, and the total coincidence rate is 95.88%; the positive coincidence rate of the kit and the IDEXX kit is 91.25 percent, the negative coincidence rate is 95.56 percent, and the total coincidence rate is 93.53 percent. Compared with the IDEXX kit, the kit provided by the invention has better compliance rate with a neutralization test and higher specificity.

(5) The detection efficiency is high: the neutralization test is complicated to operate, and the whole detection process needs at least 72 hours; the IDEXX kit needs to incubate the serum to be detected overnight, and the whole detection process needs 13-19 hours; the detection process of the kit is less than 1 hour, and compared with a neutralization test and an IDEXX kit, the kit is simpler and more convenient to operate, and the detection time is greatly shortened.

The hybridoma provided by the invention has been subjected to patent deposit, and the deposit information is as follows:

according to the biological materials (strains): 1F24

And (3) classification and naming: hybridoma cell

The preservation date is as follows: 7 month and 14 days 2021

The preservation number is: CGMCC number 23005

The preservation organization: china general microbiological culture Collection center

Address: xilu No. 1, Beijing, Chaoyang, Beijing, and institute for microbiology, China academy of sciences.

Drawings

FIG. 1 is a gel electrophoresis diagram of PCR amplification products of gB target gene fragments; in the figure, M: DNA Marker DL 2000; lane 1: gB target gene fragment.

FIG. 2 shows the PCR identification result of recombinant shuttle plasmid rBac-gB; in the figure, M: DNA Marker DL 5000; lane 1: amplification products of gB-specific primers; lane 2: amplification product of M13 universal primer.

FIG. 3 shows the result of PCR identification of recombinant baculovirus; lane 1 in the figure: PCR products using P2 generation baculovirus genome as template; lane 2: sf9 blank control; lane 3: negative control (wild type baculovirus rBV-null strain); lane 4: positive control (recombinant shuttle plasmid rBac-gB).

FIG. 4 shows the indirect immunofluorescence assay of recombinant baculovirus; in the figure, A: normal Sf9 cells; b: sf9 cells infected with recombinant baculovirus.

FIG. 5 Western blot identification of gB protein; lane 1 in the figure: normal Sf9 cells; lane 2: recombinant baculovirus Sf9 cell culture supernatant; lane 3: precipitation of recombinant baculovirus Sf9 cells.

FIG. 6 SDS-PAGE analysis of gB protein; in the figure, M: a 180kDa protein marker; lane 1: high Five blank control; lane 2: cell culture supernatant; lane 3: flow through the peak; lane 4: washing with 20mM imidazole; lane 5: 50mM imidazole wash.

FIG. 7 shows the Western blot analysis result of the 1F24 monoclonal antibody of the present invention.

FIG. 8 shows the results of indirect immunofluorescence assay of the 1F24 monoclonal antibody of the present invention. A. MDBK infected with IBRV was detected using mAb 1F 24. B. MDBK infected with IBRV was detected using mouse negative sera.

FIG. 9 shows the result of identifying the specificity of the 1F24 monoclonal antibody of the present invention. Lane 1: IBRV Bartha Nu/67 strain; lane 2: mycoplasma bovis PD strain; lane 3: type A cattle Pasteurella multocida Pm1 strain; lane 4: type B bovine Pasteurella multocida Pm572 strain; lane 5: BVDV Oregon C24V strain; lane 6: wild type baculovirus rBV-null strain.

FIG. 10 shows the ROC curve corresponding to the results of the test of the kit of the present invention on the S/N values of 460 sera.

Detailed Description

The present invention is described in detail below with reference to examples, it being understood that the following examples are only illustrative and illustrative of the present invention and do not limit the scope of the present invention in any way.

Animals: 6-8 week-old female BALB/c mice were purchased from Beijing Wittingle laboratory animal technology, Inc.

Cell: sf9 cells, High Five cells, MDBK cells and myeloma cells SP2/0 cells are provided by livestock and poultry epidemic disease research center of agriculture and forestry academy of sciences of Beijing, and all the cells can be obtained commercially. Coli DH5 α competent cells: purchased from Beijing Quanjin Biotechnology Ltd, cat # CD 201-01. DH10BAC competent cells: purchased from Invitrogen, cat # 10361012.

Viruses and bacteria: bovine infectious rhinotracheitis virus (IBRV) Bartha Nu/67 standard strain is provided by livestock and poultry epidemic disease research center of agriculture and forestry academy of sciences in Beijing, and is a known Bovine herpes virus type I strain, which is disclosed in the documents Xu J, Zhang X, ZHou S, Shen J, Yang D, Wu J, Li X, Li M, Huang X, Sealy JE, Iqbal M, Li Y. A DNA aptamer affinity inhibition of infection of Bovine herpesvirus 1 by blocking virus entry Sci Rep.2017 Sep 18, (7) (1) 11796, doi: 10.1038/S41598-017 10070-1, PMID: 28924154, ID: PMC 3556041. The bacterial strain of mycoplasma bovis PD, the bovine pasteurella multocida Pm 1A, the bovine pasteurella multocida Pm 572B, the bovine viral diarrhea/mucosis virus Oregon C24V (BVDV Oregon C24V) and the wild type baculovirus rBV-null are provided by livestock and poultry epidemic research center of agriculture and forestry academy of sciences of Beijing. The above viruses and bacteria were also stored in the laboratory and the applicant stated that they could be released to the public for the necessary validation experiments within twenty years from the filing date.

Serum: IBRV standard positive serum and standard negative serum were purchased from the Chinese veterinary medicine inspection institute. 460 serum samples prepared, identified and stored by agroforestry academy of sciences of Beijing, including 300 parts of IBRV antibody negative serum and 160 parts of IBRV antibody positive serum, were identified by neutralization test and confirmed for background. 30 parts of IBRV antibody weak positive serum prepared, identified and stored by the academy of agriculture and forestry, Beijing, are identified by a neutralization test, and the background of the IBRV antibody weak positive serum is confirmed. 170 parts of immune serum and non-immune serum of the infectious bovine rhinotracheitis inactivated vaccine collected in the field are identified by a neutralization test, wherein 83 parts of serum is positive for an IBRV antibody, 87 parts of serum is negative for the IBRV antibody, and the serum is collected, identified and stored by the agroforestrial academy of sciences of Beijing.

Carrier: pFastBac ^TM1, is an insect cell expression vector, is provided by livestock and poultry epidemic disease research center of agriculture and forestry academy of sciences of Beijing and can be obtained commercially.

Reagent consumables: kanamycin, X-Gal, ampicillin and endotoxin-free plasmid miniprep kit were purchased from Tiangen Biotechnology (Beijing) Ltd. Gentamicin, tetracycline, Casein, ovalbumin, ammonium sulfate were purchased from Beijing Solebao technologies, Inc. IPTG was purchased from Sigma-Aldrich. HF502C insect cell serum-free medium was purchased from wome biotechnology limited, suzhou. DMEM, Australian fetal bovine serum, calf serum, horse serum were purchased from Gibco. BSA was purchased from Calbiochem. Gelatin, sucrose, NaIO₄、NaBH₄、(NH₄)₂SO₄Purchased from beijing chemicals. 6-well plates, T175 cell culture flasks, shake flasks, elisa plates, 96-well cell culture plates, 48-well plates, and sterile flying discs were purchased from Corning. Plate washer (BIO RAD, model ImmunoWash)^TM1575) Multifunctional microplate detector (PerkinElmer, model Victor Nivo)^TM）。

Solution preparation:

PBS: 2.9g of disodium hydrogen phosphate (containing 12 crystal waters), 0.2g of potassium dihydrogen phosphate, 8g of sodium chloride and 0.2g of potassium chloride were weighed, and 1000ml of purified water was added thereto and dissolved by stirring.

Stopping liquid: 876ml of purified water is measured, 124 ml of sulfuric acid (2 mol/L) is slowly added, the mixture is stirred uniformly, and then the purified water is added to reach the volume of 1000 ml. Quantitatively subpackaging and storing at 2-8 ℃.

Enzyme conjugate dilution: weighing 2.9g of disodium hydrogen phosphate (containing 12 crystal water), 0.2g of monopotassium phosphate, 8g of sodium chloride and 0.2g of potassium chloride, adding 800ml of purified water, stirring and dissolving, then adding 15g of BSA, adding 1ml of Proclin 300 and 1ml of TritonX-100, then adding purified water to reach the constant volume of 1000ml, and filtering and sterilizing.

Unless otherwise specified, the reagents used in the following examples are conventional in the art, and are either commercially available or formulated according to methods conventional in the art, and may be of laboratory pure grade. Unless otherwise specified, the experimental methods and conditions used in the following examples are all conventional in the art, and reference may be made to relevant experimental manuals, well-known literature, or manufacturer's instructions. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.

Example 1 design and expression of recombinant gB proteins of IBRV

1. Sequence optimization and primer synthesis

The gB gene sequence of IBRV (GeneID: 4783419) was downloaded from the GenBank database and analyzed using an on-line analysis website (http:// www.cbs.dtu.dk/services/TMHMM /), to design a truncated gB gene sequence (SEQ ID NO: 1) encoding a truncated gB protein (SEQ ID NO: 2). In order to allow secretory expression of the truncated gB protein in insect cells, the truncated gB gene sequence was codon optimized according to insect cell preference to obtain the target gene sequence (SEQ ID NO: 3). The target gene was synthesized by the firm of Venetian Biotechnology engineering (Shanghai). According to a base sequence and a target gene sequence of a baculovirus expression vector, 1 pair of homologous arm amplification primers are designed, enzyme cutting sites NdeI (CATATG) and XhoI (CTCGAG) are respectively added in an upstream primer sequence and a downstream primer sequence, the primers are sent to Beijing Optimalaceae biotechnology limited for primer synthesis, and a universal primer M13 is synthesized at the same time.

TABLE 1 primer sequence Listing

Primer name	Sequence 5 '-3'	Cleavage site
			gB-F	CGGCGCATTCTGCCTTTGCGCATATGGGCGCCGGAGACGGTC	NdeI
gB-R	CTTGTGGTGGTGGTGGTGGTGCTCGAGGCGCCGCGGGCCCGGC	XhoI
			PUC/M13R	AGCGGATAACAATTTCACACAGG
PUC/M13F	CCCAGTCACGACGTTGTAAAACG

2. Construction and identification of baculovirus transfer vectors

The target gene was amplified by PCR using the primers gB-F and gB-R. The 50 μ L PCR reaction was as follows: 10 μ L of 5 XPrimeSTAR Buffer (Mg)²⁺Plus) (TaKaRa, cat # 9158A), 4. mu.L dNTP Mix, 0.5. mu.L PrimeSTAR HS DNA Polymerase (TaKaRa, cat # R010Q), 1. mu.L gB-F, 1. mu.L gB-R, 1. mu.L DNA template and 32.5. mu.L ddH₂O; the reaction procedure is as follows: denaturation at 94 deg.C for 2 min; denaturation at 98 ℃ for 10s, annealing at 56 ℃ for 15s, and extension at 72 ℃ for 90s for 30 cycles; extension at 72 ℃ for 10 min. After the PCR was completed, the product was detected by electrophoresis on a 1% agarose gel to obtain an amplified band of about 1470bp, which is consistent with the expected result (FIG. 1). The objective gene fragment was recovered using a gel recovery kit (Omega Bio-Tek, cat # OMEGA. D2500-01) according to the protocol described in the kit instructions.

Recovering the target gene fragment and pFastBac ^TM1, carrying out double enzyme digestion on the vectors respectively. The enzyme cutting system is as follows: 2 μ L Neb Buffer3.1, 6 μ L pFastBac ^TM1 plasmid/Gene fragment of interest, 2. mu.L of Xho I endonuclease (NEB, Ex. Fr.; Ex. RTM.; 2. mu.L)# R0146S), 2. mu.L of Nde I endonuclease (NEB, cat # R0111S), 8. mu.L of ddH₂And O. And (3) uniformly mixing the enzyme digestion system, and then placing the mixture in a constant-temperature water bath at 37 ℃ for reaction for 2 hours. The cleavage products were recovered by gel electrophoresis using a gel recovery kit (Omega Bio-Tek, cat # OMEGA. D2500-01) according to the kit instructions.

The target gene fragment subjected to double enzyme digestion is directionally cloned to the pFastBac subjected to double enzyme digestion by using Clon express II One Step Cloning Kit (the product number is C112-01/02) of Nanjing Novjingzu Biotechnology Limited company ^TM1 on a carrier. The linking system is as follows: 0.65 μ L pFastBac ^TM1 linearized vector, 3. mu.L of the target gene fragment, 4. mu.L of 5 × CE II Buffer, 2. mu.L of Exnase II, 10.35. mu.L of ddH₂And O. Ligation was carried out at 37 ℃ for 30min to obtain the transfer vector pFast-gB. The constructed transfer vector pFast-gB is transformed into escherichia coli DH5 alpha competent cells by a heat shock method, and positive clones are selected the next day and sent to Beijing Ongskaceae Biotech Limited for sequencing and identification.

3. Construction and identification of recombinant shuttle plasmid

The correct transfer vector identified, pFast-gB, was transformed into freshly prepared DH10BAC competent cells (Invitrogen, 10361012). The conversion steps are as follows: adding 1 mug of pFast-gB transfer carrier into the competent cell suspension, uniformly mixing, placing in 42 ℃ water bath for 80s after ice bath for 30min, and then rapidly carrying out ice bath for 200 s; adding 900 muL of nonreactive SOC culture medium into the tube, and performing shake culture at 37 ℃ and 190 rpm for 4 hours; 100 mu L of bacterial liquid is uniformly coated on an LB solid culture medium containing kanamycin (50 mu g/ml), gentamicin (7 mu g/ml), tetracycline (10 mu g/ml), X-gal and IPTG, and cultured for 24h at 37 ℃. Single white colonies were picked and identified by PCR using specific primers (gB-F and gB-R) and M13 universal primers. And carrying out streak culture on the correctly identified bacterial liquid on an LB solid culture medium containing kanamycin, gentamicin and tetracycline, and carrying out PCR identification again the next day to obtain positive bacteria. As shown in FIG. 2, the target band (lane 1) with a size of 1470bp obtained by specific primer amplification, and the band (lane 2) with a size of 3770bp (2300 bp + insert) obtained by M13 universal primer amplification, both of which are consistent with the size of the target fragment, indicate that the recombinant shuttle plasmid (named rBac-gB) is successfully constructed. The positive bacteria were then expanded and recombinant shuttle Plasmid (rBac-gB) was extracted using Pure Link Hi Pure Plasmid DNA Purification Kits (Invitrogen, cat # K2100) according to the kit instructions.

4. Rescue and passage of recombinant baculovirus

The recombinant shuttle plasmid was transfected into Sf9 cells (insect ovarian cells) using the expifctamine Sf Transfection Reagent Transfection kit (Invitrogen, cat No. a 38915). The method comprises the following steps: in a 6-well plate according to 0.8X 10⁶1.0X 10 cells/well⁶1.2X 10 cells/well⁶The Sf9 cells with good growth vigor are paved on the cells/hole, and the cells are cultured in an incubator at 28 ℃ for 2h to be completely attached to the wall. mu.L of Sf Transfection Reagent was added to 500 mu.L of Opti-MEM (Gibco)^TM) After mixing, incubating at 25 ℃ for 5 min. Mu.g of recombinant shuttle plasmid (rBac-gB) was added to the above solution, gently mixed, and incubated at 25 ℃ for 5 min. The above solution was added dropwise to the wells of the cells grown in a monolayer, and cultured at 28 ℃. The cell state was observed every day, and when the cells appeared more obvious lesions on day 4, the cell culture supernatant was collected by centrifugation to obtain P0 generation baculovirus. The baculovirus of generation P0 continued to pass blindly to generation P3 to be identified.

5. Expression and identification of recombinant gB protein in Sf9 cells

(1) PCR identification

And extracting a P2 generation baculovirus genome, and performing PCR identification by using specific primers gB-F and gB-R according to the PCR reaction system and the reaction program. Gel electrophoresis results show that a specific band appears around 1470bp (figure 3), which indicates that the gB gene and baculovirus undergo homologous recombination and successfully infect Sf9 cells.

(2) Indirect immunofluorescence assay

Inoculating P2 generation baculovirus into a 6-hole plate, infecting well-grown Sf9 cells, culturing the cells in a 27 ℃ cell culture box in a dark place for 72 hours, sucking and removing a culture medium after the cells grow larger and become round, the edges of the cells are irregular, and intracellular particles are increased, and washing with PBS for 3 times to remove the culture medium; adding 4% paraformaldehyde, fixing at room temperature for 10min, and washing with PBS for 3 times to remove paraformaldehyde; adding 0.1% Triton 100 for permeabilization for 15min, washing with PBS 3 times to remove Triton; adding 5% BSA, blocking at room temperature for 2h, discarding the blocking solution, adding monoclonal antibody (abcam, cat # ab 18184) against 6 × His tag (diluted with blocking solution at a ratio of 1: 5000), incubating at 37 deg.C for 1h, and washing with PBST for 5 times; FITC-labeled goat anti-mouse IgG (Sigma-Aldrich, cat # F5387) (diluted 1:1000 with blocking solution) was added, incubated 1h at room temperature in the dark, and washed 5 times with PBST. And observing and photographing under a fluorescent microscope. As a result, as shown in fig. 4, Sf9 cells not infected with recombinant baculovirus were non-fluorescent (fig. 4A), and Sf9 cells infected with recombinant baculovirus were able to detect bright green fluorescence (fig. 4B), indicating that recombinant gB protein was successfully expressed in Sf9 cells.

(3) Western blot identification

Inoculating P2 generation baculovirus into an airtight T175 cell culture bottle, infecting Sf9 cells in logarithmic growth phase, blowing down the cells when cytopathic effect reaches about 70%, centrifuging for 6min at 100 Xg, and respectively collecting cell culture supernatant and cell precipitate. The cell pellet was resuspended in 160 μ L sterile water. Mixing the cell culture supernatant and the cell sediment suspension with the protein loading buffer solution respectively, boiling water bath for 10min, and rapidly ice-cooling for 5 min. After completion of SDS-PAGE, transfer was carried out according to a conventional transfer method. After the transfer, the PVDF membrane was blocked with 5% skim milk in PBST for 2 h. The primary antibody was anti-6 XHis-tagged monoclonal antibody (abcam, cat # ab 18184) (diluted 1:5000 with blocking solution), and the secondary antibody was goat anti-mouse IgG (Sigma-Aldrich, cat # A9309) (diluted 1:10000 with blocking solution) following the conventional Western blot procedure. As a result, as shown in FIG. 5, specific bands appeared in both the cell culture supernatant (lane 2) and the cell pellet (lane 3), indicating that the recombinant gB protein was successfully expressed in Sf9 cells and secreted into the cell culture supernatant.

(4) Efficient expression and purification of recombinant gB protein

Inoculating the P3 generation baculovirus into a cell shake flask, infecting High Five cells in logarithmic growth phase, and centrifuging for 60h after inoculation to respectively collect cell culture supernatant. After filtration by centrifugation, the His column (Qiagen, cat # 70971) was hung at 4 ℃ by a peristaltic pump. The recombinant gB protein was then purified and eluted with a gradient of imidazole concentration (20 mM, 50mM and 400 mM) and the individual eluted peaks were identified by SDS-PAGE. As a result, as shown in FIG. 6, a larger amount of the target protein was observed in the 50mM imidazole-eluted peak after the gB protein was applied to the His column (lane 5).

Example 2 preparation and screening of anti-IBRV monoclonal antibodies

1. Animal immunization

First immunization: after purified IBRV virus solution (Bartha Nu/67 standard strain) and equal volume of Freund's complete adjuvant (Sigma-Aldrich, Cat. No. F5881) are mixed and emulsified completely, 6-8 weeks old female BALB/c mice of SPF grade are immunized, and the immunization dose is 50 microgram/mouse. 2 weeks after the first immunization, after fully emulsifying an IBRV virus solution (Bartha Nu/67 standard strain) with the same volume with Freund's incomplete adjuvant (Sigma-Aldrich, Cat. F5506), 2 nd, 3 rd and 4 th immunizations are carried out, wherein the immunizing dose is 50 mug/mouse, and each immunization interval is 2 weeks.

2. Serum potency assay

An indirect ELISA method for screening hybridomas is established by using the positive serum of the mice after the three-immunization, and the optimal antigen coating concentration and the optimal dilution of the positive serum are calibrated by using a chessboard method. The indirect ELISA method was as follows:

coating: the recombinant gB protein prepared in example 1 was diluted to 0.1562. mu.g/ml in a linear-to-double ratio of 5. mu.g/ml and 2.5. mu.g/ml, an ELISA plate was added at 100. mu.L per well, PBST was added to the last row of the ELISA plate as an antigen negative control, and after incubation at 37 ℃ for 1 hour, overnight at 4 ℃.

And (3) sealing: after washing the plate 5 times with a plate washer, 300. mu.L of 5% skim milk (PBST diluted) was added to each well and blocked for 2h at 37 ℃.

Incubating primary antibody: PBST was used to dilute the positive and negative sera of mice after the three-immunization sequentially from 1:400 to 1:800 to 1: 12800, after washing the plates, 100. mu.L/well was added, and incubated at 37 ℃ for 1 h.

Hatching a secondary antibody: HRP-labeled goat anti-mouse IgG (Sigma-Aldrich, cat # A9309) was diluted 1:10000 times in PBST, added after washing the plate, 100. mu.L/well, and incubated at 37 ℃ for 1 h.

Color development: adding TMB developing solution (Solarb) after washing the plateio, cat # PR 1210), 100. mu.L/well, reaction at 37 ℃ for 15min in the absence of light, and termination by addition of 50. mu.L of 2M sulfuric acid. Reading the absorbance (OD) at a wavelength of 450nm_450nm）。

Selection of OD_450nmThe wells with the value closest to 1.0 correspond to the antigen concentration and serum dilution of the optimal antigen coating concentration (0.625. mu.g/mL) and the optimal positive serum dilution (1: 6400). Blood sampling is carried out on mouse eyeballs one week after four-immunization, and the serum titer of the mouse is determined according to the indirect ELISA method by adopting the optimal antigen coating concentration and the optimal positive serum dilution. Two mice with the highest titer are selected, and peritoneal boosting immunization is carried out 3 days before cell fusion, wherein the immunization dose is 50 mug/mouse.

3. Cell fusion and screening

Spleen of the BALB/c mice after the boosting immunization is taken under a sterile environment to prepare a splenocyte suspension, splenocytes of the mice and SP2/0 myeloma cells are fused according to the cell number ratio of 5:1, and the fused splenocytes are paved on 6 96-hole cell culture plates, selectively cultured by HAT culture medium (Sigma-Aldrich, the product number H0262) containing 20% fetal bovine serum, and gradually replaced by HT culture medium (Sigma-Aldrich, the product number H0137) for 7-12 days. On day 10 after the fusion, hybridoma cells were preliminarily screened by the indirect ELISA method described above using the recombinant gB protein and IBRV prepared in example 1 as coating antigens, respectively, with a coating amount of 62.5 ng/well and 500 ng/well of IBRV. The assay was repeated every 2 days, and wells positive for both recombinant gB protein and IBRV were screened. The fused cells in all the wells with strong positive detection results in 6 plates are transferred to 48-well plates for amplification culture, and 5 wells with high ELISA value are selected for first subcloning. Subcloning was performed 2 more times according to the same method until the positive rate was 100%. 1 hybridoma cell line which can stably secrete the monoclonal antibody is obtained, is numbered as 1F24 and is frozen and stored in a liquid nitrogen tank. The hybridoma cell strain 1F24 has been preserved in China general microbiological culture Collection center (CGMCC), with the preservation number of CGMCC No. 23005.

4. Identification of monoclonal antibodies

(1) Western blot identification

The recombinant gB protein prepared in example 1 was mixed with the protein loading buffer at a ratio of 1:5, boiled at 100 ℃ for 10min and immediately placed on ice for cooling. And performing SDS-PAGE after loading samples at 5 muL/hole, and transferring the proteins on the polyacrylamide gel to a PVDF membrane by using a conventional wet transfer method. Sealing the PVDF membrane by using 5% skim milk at room temperature for 1 h; taking the cell culture supernatant of the hybridoma cell strain 1F24 as a primary antibody, and incubating for 1h at room temperature; PBST membrane washing for 3 times, 10min each time; goat anti-mouse IgG labeled with HRP (Sigma-Aldrich, cat # A9309) (1: 10000) was used as a secondary antibody and incubated at room temperature for 1 h; PBST membrane washing for 3 times, 10min each time; chemiluminescence and photographing for storage. The results showed that 1F24 monoclonal antibody reacted specifically with recombinant gB protein (FIG. 7).

(2) Indirect immunofluorescence assay

Sterile flyswatches and equivalent MDBK cell suspension were added to 6-well plates at 37 ℃ with 5% CO₂Cells were cultured in an incubator as monolayers, which were inoculated with IBRV at a viral load of 100TCID 50. After 24h of inoculation, fixing with 4% paraformaldehyde for 10min, and washing with PBS for 3 times; 0.1% TritonX-100 acts for 15min, and is washed 3 times with PBS; blocking with PBS containing 5% BSA at room temperature for 1h, washing with PBS 3 times; adding 1F24 hybridoma culture supernatant into different culture wells, setting negative control and positive control (the negative control is blank control well, and the positive control well is added with 1:100 times diluted mouse IBRV positive serum), incubating at 37 deg.C for 1h, washing with PBS for 3 times, each for 5 min; adding FITC labeled goat anti-mouse IgG (Sigma-Aldrich, Cat. No. F5387) (diluted with blocking solution at a ratio of 1: 1000), keeping away from light at room temperature for 1h, washing with PBS for 3 times, each for 5 min; DAPI (Sigma-Aldrich, cat # D9542) (deionized water 1:10000 diluted) was added, protected from light at room temperature for 6min, washed 2 times with deionized water, fixed on a glass slide with an anti-quencher, and observed under a fluorescent microscope. As shown in FIG. 8, 1F24 monoclonal antibody was able to produce specific green fluorescence with MDBK cells infected with IBRV (FIG. 8A).

(3) Subtype identification of monoclonal antibodies

Monoclonal Antibody Isotyping Reagents (Sigma-Aldrich, cat # ISO 2) were used for Monoclonal Antibody Isotyping Reagents according to the kit instructions. The results show that the 1F24 monoclonal antibody is IgG1 subclass.

(4) Preparation and potency determination of ascites

0.5mL of sterile liquid paraffin is injected into the abdominal cavity of SPF-level BALB/c mice for sensitization, and 10 g of sterile liquid paraffin is injected into the abdominal cavity after 7 days⁶1F24 hybridoma cells. The abdominal cavity of the mouse is observed every day, and when the mouse is expanded to be inconvenient to move, the ascites is collected. The obtained ascites was purified by Thermo Protein A/G purification column, the concentration was measured and stored at-80 ℃ for future use. The titer of ascites was determined by the established indirect ELISA method.

(5) Stability detection of monoclonal antibody secreted by hybridoma cell strain 1F24

After 8 months, the cryopreserved hybridoma cell line 1F24 was removed from the liquid nitrogen and revived, and then subjected to indirect ELISA detection. The results showed that the titer of the monoclonal antibody supernatant reached 1:6400, indicating that the activity of the hybridoma cell line 1F24 for secreting monoclonal antibody was not reduced.

(6) Characterization of the specificity of monoclonal antibodies

Respectively taking 40 mu L of inactivated infectious bovine rhinotracheitis virus Bartha Nu/67 strain virus liquid, bovine mycoplasma PD culture solution, A type bovine pasteurella multocida Pm1 bacterial liquid, B type bovine pasteurella multocida Pm572 bacterial liquid, bovine viral diarrhea/mucosal disease virus Oregon C24V virus liquid, wild type rhabdovirus rBV-null virus liquid and protein loading buffer solution, mixing, and rapidly performing ice bath for 5min after boiling water bath for 10 min. After completion of SDS-PAGE, transfer was carried out according to a conventional transfer method. After the transfer, the PVDF membrane was blocked with 5% skim milk in PBST for 2 h. The specificity of the monoclonal antibody was identified by the conventional Western blot procedure using 1F24 monoclonal antibody as the primary antibody and HRP-labeled goat anti-mouse IgG (Sigma-Aldrich, cat # A9309) (1: 10000 diluted) as the secondary antibody. As shown in FIG. 9, the 1F24 monoclonal antibody specifically recognized the infectious bovine rhinotracheitis virus Bartha Nu/67 strain (lane 1), and did not react with the bovine mycoplasma PD strain (lane 2), bovine pasteurella multocida type A Pm1 strain (lane 3), bovine pasteurella multocida type B Pm572 strain (lane 4), bovine viral diarrhea/mucosis virus Oregon C24V strain (lane 5), and wild type baculovirus rBV-null strain (baculovirus without any foreign gene inserted) (lane 6).

Example 3 establishment of IBRV Competition ELISA antibody detection method

1. Horse radish peroxidase labeled monoclonal antibody

Horseradish peroxidase (HRP) labeling of 1F24 mab with sodium periodate method, as follows:

(1) 5mg of HRP (Sigma-Aldrich, SRE 0082) was weighed into 1000. mu.L of double distilled water and 500. mu.L of fresh 0.1M NaIO was added₄Mixing, and incubating at 4 deg.C in dark for 30 min.

(2) Add 500. mu.L of fresh 0.2M ethylene glycol (Sigma-Aldrich, 324558) and mix well and incubate at 4 ℃ for 30min in the dark.

(3) 5mg of purified 1F24 mab was added to the above solution, mixed well and placed in a pre-treated dialysis bag (Solambio, MW 14000) and dialyzed overnight in 0.1M carbonate buffer pH9.6 with three changes during dialysis.

(4) The dialyzed liquid was poured into a new centrifuge tube and 200. mu.L of newly formulated 5mg/mL NaBH was added₄Mixing, and incubating at 4 deg.C in dark for 2 h.

(5) The liquid was poured into a clean beaker and an equal volume of supersaturated (NH) was added slowly₄)₂SO₄The solution was centrifuged at 3000rpm for 30min, the supernatant was discarded and the pellet was resuspended in an appropriate amount of pre-cooled 0.1M PBS solution, pH 7.2.

(6) The solution was filled into dialysis bags and dialyzed overnight against 0.1M carbonate buffer pH9.6 with three medium changes.

(7) Collecting the liquid in the dialysis bag the next day, measuring the concentration, subpackaging and storing in 30% glycerol solution.

2. Determination of antigen coating concentration and enzyme-labeled monoclonal antibody optimal dilution

The gB recombinant protein (prepared in example 1) at a concentration of 2mg/ml was diluted 1:500, 1:1000, 1:2000, and 1:4000 with phosphate buffer (0.02 mol/L, pH 6.5. + -. 0.2) to serve as a coating antigen, and the enzyme-labeled plate was coated in an amount of 100. mu.l/well. HRP-labeled 1F24 monoclonal antibody at a concentration of 1 mg/ml was diluted with enzyme conjugate diluent at a ratio of 1:1000, 1:2000, 1:4000, 1: 8000. Competitive ELISA was performed with HRP-labeled 1F24 monoclonal antibody using IBRV standard positive and standard negative sera, and the highest N/P value (N denotes negative serum OD)_450nmMean, P represents positive serum OD_450nmMean value) as the optimal antigen coating concentration and the optimal enzyme-labeled monoclonal antibody concentration. The result shows that the optimal coating concentration of the antigen is 2 mug/ml, and the optimal concentration of the enzyme-labeled monoclonal antibody is 0.5 mug/ml.

3. Selection of coating liquid

Carbonate Buffer (CB) (0.05 mol/L, pH 9.6. + -. 0.2): 1.59g of anhydrous sodium carbonate and 2.93g of sodium bicarbonate are weighed, and purified water is added to the mixture to reach the constant volume of 1000 ml.

Phosphate Buffer (PB) (0.02 mol/L, pH 6.5. + -. 0.2): 2.043g of disodium hydrogen phosphate (containing 12 crystal water) and 2.227g of sodium dihydrogen phosphate (containing 2 crystal water) are weighed, and purified water is added to the mixture to reach the volume of 1000 ml.

Tris Buffer (TB) (0.01 mol/L, pH 8.0. + -. 0.2): weighing 1.21g of Tris, adding 800ml of purified water for dissolving, then adjusting the pH value to 8.0 +/-0.2 by using HCl, and adding the purified water for fixing the volume to 1000 ml.

The three buffers were prepared as coating solutions. The gB recombinant protein (prepared in example 1) was diluted to 2. mu.g/ml with different coating solutions, and the ELISA plates were coated at 100. mu.l/well. Competitive ELISA was performed with IBRV standard positive and standard negative sera and HRP-labeled 1F24 monoclonal antibody (0.5 μ g/ml), and N/P values were screened (N represents negative serum OD)_450nmMean, P represents positive serum OD_450nmMean) the largest coating solution was used as the optimal coating solution. KnotThe result shows that phosphate buffer PB (0.02 mol/L, pH 6.5 + -0.2) is the optimal coating solution.

TABLE 5 measurement results after coating with different coating solutions

Coating liquid	CB	PB	TB
				N	0.968	1.545	1.234
P	0.221	0.154	0.189
				N/P	4.380	10.032	6.529

4. Selection of confining liquids

PBS solutions containing 1% BSA +5% sucrose (1 g BSA and 5g sucrose per 100ml PBS), 0.1% Casein +5% sucrose (0.1 g Casein and 5g sucrose per 100ml PBS), and 5% gelatin +5% sucrose (100 m PBS), were prepared separately5g of gelatin and 5g of sucrose) was added to l PBS, and a PBS solution containing 1.5% ovalbumin +5% sucrose (1.5 g of ovalbumin and 5g of sucrose per 100ml of PBS) was used as a blocking solution. And preparing a gB protein solution of 2 mu g/ml by using the optimal coating solution, and coating the ELISA plate according to the amount of 100 mu l/hole. And respectively sealing the 4 sealing liquids for 16-24 hours at the temperature of 2-8 ℃. Competitive ELISA was performed with IBRV standard positive and standard negative sera, against HRP-labeled 1F24 monoclonal antibody (0.5 μ g/ml), according to the N/P value (N denotes negative serum OD)_450nmMean, P represents positive serum OD_450nmMean) to determine the optimal blocking solution. The results showed that the OD of the negative serum was determined when 0.1% Casein +5% sucrose in PBS was used as the blocking solution_450nmThe values were higher and the N/P value was greatest, so a PBS solution containing 0.1% Casein +5% sucrose was the best blocking solution.

TABLE 6 measurement results after blocking with different blocking solutions

Sealing liquid	1% BSA +5% sucrose	0.1% Casein +5% sucrose	5% gelatin +5% sucrose	1.5% ovalbumin +5% sucrose
					N	1.275	1.547	0.826	1.168
P	0.226	0.144	0.198	0.165
					N/P	5.642	10.743	4.172	7.079

5. Selection of sample dilutions

PBS solution containing 1.5% (g/ml) BSA, PBS solution containing 5% (v/v) calf serum, and PBS solution containing 5% (v/v) horse serum were prepared as sample dilutions, respectively. And preparing a gB protein solution of 2 mu g/ml by using the optimal coating solution, and coating the ELISA plate according to the amount of 100 mu l/hole. Blocking with an optimal blocking liquid. Diluting IBRV standard positive serum and standard negative serum by using 3 sample diluents according to the proportion of 1:2, and performing competitive ELISA with HRP-labeled 1F24 monoclonal antibody (0.5 mu g/ml) according to the N/P value (N represents negative serum OD)_450nmMean, P represents positive serum OD_450nmMean) to determine the optimal sample dilution. The results show that the N/P value is maximal when 1.5% BSA in PBS is used as the sample diluent, so 1.5% BSA in PBS is the optimal sample diluent.

TABLE 7 measurement results of different sample dilutions

Sample diluent	1.5% BSA	5% Calf serum	5% horse serum
				N	1.544	1.505	1.436
P	0.103	0.158	0.115
				N/P	14.990	9.525	12.487

6. Determination of optimal dilution factor of serum

And preparing a gB protein solution of 2 mu g/ml by using the optimal coating solution, and coating the ELISA plate according to the amount of 100 mu l/hole. Blocking with an optimal blocking liquid. After the IBRV standard positive serum and the standard negative serum are respectively diluted by 1:2, 1:5, 1:10, 1:20, 1:40 and 1:80 by using the optimal sample diluent, competitive ELISA is carried out with an HRP-labeled 1F24 monoclonal antibody (0.5 mu g/ml), and the N/P value (N represents the OD of the negative serum)_450nmMean, P represents positive serum OD_450nmMean) to determine the optimal dilution factor. The results showed that the N/P value was maximal at a serum dilution of 1:2, so the optimal serum dilution was 1: 2.

TABLE 8 serum optimal dilution test results

Dilution of serum	1:2	1:5	1:10	1:20	1:40	1:80
							N	1.591	1.132	0.985	0.887	0.824	0.697
P	0.104	0.204	0.159	0.178	0.166	0.169
							N/P value	15.298	5.549	6.195	4.983	4.964	4.124

7. Determination of reaction time

And preparing a gB protein solution of 2 mu g/ml by using the optimal coating solution, and coating the ELISA plate according to the amount of 100 mu l/hole. Blocking with an optimal blocking liquid. After diluting IBRV standard positive serum and standard negative serum by 1:2 with optimal sample diluent respectively, performing competitive ELISA with HRP-labeled 1F24 monoclonal antibody (0.5 mug/ml). The post-sample incubation time + post-color development incubation time were set to react at 37 ℃ for 15+10 minutes, 30+10 minutes, 45+10 minutes, and 60+10 minutes, respectively, and the values of N/P (N represents negative serum OD)_450nmMean, P represents positive serum OD_450nmMean) determines the optimal reaction time. As a result, 30+10 minutes was selected as the optimum reaction time since the N/P value was the largest under the conditions of incubation at 37 ℃ for 30 minutes after sample application and incubation at 37 ℃ for 10 minutes after color development.

TABLE 9 screening of optimal reaction time

Reaction time	15+10 min at 37 DEG C	30+10 min at 37 DEG C	45+10 min at 37 DEG C	60+10 min at 37 DEG C
					N	0.875	1.547	1.626	1.768
P	0.096	0.146	0.198	0.265
					N/P	9.115	10.596	8.212	6.672

8. Preparation of IBRV competition ELISA antibody detection kit

Preparing an antigen coated plate: diluting the IBRV gB recombinant protein (prepared in example 1) to 2 mu g/ml by using a phosphate buffer solution (0.02 mol/L, pH value of 6.5 +/-0.2), adding the diluted IBRV gB recombinant protein into an ELISA plate in an amount of 100 mu L/hole, and coating the recombinant protein for 16-24 hours at the temperature of 2-8 ℃. PBST plate washing 3 times, spin off the hole liquid, clap to dry. Adding a sealing solution (PBS solution containing 0.1% Casein and 5% sucrose), sealing at 2-8 ℃ for 16-24 hours at 150 mu l/hole. And removing the sealing liquid, drying at room temperature (15-25 ℃) for 20-24 hours, then adding a drying agent, sealing in an aluminum foil bag, and storing at 2-8 ℃.

Assembling a kit: preparing prepared antigen coated plate, enzyme-labeled monoclonal antibody (HRP-labeled anti-IBRV monoclonal antibody, preservation number of hybridoma cell secreting the monoclonal antibody is CGMCC number 23005), sample diluent (PBS solution containing 1.5% BSA), PBST solid lotion, TMB color development liquid and stop solution (2M H)₂SO₄) And respectively and aseptically packaging, then completely packaging into the kit, and attaching a kit label on a kit shell.

The kit comprises the following steps:

(1) balancing: and taking the antigen coated plate out of the refrigeration environment, and keeping the antigen coated plate at room temperature to be balanced to room temperature (15-25 ℃) for use. Other liquid reagents were gently swirled or shaken well before use.

(2) Preparing a washing solution: 5g of PBST solid wash solution was completely dissolved with 500ml of purified water for use.

(3) Sample preparation: in a serum dilution plate, a sample to be detected is diluted by a sample diluent according to a ratio of 1: 2. Negative and positive controls (IBRV standard negative and positive sera) were used directly without dilution. Each sample should be mixed well before being added to the antigen coated plate.

(4) Sample adding: a negative control and a positive control are added to a serum dilution plate at 60 mu l/well, 60 mu l of diluted sample is added to a sample well, and 60 mu l of enzyme-labeled monoclonal antibody (0.5 mu g/ml) is added to each well. Shaking and mixing uniformly, sucking 100 mul of each well and transferring to a corresponding well of an antigen coated plate, wherein 92 samples can be detected by each plate, and 2 positive control wells and 2 negative control wells are arranged. After each sample application, the tip needs to be changed and the position of each sample on the plate is accurately recorded.

(5) And (3) incubation: incubate in a 37 ℃ incubator for 30 minutes.

(6) Washing the plate: and (4) discarding the liquid in each hole into a waste liquid cylinder, adding 280 microliters of washing liquid into each hole, discarding the washing liquid, and continuously washing for 5 times. After the last wash was discarded, the residual wash in the wells was patted dry on absorbent paper.

(7) Color development: a, B components of the color development liquid are uniformly mixed in equal proportion, and 100 mu l of the color development liquid is added into each hole. Incubate in a 37 ℃ incubator for 10 minutes.

(8) And (4) terminating: and adding 50 mu l of stop solution into each well to terminate the reaction.

(9) And (3) determination: the absorbance (OD) at 450nm of the sample and control sera were determined and recorded_450nmValue).

Determination of the cut-off value of the kit

460 parts of bovine serum samples (IBRV antibody negative serum 300 parts and IBRV antibody positive) are subjected to the kit according to the kit operation steps160 parts of sex serum) and determining the OD of all samples_450nmAnd calculating the S/N value. S/N value = sample OD_450nmValue/negative control OD_450nmAverage value. Negative control OD_450nmMean value (OD of negative control well No. 1)_450nmValue + OD of negative control well No.2_450nmValue)/2.

Based on the serum background result and the detection result of the kit, the SPSS 16.0 is adopted to analyze the corresponding relation between the S/N value and the sensitivity and the specificity of a detected sample (460 bovine serum samples), a ROC curve (figure 10) is drawn by taking true positive (sensitivity) as the ordinate and false positive rate (100-specificity) as the abscissa, and each point on the curve respectively represents the sensitivity and the specificity corresponding to the S/N value. And (3) evaluating the accuracy of the diagnosis method by taking the area value (AUC) under the ROC curve as a judgment standard. Under the condition that the AUC is larger than 0.5, the closer the AUC is to 1, the better the diagnosis effect is, the lower the accuracy of the AUC is between 0.5 and 0.7, the certain accuracy of the AUC is between 0.7 and 0.9, and the higher the accuracy of the AUC is above 0.9. According to the analysis of the ROC curve result, the Area value under the ROC curve corresponding to the detection result of 460 serum S/N values is 0.978, the standard error is 0.00556, the 95% confidence interval is 0.961-0.990, the Z statistic is 86.048, and the significance level P (Area = 0.5) <0.0001, which indicates that the detection method of the kit has high accuracy and can be used for determining the next critical value.

The tangent points with the maximum approximately exponential values are respectively used as the critical values of the S/N values. The Youden index (Youden) is a method for evaluating the authenticity of a screening test, the Youden index is the sum of sensitivity and specificity minus 1 and represents the total capability of a screening method for identifying a negative sample and a positive sample, and the larger the index is, the better the screening effect is, and the greater the authenticity is. The S/N value of each sample corresponding to the Yoden index is calculated, and the S/N value when the Yoden index is maximum is selected as the critical value of the method. As can be seen from Table 10, the maximum Johnson index is 0.909, which corresponds to an S/N value of 0.696, close to 0.7. Therefore, the critical value of the S/N value of the method is determined to be 0.7, and the judgment standard of the method is determined to be: if the S/N value is more than 0.7, judging the sample as IBRV antibody negative; if the S/N value is less than or equal to 0.7, the sample is judged to be positive by the IBRV antibody.

TABLE 10 sensitivity and specificity results for different S/N values

Standard (S/N value)	Sensitivity (%)	Specificity (%)	Joden index	Standard (S/N value)	Sensitivity (%)	Specificity (%)	Joden index
								<0.307	0	100	0.000	≤0.677	87.5	96	0.835
≤0.54	31.25	100	0.313	≤0.679	88.75	95.33	0.841
								≤0.542	31.87	99.67	0.315	≤0.681	90.62	95.33	0.860
≤0.596	51.88	99.67	0.516	≤0.683	90.62	95	0.856
								≤0.598	52.5	99.33	0.518	≤0.684	92.5	95	0.875
≤0.599	52.5	99	0.515	≤0.686	92.5	94.67	0.872
								≤0.605	55	99	0.540	≤0.696	96.25	94.67	0.909
≤0.607	55.63	98.67	0.543	≤0.711	96.25	92.33	0.886
								≤0.615	57.5	98.67	0.562	≤0.713	96.87	92.33	0.892
≤0.616	57.5	98.33	0.558	≤0.743	96.87	85.33	0.822
								≤0.624	59.38	98.33	0.577	≤0.744	97.5	84.33	0.818
≤0.625	59.38	97.67	0.571	≤0.758	97.5	81.33	0.788
								≤0.641	69.37	97.67	0.670	≤0.76	98.12	80.67	0.788
≤0.642	71.25	97.33	0.686	≤0.773	98.12	78	0.761
								≤0.645	75	97.33	0.723	≤0.774	98.75	78	0.768
≤0.646	75	97	0.720	≤0.786	98.75	74.67	0.734
								≤0.651	76.87	97	0.739	≤0.788	99.37	73.67	0.730
≤0.654	76.87	96.67	0.735	≤0.801	99.37	71.67	0.710
								≤0.659	78.75	96.67	0.754	≤0.803	100	71.67	0.717
≤0.661	78.75	96.33	0.751	≤1.825	100	0	0.000
								≤0.675	87.5	96.33	0.838

Example 4 Performance test of the IBRV competition ELISA antibody detection kit of the present invention

1. Sensitivity test

30 parts of IBRV antibody weak positive serum prepared, identified and stored by agriculture and forestry academy of sciences of Beijing are detected by using the IBRV competition ELISA antibody detection kit (the kit of the invention for short) prepared in the embodiment 3. As shown in Table 11, the S/N values of 29 serum samples were all 0.400 to 0.700, and only 1 serum sample had an S/N value of 0.722 and an S/N value of 0.700 to 0.750, and the positive rate of agreement with the neutralization test was 96.67%.

TABLE 11 detection results of 30 weak positive sera with the kit of the present invention

	Kit of the invention	Kit of the invention	Neutralization test
				Serum numbering	OD450nmValue of	S/N value	Potency of the drug
MP1	0.772	0.500	1:2
				MP2	0.864	0.560	1:4
MP3	0.760	0.493	1:4
				MP4	0.691	0.448	1:4
MP5	0.903	0.585	1:4
				MP6	0.833	0.540	1:4
MP7	0.899	0.583	1:4
				MP8	0.991	0.642	1:2
MP9	0.927	0.601	1:2
				MP10	0.985	0.639	1:2
MP11	0.805	0.522	1:2
				MP12	0.739	0.479	1:4
MP13	0.979	0.635	1:4
				MP14	1.027	0.666	1:4
MP15	1.027	0.666	1:4
				MP16	1.114	0.722	1:2
MP17	1.014	0.657	1:4
				MP18	0.932	0.604	1:4
MP19	1.002	0.650	1:8
				MP20	0.855	0.554	1:8
MP21	0.900	0.584	1:8
				MP22	0.945	0.612	1:8
MP23	1.014	0.657	1:8
				MP24	0.932	0.604	1:8
MP25	1.002	0.650	1:8
				MP26	0.855	0.554	1:8
MP27	0.900	0.584	1:8
				MP28	0.805	0.522	1:8
MP29	0.739	0.479	1:8
				MP30	0.979	0.635	1:8
NC`X	1.543
				PC`X	0.087

Note: S/N value-sample OD_450nmValue/negative control OD_450nmThe value is obtained. NC (numerical control)_{`X</sub>Represents a negative control (IBRV standard negative serum), PC<sub>`X}Represents a positive control (IBRV standard positive serum).

2. Consistency check

170 bovine infectious rhinotracheitis inactivated vaccine immune and non-immune serum samples collected in the field are detected by respectively adopting a neutralization experiment, the kit disclosed by the invention and an IDEXX bovine infectious rhinotracheitis virus (IBR) gB X3 antibody detection kit (IDEXX kit for short, product code 99-41299) of Edison corporation in America. The procedures of the kit of the invention are described in example 3, and the procedures of the IDEXX kit are described in the kit instructions.

The specific procedures for the neutralization experiment were as follows:

(1) MDBK cells were transferred to 96-well plates one day in advance to ensure that the cells for the assay were in log phase growth.

(2) The serum was inactivated in a 56 ℃ water bath for 30 minutes.

(3) Serum to be detected, IBRV standard negative serum and standard positive serum are sequentially diluted to 1:256 from 1:4 and 1:8 by serum-free DMEM, the serum to be detected and the standard negative and positive serum are respectively added into a hole of a 96-hole cell culture plate, each hole is 60 mu l, each group is repeated for 2 holes, and the serum to be detected is added in the last line to be used as serum toxicity control.

(4) Adding 200TCID per hole₅₀Mu.l of virus suspension/100. mu.l 60. mu.l. To the serotoxic control wells, 60 μ l serum-free DMEM was added instead of the virus diluent.

(5) 100TCID Using serum-free DMEM₅₀Mu.l of virus solution was serially diluted 3 times by 10 times, each dilution was 4 wells, and 60. mu.l of virus suspension was added to each well to make a virus regression control.

(6) Place the plates at 37 ℃ CO₂The incubator was neutralized for 1 hour.

(7) Pipette 100. mu.l of the solutionAdding the mixture into single-layer MDBK cells, incubating at 37 deg.C for 1 hr, replacing the liquid in the well with maintenance liquid, and adding CO at 37 deg.C₂The incubator was used for 4 days.

(8) Cytopathic conditions were observed with an inverted microscope. Check for regression titer, viral regression control at 100TCID ₅₀100 μ l and 10TCID₅₀Lesions appeared in 100. mu.l, 1TCID₅₀0TCID in half of the cells in 100. mu.l wells₅₀No cytopathic effect occurred in the/100. mu.l wells. The negative serum controls all showed cytopathic effects, and the serum toxicity controls showed no pathological effects.

The results are shown in Table 12, and the results of the neutralization test were 83 IBRV antibody-positive sera and 87 IBRV antibody-negative sera in 170 sera. The detection result of the kit provided by the invention is 77 parts of IBRV antibody positive serum and 93 parts of IBRV antibody negative serum; the detection result of the IDEXX kit is 80 parts of IBRV antibody positive serum and 90 parts of IBRV antibody negative serum.

TABLE 12 summary of results of the three methods on 170 clinical sera

		The kit of the invention	The kit of the invention	The kit of the invention	IDEXX kit	IDEXX kit	IDEXX kit	Neutralization test	Neutralization test
										Serum numbering	Test number	OD450nm	S/N	Determination	OD450nm	Blocking Rate (%)	Determination	Potency of the drug	Determination
2	1	0.961	0.601	+	0.001	99.93	+	1:16	+
										4	2	0.114	0.071	+	0.08	94.61	+	1:32	+
6	3	0.898	0.562	+	0.065	95.62	+	1:32	+
										7	4	0.945	0.591	+	0.021	98.58	+	1:8	+
9	5	0.303	0.190	+	0.045	96.97	+	1:8	+
										12	6	0.476	0.298	+	0.102	93.13	+	1:16	+
13	7	0.776	0.485	+	0.125	91.58	+	1:16	+
										14	8	0.678	0.424	+	0.065	95.62	+	1:8	+
16	9	0.411	0.257	+	0.112	92.45	+	1:8	+
										19	10	0.688	0.430	+	0.037	97.51	+	1:16	+
21	11	0.306	0.191	+	0.078	94.74	+	1:32	+
										28	12	1.028	0.643	+	0.156	89.49	+	1:16	+
30	13	0.272	0.170	+	0.037	97.51	+	1:8	+
										31	14	0.212	0.133	+	0.07	95.28	+	1:16	+
35	15	0.997	0.624	+	0.886	40.30	-	1:16	+
										37	16	1.079	0.675	+	0.105	92.92	+	1:16	+
40	17	0.845	0.528	+	0.013	99.12	+	1:8	+
										41	18	0.902	0.564	+	0.063	95.75	+	1:8	+
42	19	0.961	0.601	+	0.101	93.19	+	1:8	+
										43	20	0.343	0.215	+	0.124	91.64	+	1:8	+
44	21	0.992	0.62	+	0.267	82.01	+	1:16	+
										50	22	0.966	0.604	+	0.092	93.80	+	1:16	+
54	23	1.380	0.863	-	0.103	93.06	+	1:8	+
										57	24	0.215	0.135	+	0.099	93.33	+	1:8	+
58	25	0.153	0.096	+	0.155	89.56	+	1:8	+
										60	26	0.436	0.273	+	0.042	97.17	+	1:16	+
61	27	0.108	0.068	+	0.059	96.02	+	1:16	+
										66	28	1.340	0.838	-	0.086	94.20	+	1:8	+
67	29	0.586	0.367	+	0.167	88.75	+	1:8	+
										73	30	0.197	0.123	+	0.126	91.51	+	1:16	+
75	31	0.723	0.452	+	0.141	90.50	+	1:32	+
										76	32	0.469	0.293	+	0.066	95.55	+	1:16	+
77	33	1.367	0.855	-	0.035	97.64	+	1:8	+
										85	34	0.188	0.118	+	0.1	93.26	+	1:8	+
87	35	0.673	0.421	+	0.105	92.92	+	1:16	+
										90	36	0.787	0.492	+	0.048	96.77	+	1:32	+
92	37	1.049	0.656	+	0.932	37.20	-	1:8	+
										109	38	0.657	0.411	+	0.051	96.56	+	1:8	+
129	39	0.208	0.130	+	0.095	93.60	+	1:8	+
										141	40	0.495	0.309	+	0.021	98.58	+	1:16	+
165	41	0.734	0.459	+	0.055	96.29	+	1:16	+
										166	42	0.210	0.131	+	0.13	91.24	+	1:16	+
1022	43	0.554	0.347	+	0.134	90.97	+	1:8	+
										1238	44	0.251	0.157	+	0.11	92.59	+	1:16	+
1404	45	1.046	0.654	+	0.063	95.75	+	1:16	+
										1520	46	0.157	0.098	+	0.087	94.14	+	1:8	+
1613	47	0.285	0.178	+	0.187	87.40	+	1:32	+
										2003	48	0.700	0.438	+	0.026	98.25	+	1:8	+
2047	49	0.251	0.157	+	0.061	95.89	+	1:8	+
										2057	50	0.363	0.227	+	0.057	96.16	+	1:16	+
2085	51	0.440	0.275	+	0.044	97.04	+	1:16	+
										2275	52	0.581	0.363	+	0.126	91.51	+	1:16	+
3088	53	0.280	0.175	+	0.148	90.03	+	1:8	+
										4062	54	0.499	0.312	+	0.075	94.95	+	1:32	+
4063	55	0.387	0.242	+	0.129	91.31	+	1:16	+
										5084	56	0.280	0.175	+	0.063	95.75	+	1:16	+
5098	57	0.432	0.270	+	0.076	94.88	+	1:32	+
										6002	58	0.247	0.155	+	0.076	94.88	+	1:16	+
7013	59	1.602	1.002	-	0.067	95.49	+	1:8	+
										7101	60	0.974	0.609	+	0.028	98.11	+	1:8	+
7224	61	0.610	0.382	+	0.052	96.50	+	1:8	+
										8010	62	0.460	0.288	+	0.121	91.85	+	1:8	+
8044	63	0.129	0.081	+	0.109	92.65	+	1:16	+
										8054	64	1.515	0.947	-	0.211	85.78	+	1:16	+
8073	65	0.357	0.223	+	0.134	90.97	+	1:8	+
										9843	66	0.813	0.509	+	0.097	93.46	+	1:16	+
9846	67	0.693	0.434	+	0.089	94.00	+	1:16	+
										9847	68	0.978	0.612	+	0.091	93.87	+	1:16	+
11003	69	0.639	0.400	+	0.038	97.44	+	1:8	+
										13090	70	1.353	0.846	-	0.916	38.27	-	1:16	+
13125	71	0.804	0.503	+	0.956	35.58	-	1:4	+
										14063	72	0.499	0.312	+	0.132	91.11	+	1:8	+
14071	73	0.172	0.108	+	0.122	91.78	+	1:16	+
										15003	74	0.147	0.092	+	1.014	31.67	-	1:4	+
15032	75	0.362	0.226	+	0.038	97.44	+	1:32	+
										15081	76	0.129	0.081	+	0.138	90.70	+	1:16	+
16002	77	0.805	0.504	+	0.124	91.64	+	1:32	+
										16016	78	0.726	0.454	+	0.042	97.17	+	1:8	+
18013	79	0.553	0.346	+	0.056	96.23	+	1:8	+
										18044	80	1.052	0.658	+	0.156	89.49	+	1:16	+
30201	81	0.169	0.106	+	0.141	90.50	+	1:8	+
										130103	82	0.102	0.064	+	0.122	91.78	+	1:16	+
140103	83	1.040	0.650	+	0.084	94.34	+	1:32	+
											NC`X	1.599			0.156
	PC`X	0.114			1.484
										12210	84	1.464	0.947	-	0.916	33.58	-	<1:2	-
140959	85	1.340	0.867	-	1.254	9.06	-	<1:2	-
										141176	86	1.602	1.036	-	1.356	1.67	-	<1:2	-
141283	87	1.561	1.010	-	1.121	18.71	-	<1:2	-
										141284	88	1.413	0.914	-	2.011	-45.83	-	<1:2	-
140957	89	1.467	0.949	-	1.548	-12.26	-	<1:2	-
										140950	90	1.439	0.931	-	1.322	4.13	-	<1:2	-
140637	91	1.387	0.897	-	1.755	-27.27	-	<1:2	-
										131058	92	1.385	0.896	-	1.246	9.64	-	<1:2	-
140526	93	1.402	0.907	-	1.255	8.99	-	<1:2	-
										140216	94	1.390	0.899	-	1.547	-12.18	-	<1:2	-
141063	95	1.534	0.992	-	0.987	28.43	-	<1:2	-
										141061	96	1.532	0.991	-	1.011	26.69	-	<1:2	-
140528	97	1.504	0.973	-	1.211	12.18	-	<1:2	-
										130845	98	1.484	0.960	-	1.855	-34.52	-	<1:2	-
141064	99	1.393	0.901	-	1.644	-19.22	-	<1:2	-
										141072	100	1.303	0.843	-	1.211	12.18	-	<1:2	-
140740	101	1.381	0.893	-	1.512	-9.64	-	<1:2	-
										140954	102	1.357	0.878	-	1.714	-24.29	-	<1:2	-
140846	103	1.555	1.006	-	2.135	-54.82	-	<1:2	-
										140744	104	1.342	0.868	-	1.254	9.06	-	<1:2	-
140211	105	1.354	0.876	-	2.312	-67.66	-	<1:2	-
										140738	106	1.328	0.859	-	1.257	8.85	-	<1:2	-
140531	107	1.413	0.914	-	1.354	1.81	-	<1:2	-
										140324	108	1.486	0.961	-	1.456	-5.58	-	<1:2	-
141064	109	1.289	0.834	-	1.512	-9.64	-	<1:2	-
										140212	110	1.532	0.991	-	1.611	-16.82	-	<1:2	-
140953	111	1.510	0.977	-	0.879	36.26	-	<1:2	-
										141178	112	1.379	0.892	-	0.917	33.50	-	<1:2	-
140742	113	1.514	0.979	-	0.988	28.35	-	<1:2	-
										140847	114	1.325	0.857	-	1.022	25.89	-	<1:2	-
140323	115	1.379	0.892	-	1.331	3.48	-	<1:2	-
										140845	116	1.294	0.837	-	1.451	-5.22	-	<1:2	-
130316	117	1.285	0.831	-	1.254	9.06	-	<1:2	-
										140741	118	1.469	0.950	-	1.578	-14.43	-	<1:2	-
140848	119	1.537	0.994	-	2.344	-69.98	-	<1:2	-
										141074	120	1.404	0.908	-	2.125	-54.10	-	<1:2	-
141177	121	1.402	0.907	-	1.877	-36.11	-	<1:2	-
										141068	122	1.362	0.881	-	0.589	57.29	+	<1:2	-
140957	123	1.394	0.902	-	1.325	3.92	-	<1:2	-
										140847	124	1.252	0.810	-	1.244	9.79	-	<1:2	-
141073	125	1.248	0.807	-	1.325	3.92	-	<1:2	-
										140323	126	1.399	0.905	-	1.466	-6.31	-	<1:2	-
131273	127	1.450	0.938	-	1.754	-27.19	-	<1:2	-
										141067	128	1.221	0.790	-	1.854	-34.45	-	<1:2	-
140212	129	1.323	0.856	-	1.111	19.43	-	<1:2	-
										140743	130	1.390	0.899	-	1.225	11.17	-	<1:2	-
140213	131	1.512	0.978	-	1.362	1.23	-	<1:2	-
										140322	132	1.421	0.919	-	2.131	-54.53	-	<1:2	-
140528	133	1.356	0.877	-	1.332	3.41	-	<1:2	-
										140530	134	1.401	0.906	-	1.521	-10.30	-	<1:2	-
160211	135	1.425	0.922	-	1.422	-3.12	-	<1:2	-
										141282	136	1.258	0.814	-	1.058	23.28	-	<1:2	-
140320	137	1.271	0.822	-	1.023	25.82	-	<1:2	-
										140738	138	1.305	0.844	-	1.211	12.18	-	<1:2	-
140949	139	1.492	0.965	-	2.023	-46.70	-	<1:2	-
										140214	140	1.422	0.920	-	1.741	-26.25	-	<1:2	-
0094	141	1.325	0.857	-	0.457	66.86	+	<1:2	-
										141177	142	1.374	0.889	-	1.212	12.11	-	<1:2	-
140739	143	1.430	0.925	-	1.352	1.96	-	<1:2	-
										141176	144	1.391	0.900	-	1.443	-4.64	-	<1:2	-
120318	145	1.146	0.741	-	1.521	-10.30	-	<1:2	-
										141062	146	1.189	0.769	-	1.110	19.51	-	<1:2	-
121276	147	1.521	0.984	-	1.212	12.11	-	<1:2	-
										140958	148	1.152	0.745	-	1.312	4.86	-	<1:2	-
140848	149	1.343	0.869	-	1.412	-2.39	-	<1:2	-
										141109	150	1.364	0.882	-	1.354	1.81	-	<1:2	-
140954	151	1.362	0.881	-	1.452	-5.29	-	<1:2	-
										160420	152	1.390	0.899	-	1.033	25.09	-	<1:2	-
140527	153	1.197	0.774	-	1.152	16.46	-	<1:2	-
										140739	154	1.429	0.924	-	1.789	-29.73	-	<1:2	-
140529	155	1.275	0.825	-	0.966	29.95	-	<1:2	-
										141074	156	1.262	0.816	-	1.854	-34.45	-	<1:2	-
140317	157	1.218	0.788	-	1.254	9.06	-	<1:2	-
										140320	158	1.374	0.889	-	1.311	4.93	-	<1:2	-
150754	159	1.501	0.971	-	1.454	-5.44	-	<1:2	-
										140215	160	1.313	0.849	-	1.789	-29.73	-	<1:2	-
140636	161	1.323	0.856	-	0.945	31.47	-	<1:2	-
										141067	162	1.289	0.834	-	0.997	27.70	-	<1:2	-
141181	163	1.326	0.858	-	0.965	30.02	-	<1:2	-
										140637	164	1.257	0.813	-	1.022	25.89	-	<1:2	-
150113	165	1.268	0.820	-	1.139	17.40	-	<1:2	-
										141066	166	1.353	0.875	-	1.195	13.34	-	<1:2	-
121170	167	1.636	1.058	-	1.321	4.21	-	<1:2	-
										8946	168	1.484	0.960	-	1.411	-2.32	-	<1:2	-
131054	169	1.331	0.861	-	1.522	-10.37	-	<1:2	-
										120426	170	1.509	0.976	-	1.541	-11.75	-	<1:2	-
	NC	1.546			0.124
											PC	0.105			1.379

Note: the judgment standard of the detection result of the kit of the invention is as follows: if the S/N value is more than 0.7, the sample is judged to be IBRV antibody negative; if the S/N value is less than or equal to 0.7, the sample is judged to be positive by the IBRV antibody. Determination standard of IDEXX kit detection result: the blocking rate is less than 45 percent, and the IBRV antibody is negative; the blocking rate is more than 55 percent and more than or equal to 45 percent, which is suspicious; the blocking rate is more than or equal to 55, and the IBRV antibody is positive. S/N value-sample OD_450nmValue/negative control OD_450nmThe value is obtained. NC (numerical control)_{`X</sub>And NC represents negative control (IBRV standard negative serum), PC<sub>`X}And PC for positive control (IBRV standard positive serum).

The kit of the invention compares the detection results of the neutralization test: the kit of the invention detects 77 positives, of which 77 are consistent with the neutralization test; 93 negatives were detected, of which 87 were consistent with the neutralization assay (Table 12). Thus, the total compliance rate of the kit of the present invention with the neutralization test was 96.47%, wherein the positive compliance rate was 92.77% and the negative compliance rate was 100% (see table 13 for statistical results).

TABLE 13 compliance of the kits of the invention with the neutralization test

		Neutralization test	Neutralization test	Total up to
							+	-
Kit of the invention	+	77	0	77
					Kit of the invention	-	6	87	93
Total of		83	87	170
					Positive rate of agreement				92.77%=(77/83)×100%
Negative rate of agreement				100%=(87/87)×100%
					Total rate of agreement				96.47%=（77+87）/170×100%

Comparison of the detection results of IDEXX kit with the neutralization assay: the IDEXX kit detects 80 positives, 78 of which are consistent with the neutralization test; 90 negatives were detected, 85 of which were consistent with the neutralization assay (Table 12). Therefore, the IDEXX kit has a total compliance rate of 95.88% with the neutralization test, wherein the positive compliance rate is 93.98% and the negative compliance rate is 97.70% (see table 14 for statistical results).

TABLE 14 IDEXX kit compliance with neutralization test

		Neutralization test	Neutralization test	Total up to
							+	-
IDEXX kit	+	78	2	80
					IDEXX kit	-	5	85	90
Total of		83	87	170
					Positive rate of agreement				93.98%=(78/83)×100%
Negative rate of agreement				97.70%=(85/87)×100%
					Total rate of agreement				95.88%=（78+85）/170×100%

Comparison of the kit of the invention with the IDEXX kit: in 170 detected serums, 73 positive parts and 86 negative parts are jointly detected by the two kits, the positive coincidence rate of the kit disclosed by the invention and the IDEXX kit is 91.25%, the negative coincidence rate is 95.56%, and the total coincidence rate is 93.53% (table 15).

TABLE 15 coincidence rate between the kit of the present invention and IDEXX kit

		IDEXX kit	IDEXX kit	Total up to
							+	-
Kit of the invention	+	73	4	77
					Kit of the invention	-	7	86	93
Total up to		80	90	170
					Positive rate of agreement				91.25%=(73/80)×100%
Negative rate of agreement				95.56%=(86/90)×100%
					Total rate of agreement				93.53%=（73+86）/170×100%

3. Sensitivity test

The IBRV standard positive serum is diluted according to the ratio of 1:8, 1:16, 1:32, 1:64, 1:128, 1:256, 1:512 and 1:1024, the standard positive serum of each dilution is detected by the kit and the IDEXX kit according to the instructions, and the standard positive serum of 1:2, 1:4, 1:8, 1:16, 1:32, 1:64 and 1:128 dilutions is detected by a neutralization test to determine the sensitivity of the kit. As a result, as shown in Table 16, the dilution of 1:256, the dilution of 1:128 and the dilution of 1:32 were detected in the IDEXX kit and the neutralization test, respectively, in the kit of the present invention.

TABLE 16 kit sensitivity test

	The kit of the invention	The kit of the invention	IDEXX kit	IDEXX kit	Neutralization test
						Dilution factor	OD450nm	S/N	OD450nm	Blocking ratio%	The result of the detection
1:2	/	/	/	/	+
						1:4	/	/	/	/	+
1:8	0.145	0.092	0.067	95.33	+
						1:16	0.189	0.120	0.208	85.49	+
1:32	0.291	0.185	0.312	78.22	+
						1:64	0.419	0.266	0.496	65.44	-
1:128	0.655	0.416	0.626	56.34	-
						1:256	0.881	0.560	0.872	39.18	/
1:512	1.204	0.765	0.939	34.55	/
						1:1024	1.272	0.808	1.173	18.22	/
NC`X	1.574	/	0.103	/	/
						PC`X	0.103	/	1.434	/	/

Note: the judgment standard of the detection result of the kit of the invention is as follows: if the S/N value is more than 0.7, the sample is judged to be IBRV antibody negative; if the S/N value is less than or equal to 0.7, the sample is judged to be positive by the IBRV antibody. The judgment standard of the detection result of the IDEXX kit; the blocking rate is less than 45 percent, and the IBRV antibody is negative; the blocking rate is more than 55 percent and more than or equal to 45 percent, which is suspicious; the blocking rate is more than or equal to 55, and the IBRV antibody is positive. Detection results of neutralization assay: "+" indicates that the dilution was capable of neutralizing the virus; "-" indicates that the dilution failed to neutralize the virus. S/N value-sample OD_450nmValue/negative control OD_450nmThe value is obtained. NC (numerical control)_`XRepresents a negative control (IBRV standard negative serum), PC_XRepresents a positive control (IBRV standard positive serum).

Sequence listing

<110> agriculture and forestry academy of sciences of Beijing City

<120> competitive ELISA antibody detection kit for infectious bovine rhinotracheitis virus and application thereof

<130> P210373-NLK

<160> 7

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1470

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

ggcgccggag acggtcggcg aggacagcgt cgtcatctac gaccgggacg tgttctcgct 60

gctctacgcg gtcctgcagc gcctggcgcc ggcggggcgc gcgccgcgct agccgctgcc 120

ctgctatggg cgacgtgggc cctgctgctg gcggcgcccg ccgcggggcg accggcgaca 180

acgcccccgg cgcccccgcc cgaagaggcc gcgagcccgg cgccccccgc gagccccagc 240

ccccccggcc ccgacggcga cgacgccgcc agccccgaca acagcacaga cgtgcgcgcc 300

gcgctccggc tcgcgcaggc ggccggggaa aactcgcgct tcttcgtgtg cccgccgccc 360

tcgggcgcca cggtggtccg gctcgcgccc gcgcggccgt gccctgagta cgggctcggg 420

cggaactaca cggagggcat cggcgtcatt tacaaggaga acatcgcgcc gtacacgttc 480

aaggcctaca tttacaaaaa cgtgatcgtg accacgacct gggcgggcag cacgtacgcg 540

gccattacaa accagtacac ggaccgcgtg cccgtgggca tgggcgagat cacggacctg 600

gtggacaaga agtggcgctg cctttcgaaa gccgagtacc tgcgcagcgg gcgcaaggtg 660

gtggcctttg accgcgacga cgacccctgg gaggcgccgc tgaagcctgc gcggctgagc 720

gcgcccgggg tgcggggctg gcacacgacg gacgatgtgt acacggcgct gggctcggcg 780

gggctctacc gcacgggcac ctctgtgaac tgcatcgtgg aagaagtgga ggcgcgctcg 840

gtgtacccgt acgactcgtt cgcgctctcg accggggaca ttatctacat gtcgcccttt 900

tacgggctgc gcgagggcgc gcaccgcgag cacaccagct actcgccgga gcgcttccag 960

cagatcgagg gctactacaa gcgcgacatg gccacgggcc ggcgcctcaa ggagccggtc 1020

tcgcggaact ttttgcgtac acagcacgtg acggtagcct gggactgggt gcccaagcgc 1080

aaaaacgtgt gctcgctggc caagtggcgc gaggcggacg aaatgctgcg agacgagagc 1140

cgcgggaact tccgcttcac ggcccgctcg ctctcggcga cctttgtgag cgacagccac 1200

accttcgcgt tgcagaatgt gccgctgagc gactgcgtga tcgaagaggc cgaggccgcg 1260

gtcgagcgcg tctaccgcga gcgctacaac ggcacgcacg tgctgtcggg cagcttggag 1320

acgtacctgg cgcgcggcgg ctttgtcgtg gccttccggc cgatgctcag caacgagctg 1380

gccaagctgt acctgcagga gctggcgcgc tcgaacggca cgctcgaggg gctgttcgcc 1440

gccgcggcgc ccaagccggg cccgcggcgc 1470

<210> 2

<211> 490

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 2

Gly Ala Gly Asp Gly Arg Arg Gly Gln Arg Arg His Leu Arg Pro Gly

1 5 10 15

Arg Val Leu Ala Ala Leu Arg Gly Pro Ala Ala Pro Gly Ala Gly Gly

20 25 30

Ala Arg Ala Ala Leu Ala Ala Ala Leu Leu Trp Ala Thr Trp Ala Leu

35 40 45

Leu Leu Ala Ala Pro Ala Ala Gly Arg Pro Ala Thr Thr Pro Pro Ala

50 55 60

Pro Pro Pro Glu Glu Ala Ala Ser Pro Ala Pro Pro Ala Ser Pro Ser

65 70 75 80

Pro Pro Gly Pro Asp Gly Asp Asp Ala Ala Ser Pro Asp Asn Ser Thr

85 90 95

Asp Val Arg Ala Ala Leu Arg Leu Ala Gln Ala Ala Gly Glu Asn Ser

100 105 110

Arg Phe Phe Val Cys Pro Pro Pro Ser Gly Ala Thr Val Val Arg Leu

115 120 125

Ala Pro Ala Arg Pro Cys Pro Glu Tyr Gly Leu Gly Arg Asn Tyr Thr

130 135 140

Glu Gly Ile Gly Val Ile Tyr Lys Glu Asn Ile Ala Pro Tyr Thr Phe

145 150 155 160

Lys Ala Tyr Ile Tyr Lys Asn Val Ile Val Thr Thr Thr Trp Ala Gly

165 170 175

Ser Thr Tyr Ala Ala Ile Thr Asn Gln Tyr Thr Asp Arg Val Pro Val

180 185 190

Gly Met Gly Glu Ile Thr Asp Leu Val Asp Lys Lys Trp Arg Cys Leu

195 200 205

Ser Lys Ala Glu Tyr Leu Arg Ser Gly Arg Lys Val Val Ala Phe Asp

210 215 220

Arg Asp Asp Asp Pro Trp Glu Ala Pro Leu Lys Pro Ala Arg Leu Ser

225 230 235 240

Ala Pro Gly Val Arg Gly Trp His Thr Thr Asp Asp Val Tyr Thr Ala

245 250 255

Leu Gly Ser Ala Gly Leu Tyr Arg Thr Gly Thr Ser Val Asn Cys Ile

260 265 270

Val Glu Glu Val Glu Ala Arg Ser Val Tyr Pro Tyr Asp Ser Phe Ala

275 280 285

Leu Ser Thr Gly Asp Ile Ile Tyr Met Ser Pro Phe Tyr Gly Leu Arg

290 295 300

Glu Gly Ala His Arg Glu His Thr Ser Tyr Ser Pro Glu Arg Phe Gln

305 310 315 320

Gln Ile Glu Gly Tyr Tyr Lys Arg Asp Met Ala Thr Gly Arg Arg Leu

325 330 335

Lys Glu Pro Val Ser Arg Asn Phe Leu Arg Thr Gln His Val Thr Val

340 345 350

Ala Trp Asp Trp Val Pro Lys Arg Lys Asn Val Cys Ser Leu Ala Lys

355 360 365

Trp Arg Glu Ala Asp Glu Met Leu Arg Asp Glu Ser Arg Gly Asn Phe

370 375 380

Arg Phe Thr Ala Arg Ser Leu Ser Ala Thr Phe Val Ser Asp Ser His

385 390 395 400

Thr Phe Ala Leu Gln Asn Val Pro Leu Ser Asp Cys Val Ile Glu Glu

405 410 415

Ala Glu Ala Ala Val Glu Arg Val Tyr Arg Glu Arg Tyr Asn Gly Thr

420 425 430

His Val Leu Ser Gly Ser Leu Glu Thr Tyr Leu Ala Arg Gly Gly Phe

435 440 445

Val Val Ala Phe Arg Pro Met Leu Ser Asn Glu Leu Ala Lys Leu Tyr

450 455 460

Leu Gln Glu Leu Ala Arg Ser Asn Gly Thr Leu Glu Gly Leu Phe Ala

465 470 475 480

Ala Ala Ala Pro Lys Pro Gly Pro Arg Arg

485 490

<210> 3

<211> 1470

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

ggcgccggag acggtcggtg aagactcagt ggttatctat gatagagacg tgtttagcct 60

cctgtacgct gtcctgcagc gcctggctcc tgccggcaga gctccacgtt aacctctgcc 120

atgttacggt cgcagaggtc cgtgctgctg gagaagaccg ccgagaggag acagacgtca 180

gcgccctaga cgaccacgtc cgaaaagacc aagggctaga agacccccac gtgccccggc 240

ccctcctgcc ccgaccgcta caactccgcc tgccccgaca actgcccaga cgtgcgcccc 300

aagaagcgga agtagaagaa gacctggaaa gacaagagct agttcatgcg ctagaagacc 360

aagagctcca cgctggtcag gctcccgccc tagaggcaga gctctgagta cgggttctgg 420

tggaacaact aggagagcta gtgcaagctt cacgagaaga acaagcagaa gaacaagatc 480

aagaccaaca tttactaaaa cctaaagcta accaaggccg ggtagggctg cgagaacaag 540

acccttgcaa acttcaacaa gaactgcttg cccctgggct tgggcaagaa gcagaacatg 600

gtggacacgc tcaggggcag cttttagaaa accgtctaca tgtgctgctg gtgcacgctg 660

gtggcctttg acagctacta ccacgccagg ccgcagaagg taatccctgc gaggctaagc 720

gagaccaggc tgcggagctg gaacgagacg caccatgtgt actcgcagat gggctcgtag 780

aggatccaca gcaagagccc cattgtaaac agcaagctgg aagaaatgga ggcgtgctag 840

atgcacaaga actacgcgct caaggtccag gcccggaacc ttatctacct gtagaccgtt 900

cacaggttgt gctcgtgctc gtacagcctc aactcctgct acaagaagat ccgcctccag 960

cagatctcgc gctacaacct cagctacatg gccaagagct ggagcttcgc gtagcagaag 1020

cagaggcaca ttctgcgttc actcgactta acgctaaccg ggaacgggat gcccgtctgc 1080

taaaacctgc gctcgttggc cttccggtgc caggcgcacg aaatgctgtg aaaccagagc 1140

cgctggcact tcagctagcc gtcctgctag atcaagaaga ccgctgtagg ccacagctac 1200

tccgtcccgc tgcagaatgt gtagataagc tactgcttaa tctaaacgtc cgagacctcg 1260

cagttcagct tccacggcta gcgctaccac cgcgagaacg tgctgtcgtg cggcttggag 1320

aagaacctgg agagctgctg ctctgtcatg gccgtctgga cgctgctctg ccacgtcatg 1380

gccctcttgt acatgtaggt cgtggcgtgc tcgaacggca cgctcgaggg gctgttcgcc 1440

gccgcggcgc ccaagccggg cccgcggcgc 1470

<210> 4

<211> 42

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

cggcgcattc tgcctttgcg catatgggcg ccggagacgg tc 42

<210> 5

<211> 43

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

cttgtggtgg tggtggtggt gctcgaggcg ccgcgggccc ggc 43

<210> 6

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

agcggataac aatttcacac agg 23

<210> 7

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

cccagtcacg acgttgtaaa acg 23

Claims (10)

1. The monoclonal antibody of the anti-infectious bovine rhinotracheitis virus is secreted by hybridoma cells with the preservation number of CGMCC number 23005.

2. A hybridoma cell strain secreting the monoclonal antibody of claim 1, having a collection number of CGMCC number 23005.

3. An antibody detection kit for infectious bovine rhinotracheitis virus comprising the monoclonal antibody against infectious bovine rhinotracheitis virus according to claim 1.

4. The kit of claim 3, wherein: the kit also comprises truncated infectious bovine rhinotracheitis virus gB protein, and the amino acid sequence of the truncated infectious bovine rhinotracheitis virus gB protein is shown as SEQ ID NO. 2.

5. The kit of claim 4, wherein: the kit also comprises an enzyme label plate; the truncated bovine infectious rhinotracheitis virus gB protein is coated on an enzyme label plate in advance or coated on the enzyme label plate before use.

6. The kit of claim 5, wherein: the coating amount of the truncated bovine infectious rhinotracheitis virus gB protein on the ELISA plate is 0.1-5 mu g/hole; the working concentration of the monoclonal antibody is 0.2-2 mug/mL.

7. The kit of claim 6, wherein: the kit further comprises an antigen coating solution; the antigen coating solution is 0.02mol/L, pH value of 6.5 +/-0.2 phosphate buffer solution.

8. The kit of claim 6, wherein: the kit further comprises a blocking solution; the blocking solution was a PBS solution containing 0.1% Casein and 5% sucrose.

9. The kit of claim 6, wherein: the kit further comprises a sample diluent; the sample dilution was 1.5% BSA in PBS.

10. A method for detecting antibodies against infectious bovine rhinotracheitis virus for non-diagnostic purposes, comprising: the use of the kit according to any one of claims 4 to 9 for detection, comprising the steps of:

(1) coating the truncated bovine infectious rhinotracheitis virus gB protein on an enzyme label plate by using a phosphate buffer solution with the value of 0.02mol/L, pH of 6.5 +/-0.2, wherein the coating amount is 0.1-5 mu g/hole, and incubating; washing an enzyme label plate;

(2) adding PBS solution containing 0.1% Casein and 5% sucrose, and sealing; washing an enzyme label plate;

(3) setting a sample hole, a negative control hole and a positive control hole; diluting a sample to be detected by using a PBS (phosphate buffer solution) containing 1.5% BSA (bovine serum albumin) according to a ratio of 1:2, and adding the sample to a sample hole; adding an enzyme-labeled monoclonal antibody solution with the concentration of 0.2-2 mug/mL into all the holes, and incubating; washing an enzyme label plate;

(4) adding a color development solution, and incubating;

(5) adding a stop solution, slightly and uniformly mixing, and reading a light absorption value at 450nm in an enzyme-linked immunosorbent assay;

(6) the S/N value, which is the OD of the sample well, was calculated_450nmvalue/OD of negative control well_450nmA value; if the S/N value is more than 0.7, the sample does not contain the antibody of the infectious bovine rhinotracheitis virus; if the S/N value is less than or equal to 0.7, the sample contains the antibody of the infectious bovine rhinotracheitis virus.

Images