CN112979789B - Blocking ELISA kit for detecting neutralizing antibody of infectious bovine rhinotracheitis virus and application thereof - Google Patents

Abstract

The invention relates to detection of a neutralizing antibody of infectious bovine rhinotracheitis virus, in particular to a blocking ELISA kit for detecting the neutralizing antibody of the infectious bovine rhinotracheitis virus and application thereof. The invention provides a monoclonal antibody with neutralizing activity for resisting infectious bovine rhinotracheitis virus, which is secreted by hybridoma with the preservation number of CGMCC No. 21015. Also provided is a kit for detecting neutralizing antibodies to infectious bovine rhinotracheitis virus, comprising the monoclonal antibody. The invention establishes a blocking ELISA method for detecting the neutralizing antibody of the infectious bovine rhinotracheitis virus based on the monoclonal antibody and the truncated gD protein designed by the invention, and has the advantages of strong specificity, high sensitivity and good repeatability.

Description

Blocking ELISA kit for detecting neutralizing antibody of infectious bovine rhinotracheitis virus and application thereof

Technical Field

The invention relates to detection of a neutralizing antibody of infectious bovine rhinotracheitis virus, in particular to a blocking ELISA kit for detecting the neutralizing antibody of the infectious bovine rhinotracheitis virus and application thereof.

Background

Infectious Bovine Rhinotracheitis (IBR) is a febrile, acute and very latent Infectious disease caused by infection with Infectious Bovine Rhinotracheitis Virus (IBRV). Since Miller first reported the disease in the United states in 1995, IBR has assumed a global epidemic situation, which causes enormous economic losses to the world cattle industry. The main hazard of the IBRV is that the virus can potentially infect ganglia of a host after invading the host, so that the sick cattle are finally infected with the virus, and great challenge is brought to the prevention and control of the disease. In view of its harmfulness, the world animal health Organization (OIE) ranks it as a B-type infectious disease, and China also ranks it as a second-type infectious disease. Clinical diagnosis is an essential means for assessing immune efficacy, monitoring the health of cattle and diagnosing disease, and therefore, research related to the enhancement of diagnostic techniques is imperative and also crucial.

In order to effectively prevent and control IBR, various IBRV diagnostic techniques are available, which can be mainly summarized into etiological diagnosis and serological detection, wherein the serological detection is the most widely applied diagnostic technique. The serological detection technology mainly comprises a neutralization test, ELISA and the like. The neutralization test is honored as the gold standard for diagnosing IBR in a laboratory, but the method has the defects of long test period, complex operation, low safety and the like. In contrast, ELISA has advantages of high sensitivity, high specificity, rapidity, simplicity, and the like, and is favored by a large number of diagnostic developers. Among the ELISA techniques, OIE recommends blocking ELISA methods. The existing ELISA kit can detect IBRV antibody, but cannot detect IBRV neutralizing antibody, so that the existing ELISA kit cannot replace the neutralizing test. In order to rapidly and accurately evaluate the disease resistance and vaccine immune effect of animals, the development of an ELISA kit capable of detecting IBRV neutralizing antibodies is urgently needed.

Disclosure of Invention

Aiming at the IBR prevention and control requirements, a gD gene sequence of IBRV is analyzed, a truncated gD gene is designed, an insect cell-baculovirus expression system is adopted for efficient secretion expression, a truncated gD protein is obtained, and the truncated gD protein is used for screening to obtain the anti-IBRV monoclonal antibody with the neutralizing activity.

The invention provides a monoclonal antibody with neutralizing activity for resisting infectious bovine rhinotracheitis virus, which is secreted by hybridoma with the preservation number of CGMCC number 21015.

The invention also provides a hybridoma cell strain secreting the monoclonal antibody, and the preservation number of the hybridoma cell strain is CGMCC number 21015.

The invention also provides a kit for detecting the neutralizing antibody of the infectious bovine rhinotracheitis virus, which comprises the monoclonal antibody with neutralizing activity for resisting the infectious bovine rhinotracheitis virus.

Preferably, the kit also comprises a truncated gD protein of the infectious bovine rhinotracheitis virus, and the amino acid sequence of the truncated gD protein is shown as SEQ ID NO. 2.

Preferably, the kit further comprises an elisa plate; the truncated gD protein is pre-coated on an ELISA plate or coated on an ELISA plate just before use.

Preferably, the coating amount of the truncated gD protein on the ELISA plate is 0.25-0.5 mu g/hole.

Preferably, the coating solution of the truncated gD protein is Tris-HCl buffer, pH8.5, at 0.1M.

Preferably, the working concentration of the monoclonal antibody is 0.54-2.15 mu g/mL.

Preferably, the kit further comprises a blocking solution, a washing solution, a developing solution and a stop solution; the confining liquid is 5% chicken serum.

The truncated gD protein is used as a coating antigen, the monoclonal antibody is used as a detection antibody, and a blocking ELISA method for detecting a neutralizing antibody of the infectious bovine rhinotracheitis virus is established by optimizing the antigen coating amount, the coating condition, the blocking condition, the antibody using amount and the serum dilution and determining the test establishment condition and the cut-off value of the test. The method comprises the following steps: (1) dissolving the truncated gD protein by using 0.1M Tris-HCL buffer solution with the pH value of 8.5, then adding the solution into an ELISA plate, and incubating, wherein the protein coating amount is 0.25-0.5 mu g/hole; washing an enzyme label plate; (2) adding 5% chicken serum, and sealing; washing an enzyme label plate; (3) diluting a serum sample to be detected by 2 times, adding the diluted serum sample into an enzyme label plate, and incubating; washing an enzyme label plate; (4) making the monoclonal antibody carry a color mark, preparing an antibody solution with the concentration of 0.54-2.15 mu g/mL, adding the antibody solution into an ELISA plate, and incubating; washing an enzyme label plate; (5) adding a color development liquid for color development; (6) adding a stop solution, slightly and uniformly mixing, and reading a light absorption value at 450nm in an enzyme-linked immunosorbent assay; (7) the ratio of the OD450 of the sample well to the OD450 of the negative control well is the S/N value; if the S/N value is more than or equal to 0.885, the sample does not contain the antibody of the infectious bovine rhinotracheitis virus; if the S/N value is less than 0.885, the sample contains antibody of bovine infectious rhinotracheitis virus.

In the development process of the blocking ELISA method, the reconstruction of a plurality of gD proteins is tried, protein expression is respectively carried out on 22-588bp, 363-1050bp and 543-1251bp of an IBRV gD gene (GenBank accession number: MH 751901.1) in the early stage of an experiment, the indirect Elisa method is used for detecting the three proteins, and the result shows that the three proteins can not completely distinguish standard positive serum and standard negative serum of the IBRV. Through continuous modification and screening, truncated gD protein with amino acid sequence as shown in SEQ ID No.2 is finally obtained, and the protein can accurately distinguish standard positive serum and standard negative serum of IBRV. We then used the truncated gD protein to screen out monoclonal antibodies with neutralizing activity that can be paired with the truncated gD protein for the detection of IBRV antibodies by blocking ELISA. The number of the hybridoma cell strain secreting the monoclonal antibody is 3E8, and the preservation number is CGMCC number 21015.

The kit and the blocking ELISA method provided by the invention have the following advantages:

(1) the specificity is strong: by adopting the monoclonal antibody and the truncated gD protein (also called as recombinant gD protein), the positive sera of the bovine Brucella, the bovine foot-and-mouth disease, the bovine paratuberculosis, the bovine viral diarrhea and the IBRV antibody are detected by a blocking ELISA method, and the result shows that the rest 4 sera except the IBRV show obvious negative reactions, which shows that the monoclonal antibody has no cross reaction with the 4 pathogens and good specificity.

(2) The sensitivity is good: by adopting the monoclonal antibody and the recombinant gD protein, 40 parts of serum and 30 parts of clinical infection IBRV positive serum in a sample disc are detected by a blocking ELISA method, the positive detection rate is 100%, and the negative detection rate is 100%.

(3) The sensitivity is high: the IBRV antibody positive serum is diluted according to the ratio of 1:8, 1:16, 1:32, 1:64, 1:128, 1:256, 1:512 and 1:1024, and the diluted IBRV antibody positive serum is respectively detected by adopting the blocking ELISA method and the neutralization test. The method of the invention can detect that 1:256 dilutions, neutralization assay detected 1: dilution of 32.

(4) The repeatability is good: the blocking ELISA method of the invention is used for repeatedly detecting 5 parts of serum between the same ELISA plate and three different ELISA plates. The variation coefficient of S/N values among batches is 2.69-8.3%, the average value is 4.16%, the variation coefficient of S/N values in batches is 2.9-4.6%, and the average value is 3.64%.

(5) The consistency with other methods is good: 715 bovine sera were tested using the neutralization assay, the blocking ELISA method of the invention and the american IDEXX IBRV gE antibody test kit, respectively. The total compliance of the method of the invention with the commercial kit was 93.85% and the total compliance with the neutralization test was 99.58%.

The kit provided by the invention can be used for detecting the IBRV neutralizing antibody by a blocking ELISA method, and can replace a neutralization test to become a new method for quickly and sensitively evaluating the vaccine immune effect. The serum of 59 healthy immune cattle collected from different immune stages in a geodetic cattle farm in Beijing is respectively subjected to neutralization test and blocking ELISA method detection, and the relation between the neutralization titer of the serum and the S/N value of the blocking ELISA method is compared to establish a functional relation formula of the S/N value of the blocking ELISA and the neutralization titer log2 value of the serum: y = 9.3161e^-2.335x(R = 0.9795). The neutralizing antibody titer of the sera tested by us is above 1:8, the lowest titer of vaccine protection is determined by calculating the difference between the average value of S/N and 3 times standard deviation, and the result shows that the antibody produced by the vaccine can effectively protect the host when the S/N value is not higher than 0.68.

The hybridoma provided by the invention is subjected to patent preservation, and the preservation information is as follows:

the preservation name is: 3E8

And (3) classification and naming: hybridoma cell

The preservation date is as follows: year 2020, 11 and 30

The preservation number is: CGMCC number 21015

The preservation organization: china general microbiological culture Collection center

Address: xilu No. 1, Beijing, Chaoyang, Beijing, and institute for microbiology, China academy of sciences.

Drawings

FIG. 1 is a diagram of recombinant shuttle phagemid identification; 1: identifying the result of the gD primer; 2: and identifying the PUC/M13 primer.

FIG. 2 Indirect immunofluorescence assay for recombinant gD protein; A. SF9 cell control; B. SF9 cells inoculated with recombinant baculovirus.

FIG. 3 Western blot analysis of recombinant gD protein 1: normal SF9 cell culture supernatant; 2: precipitation of normal SF9 cells; 3: recombinant baculovirus SF9 cell culture supernatant; 4: recombinant baculovirus SF9 cell pellet.

FIG. 4 SDS-PAGE analysis of recombinant gD protein; m: a 180kDa protein marker; 1: high Five insect cell blank control; 2: cell culture supernatant; 3: flow through the peak; 4: 20mM imidazole wash peak; 5: 50mM imidazole wash peak; 6: 400mM imidazole wash peak; 7: concentrated gD protein.

FIG. 5 shows the result of monoclonal antibody purification; 1: monoclonal antibody 3E 8; 2: monoclonal antibody 4F 12; 3: mab 1B 4.

FIG. 6 Western blot identification of monoclonal antibodies; a: reacting monoclonal antibody 3E8 with IBRV; b: reacting monoclonal antibody 4F12 with IBRV; c: and reacting the monoclonal antibody 1B4 with IBRV.

FIG. 7. indirect immunofluorescence identification of monoclonal antibodies; a: detecting MDBK infected by IBRV by using monoclonal antibody 1B 4; b: detecting MDBK infected by IBRV by using monoclonal antibody 3E 8; c: detecting MDBK infected by IBRV by using monoclonal antibody 4F 12; d: mouse negative sera were tested for MDBK infected with IBRV.

FIG. 8 direct ELISA assay for titer of enzyme-labeled mAb HRP-3E 8.

FIG. 9. selection of working concentration of enzyme-labeled monoclonal antibody HRP-3E 8.

FIG. 10 optimal coating for blocking ELISA method (N/P value); wherein the coating solution 1 is 0.1M Tris-HCl buffer solution with pH8.5, the coating solution 2 is 0.1M Tris-HCl buffer solution with pH8.0, the coating solution 3 is 0.1M phosphate buffer solution with pH7.2, the coating solution 4 is 0.1M citrate buffer solution with pH5.0, and the coating solution 5 is 0.1M carbonate buffer solution with pH 9.6.

FIG. 11 optimal blocking solution (N/P values) for blocking ELISA method; wherein the confining liquid 1 is 5% chicken serum, the confining liquid 2 is 5% pig serum, the confining liquid 3 is 10% horse serum, the confining liquid 4 is 1% gelatin, the confining liquid 5 is 5% sheep serum, and the confining liquid 6 is 3% egg white albumin.

FIG. 12 optimal blocking time selection (N/P values) for blocking ELISA method.

FIG. 13 optimal serum dilution selection (N/P values) for blocking ELISA method.

FIG. 14 is a normal distribution graph of A values of the standard positive serum and the standard negative serum; a: standard positive serum a-value profile; b: standard negative serum a-value profile.

FIG. 15 blocking ELISA cut-off ROC curve.

FIG. 16. Cross-reactivity assay blocking ELISA method.

FIG. 17 log2 values for serum neutralization titers as a function of S/N values.

Detailed Description

The present invention is described in detail below with reference to examples, it being understood that the following examples are only illustrative and illustrative of the present invention and do not limit the scope of the present invention in any way.

Cell: SF9 cell, High Five cell, MDBK cell, myeloma cell SP2/0 cell are provided by Peking institute of agriculture and forestry disease research center, and can be obtained commercially.

Virus: bovine infectious rhinotracheitis virus (IBRV) is provided by livestock and poultry epidemic disease research center of agriculture and forestry academy of sciences of Beijing, and known strains are described in Xu J, Zhang X, ZHou S, Shen J, Yang D, Wu J, Li X, Li M, Huang X, seal JE, Iqbal M, Li Y. A DNA aptamer efficacy inhibition of the infection of Bovine hervirous 1 by blocking viral entry, Sci Rep.2017 Sep 18, (7 (1):11796. doi: 10.1038/S41598-017-10070-1. PMID: 28924154; PMCID: PMCID 5603541. The strain is also stored in the laboratory and the applicant states that it can be released to the public for verification experiments within twenty years from the filing date.

Animals: BALB/c mice were purchased from Experimental animals technology, Inc. of Wei Tony Hua, Beijing.

Serum: IBRV standard positive serum and standard negative serum are purchased from Chinese veterinary institute; 715 parts of bovine serum are collected by livestock and poultry epidemic disease research center of agriculture and forestry academy of sciences of Beijing; horse negative sera were purchased from solibao corporation; the special grade pig serum and the negative sheep serum are purchased from Kangyuan biological company; the chicken negative serum is prepared by livestock and poultry epidemic disease research center of agriculture and forestry academy of sciences of Beijing; the bovine brucellosis positive serum, the bovine foot-and-mouth disease positive serum, the bovine paratuberculosis positive serum and the bovine viral diarrhea positive serum are stored by livestock and poultry epidemic disease research centers of agriculture and forestry academy of sciences of Beijing.

Reagent consumables: gel recovery kit, purchased from Omega Bio-Tek, USA under the trade designation OMEGA. D2500-01. pFastBac^TM1: insect cell expression vectors, stored in the research center, are commercially available. Xho I restriction enzyme, available from NEB (Beijing) Inc., cat # R0146S; nde I restriction enzyme, purchased from NEB (beijing) ltd, cat # R0111S. Clonexpress II One Step Cloning Kit: purchased from Nanjing Nodezam Biotech, Inc., cat #: c112-01/02. Trans5 α clone competent cells: purchased from Beijing Quanyu gold Biotechnology (TransGen Biotech) Inc., catalog No.: CD 201-01. Plasmid extraction kit: purchased from tiangen Biochemical technology (Beijing) Ltd, cat #: DP 103. DH10BAC competent cells: invitrogen, cat # 10361012. The IDEXX gE antibody ELISA detection kit is purchased from Henschel Biotech limited of Aidshur, Beijing. Bovine serum albumin, egg white albumin were purchased from Calbiochem. Gelatin, NaIO₄、NaBH₄Purchased from beijing chemicals. Ammonium sulfate was purchased from beijing solibao corporation. T75 cell culture flasks, six well plates: purchased from Corning corporation. Enzyme label plate: purchased from Corning corporation, 96 well format. TMB color development liquid: purchased from beijing solibao technologies ltd. Plate washer (BIO RAD, model ImmunoWash)^TM1575) Multifunctional microplate detector (PerkinElmer, model Victor Nivo)^TM）。

Unless otherwise specified, the reagents used in the following examples are conventional in the art, and are either commercially available or formulated according to methods conventional in the art, and may be of laboratory pure grade. Unless otherwise specified, the experimental methods and conditions used in the following examples are all conventional in the art, and reference may be made to relevant experimental manuals, well-known literature, or manufacturer's instructions. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.

Example 1 preparation of recombinant gD protein and anti-IBRV monoclonal antibody

1 preparation of recombinant gD protein

1.1 Gene and primer design

An IBRV gD gene sequence (gene sequence accession number: MH 751901.1) was downloaded from the GenBank database, and a truncated gD gene sequence (SEQ ID NO: 1) encoding a truncated gD protein (SEQ ID NO: 2) was designed using an on-line analysis website (http:// www.cbs.dtu.dk/services/TMHMM /) to analyze and predict the transmembrane region of the sequence. In order to promote the protein purification after the truncated gD protein can be secreted and expressed in insect cells, a 6 × His sequence needs to be artificially introduced into the C end of the protein. The optimized gD gene sequence (SEQ ID NO: 3) was synthesized by Biotechnology engineering (Shanghai) GmbH. Specific primers (Gd-F/Gd-R) of the truncated gD gene were designed using Oligo7.0 software, and restriction enzyme sites Nde I (CATATG) and Xho I (CTCGAG) were introduced upstream and downstream, respectively, while universal primers PUC/M13 (F/R) were synthesized, by Biotech, Inc., of Beijing Optimalaceae.

TABLE 1 primer sequence Listing

Primer name	Sequence 5 '→ 3'
		Gd-F	CGGCGCATTCTGCCTTTGCGCATATGATGGTGACGGTATACG
Gd-R	CTTGTGGTGGTGGTGGTGGTGCTCGAGGATCCCGACGCTGACC
		PUC/M13F	CCCAGTCACGACGTTGTAAAACG
PUC/M13R	AGCGGATAACAATTTCACACAGG

1.2 amplification of the Gene of interest

The truncated gD gene was amplified using the Prime STAR HS DNA Polymerase with GC Buffer enzyme from TAKARA, in a PCR reaction system:

2×PrimeSTAR GC Buffer (Mg2+ plus)	25
		dNTP Mixture (2.5 mM each)	4
PrimeSTAR HS DNA Polymerase (2.5 U/µL)	0.5
		primer Gd-F (1 mu M)	1
Primer Gd-R (1 mu M)	1
		DNA template	1
ddH2O	17.5
		Total volume	50（µL）

The PCR reaction procedure was referenced to the product specification and the annealing temperature was 65 ℃. After the reaction is finished, taking the PCR product and detecting the PCR product by agarose gel electrophoresis. The target fragment was recovered using a gel recovery kit (Omega Bio-Tek, Omega. D2500-01) according to the protocol of the kit instructions, and the concentration was determined.

1.3 construction and identification of recombinant Donor plasmids

1.3.1 vector/gD Gene fragment double digestion

Vector pFastBac was targeted with restriction enzymes Xho I and Nde I, respectively^TM1 and the recovered gD gene fragment are subjected to double enzyme digestion, wherein the enzyme digestion system is as follows:

Neb Buffer3.1	2
		pFastBac TM1 plasmid/gD Gene fragment	6
Xho I	2
		Nde I	2
ddH2O	8
		Total volume	20（µL）

The system is mixed evenly and placed in a constant temperature water bath at 37 ℃ for reaction for 2h, the gel electrophoresis is used for detecting the enzyme digestion result, and a gel recovery kit (Omega Bio-Tek, OMEGA. D2500-01) is used for recovering the target fragment according to the instruction of the kit and determining the concentration.

1.3.2 connection

The gD gene fragment and pFastBac recovered after enzyme digestion ^TM1 Linear carrier with Clon express II One Step Cloning Kit (Nanjing Novox, C112-01/02) at 37 ℃ connection for 30min, the connector system:

pFastBac TM1 linearized vector	0.65
		Insert (gD gene)	3
5×CE Ⅱ Buffer	4
		Exnase Ⅱ	2
ddH2O	10.35
		Total volume	20（µL）

1.3.3 transformation of ligation products

The ligation product obtained at 1.3.2 was cooled on ice and then transformed into Trans5 α clone competent cells (all gold). The next day, a single colony was picked and PCR was performed according to the reaction system and procedure in step 1.2. And sending the bacterial liquid with positive identification result to Beijing Optimalaceae Biotechnology Limited for sequencing. Plasmids were extracted using a plasmid extraction kit (Tiangen, DP 103) according to the instructions, and the plasmid was designated gD-pFast Bac ^TM 1, measuring the concentration, and storing at-20 ℃ for later use.

1.4 construction and identification of recombinant baculovirus shuttle plasmid Bacmid-gD

1.4.1 transformation of competent cells with recombinant donor plasmids

Extracting donor plasmid gD-pFast Bac^TM DH10BAC competent cells (Invitrogen, 10361012) were transformed 1 to construct recombinant shuttle rods. The method comprises the following steps: adding 1 mu g of donor plasmid gD-pFast Bac into competent cell suspension ^TM 1, uniformly mixing, placing in a 42 ℃ water bath for 80s after ice bath for 30min, and then rapidly carrying out ice bath for 200 s; adding 900 muL of nonreactive SOC culture medium into the tube, and performing shake culture at 37 ℃ and 190 rpm for 4 hours; coating the transformed competent cells with the mixture containing Kan⁺(kanamycin, 50 μ g/ml), Gen⁺(gentamicin, 7 mug/ml), Tet⁺Culturing for 48h at 37 ℃ on LB solid medium of (tetracycline, 10 mug/ml), X-gal and IPTG. PCR identification is carried out on white single colonies by using PUC/M13 (F/R) primer and gD specific primer (Gd-F/Gd-R), and the single colonies with positive identification result are streaked and cultured in a way of containing Kan⁺、Gen⁺And Tet⁺And performing PCR identification again the next day on the LB solid culture medium to obtain positive bacteria.

1.4.2 extraction of recombinant shuttle rod particles

After the positive bacteria obtained in 1.4.1 were subjected to amplification culture, recombinant shuttle particles were extracted using Pure Link Hi Pure Plasmid DNA Purification kit (K2100) from Invitrogen according to the kit instructions.

1.4.3 identification of recombinant shuttle rods

PCR identification of the extracted recombinant shuttle rod particles was performed using PUC/M13 (F/R) primer and gD specific primer (Gd-F/Gd-R), the results are shown in FIG. 1. The correctly identified recombinant shuttle rod was named Bacmid-gD.

1.5 rescue of recombinant baculovirus rBac-gD

1.5.1 transfection of recombinant baculovirus plasmids into SF9 cells

Recombinant bacmids were transfected into SF9 cells using the Expifactamine Sf Transfection Reagent Transfection kit (cat # A38915) from Invitrogen, following the procedure: in a 6-well plate according to 0.8X 10⁶1.0X 10 cells/well⁶1.2X 10 cells/well⁶SF9 cells with good growth are paved on the cells/hole, and the cells are cultured in an incubator at 27 ℃ for 2h to be completely attached to the wall. Adding 20 mu L of Sf Transfection Reagent into 500 mu L of Opti-MEM, mixing uniformly, and incubating for 5min at 25 ℃. Mu.g of recombinant shuttle rod particles (Bacmid-gD) were added to the above solution, mixed gently and incubated at 25 ℃ for 5 min. The solution was added dropwise to the wells of the cells grown in monolayers, incubated at 27 ℃ for 96h in an incubator, and the cell supernatants were separately frozen in a freezer at-80 ℃. This is the P0 seed virus, denoted as rBac-gD.

1.5.2 passages of recombinant baculovirus

Well-grown SF9 cells (cell number about 1.2X 10)⁷Respectively) inoculating the seeds into a T75 cell culture bottle, and inoculating the seeds of the P0 generation according to the proportion of 10 percent after the cells are attached to the wall. After inoculation for about 72 hours, the SF9 cells can be observed to have obvious lesions, at the moment, cell culture supernatant is harvested, the cell culture supernatant is stored at minus 80 ℃ in a dark place, is marked as P1 generation seed virus, and is continuously transmitted to P3 generation blindly.

1.6 expression and detection of truncated gD Gene in SF9 cells

1.6.1 Indirect immunofluorescence identification of recombinant gD proteins

Inoculating P2 toxin substitute to a six-well plate, infecting SF9 cells growing in a single layer, culturing for 72 hours at 27 ℃ in a dark place, and when cytopathic effect is about 80%, removing the culture medium and washing for 5 times by PBST; fixing 4% cell tissue fixing solution (Beijing Soilebao, No. P1110) for 8min, and washing with PBST for 5 times; adding 0.1% Triton 100 (PBS for dilution), permeabilizing for 20min, and washing with PBST for 5 times; adding PBST containing 5% BSA, blocking at 25 deg.C for 2h, discarding blocking solution, adding 6 × His monoclonal antibody (abcam, ab 18184) diluted 1:5000 times, incubating at 37 deg.C for 1h, and washing with PBST for 5 times; adding FITC-labeled goat anti-mouse IgG (Invitrogen, A32723) diluted at a ratio of 1:200, incubating for 1h at room temperature in the dark, and washing for 5 times with PBST; observed under a fluorescent microscope and photographed (fig. 2).

1.6.2 Western blot analysis of recombinant gD proteins

Infecting SF9 cells growing in a monolayer with P2 virus, blowing down the cells when cytopathic effect is about 80%, centrifuging at 1000rpm for 6min, and collecting cell culture supernatant and cell precipitate respectively. And (4) resuspending the cell sediment by 160 mu L of sterilized water, mixing the cell sediment with the protein loading buffer solution, carrying out boiling water bath for 10min, and carrying out ice bath for 5min rapidly. After completion of SDS-PAGE, transfer was carried out according to a conventional transfer method. After the transfer is finished, the PVDF membrane is sealed by PBST solution containing 5% skimmed milk for 2 h; diluting IBRV standard positive serum with PBST at a ratio of 1:1000 to serve as primary antibody, incubating at 25 ℃ for 2h, washing the membrane with PBST for 5 times, and washing for 5min each time; diluting HRP-labeled goat anti-bovine IgG (Sigma, SAB 3700005) with PBST at a ratio of 1:10000, incubating at 25 deg.C for 2h, washing the membrane with PBST for 5 times, each for 5 min; chemiluminescence and storage by photography (fig. 3).

1.7 purification and concentration of recombinant gD protein

300mL of a 1L triangular flask with a density of 1.0X 10 was inoculated⁶Each/mL of High Five cells were incubated at 27 ℃ for 24h at 140rpm in the dark to allow the cells to be in the logarithmic growth phase. The next day, recombinant baculovirus of P3 generation was inoculated at 10% of the virus inoculum size and cultured at 27 ℃ for 84h at 140rpm in the dark. The cell sap was collected, centrifuged at 8000 Xg for 30min at 4 ℃ and the cell culture supernatant was filtered through a 0.22 μm filter to remove impurities. At 4 deg.C, with 5 column volumes (about 50 mL) of ddH₂O low flow rate displaced 20% ethanol in the protein purification column (Qiagen, 70971). 0.2M NiCl over 2 column volumes (about 20 mL)₂Until the reading is stable. ddH over 5 column volumes₂The O washes away unbound Ni ions. The protein purification column was equilibrated with 5 column volumes of lysis buffer (20 mM Tris, 0.5M NaCl, pH 8.0). Circulating the cell culture supernatant through His column overnight at 4 deg.C, and collecting the sample before loading, and collecting the effluent. The column was washed with lysis buffer containing 20mM imidazole until the OD280 absorbance stabilized, and the sample was retained, followed by addition of PMSF to a final concentration of 1%. The column was washed with lysis buffer containing 50mM imidazole until the OD280 absorbance stabilized, and the sample was retained, and PMSF was added to a final concentration of 1%. The column was washed with lysis buffer containing 400mM imidazole until the OD280 absorbance stabilized, and the sample was retained, followed by addition of PMSF to a final concentration of 1%. ddH was added in 5 column volumes in sequence₂O, EDTA solution (0.5M), ddH₂O, NaOH solution (0.5M), ddH₂The Ni column was treated with O and 20% ethanol. Samples were sequentially retained in the above steps and subjected to SDS-PAGE (FIG. 4). The sample containing the single band was placed in a 50mL protein concentration tube, DTT was added to a final concentration of 1mM, and centrifuged at 2900rpm at 4 ℃ until the solution was left at around 2 mL. The concentrated recombinant gD protein was assayed for protein concentration with a nucleic acid protein concentration analyzer and stored in glycerol containing 30% and frozen at-80 ℃ for future use.

2. Preparation of anti-IBRV monoclonal antibody

2.1 preparation of immunogens

MDBK cells grown in a monolayer were prepared, and were incubated for 1h in a serum-free medium containing 1% IBRV, followed by changing to a maintenance solution containing 2% (v/v) FBS, and incubated at 37 ℃ for 2-3 days. When the cell CPE (cytopathic effect) reaches about 80%, the cell CPE is repeatedly frozen and thawed three times in a refrigerator at minus 80 ℃, and supernatant is collected by centrifugation. Subsequently, sucrose gradient density centrifugation is adopted for virus concentration, and the antigen concentration is measured.

2.2 animal immunization

And (3) taking the purified infectious bovine rhinotracheitis virus liquid to carry out Western blot identification. The virus liquid without error is taken as immunogen to be emulsified with Freund's adjuvant in equal volume, BALB/c mice are immunized, and the specific immunization program is as the following table.

TABLE 2 immunization procedure

Number of immunizations	Immunological pathways	Immunogen dose (μ g)	Adjuvant
				Head free	Subcutaneous injection of neck and back	100	Equivalent Freund's complete adjuvant
Two exempt from	Subcutaneous injection of neck and back	100	Equivalent Freund's incomplete adjuvant
				Sanwu	Subcutaneous injection of neck and back	100	Equivalent Freund's incomplete adjuvant
Exempt from	Subcutaneous injection of neck and back	100	Equivalent Freund's incomplete adjuvant
				Strengthen exempting from	Abdominal injection	100	Without adding adjuvant

2.3 establishment of hybridoma screening method

2.3.1 preparation of anti-IBRV Positive and negative sera

Collecting blood from eyeball of immunized mice 5 days after the third immunization, standing at 37 deg.C for 1h, centrifuging at 4 deg.C and 3000rpm for 15min, collecting supernatant, packaging, and storing in-40 deg.C refrigerator as positive control for screening hybridoma; simultaneously purchased nonimmunized mice were sampled, placed at 37 ℃ for 1h, centrifuged at 3000rpm at 4 ℃ for 15min, and the supernatants were aspirated and stored in a-40 ℃ freezer for use as a negative control for screening hybridoma cells.

2.3.2 establishment of Indirect ELISA method

And (4) calibrating the optimal antigen and the optimal antibody using amount by using a chessboard method. The indirect ELISA method was as follows:

coating: after diluting the purified recombinant gD protein (initial concentration of 2 mg/mL) to 0.1562. mu.g/mL in a linear fold ratio of 5. mu.g/mL and 2.5. mu.g/mL, 100. mu.L of ELISA plate per well was added to the final line, PBST was added as an antigen negative control, and after incubation at 37 ℃ for 1h, overnight at 4 ℃.

And (3) sealing: after 5 washes in the plate washer, 300. mu.L of 5% skim milk (PBST diluted) was added to each well and blocked for 2h at 37 ℃.

Incubating primary antibody: PBST was used to dilute the positive and negative sera of mice after the three-immunization sequentially from 1:400 to 1:800 to 1:12800 at a rate of 100. mu.L/well after washing the plates, and incubated for 1h at 37 ℃.

Hatching a secondary antibody: HRP-labeled goat anti-mouse IgG (Sigma, A9309) was diluted 1:10000 times with PBST, washed 100. mu.L/well and incubated at 37 ℃ for 1 h.

Color development: after washing the plate, 100. mu.L/well of TMB color developing solution was added, the reaction was carried out at 37 ℃ in the dark for 15min, and then 50. mu.L of 2M sulfuric acid was added to terminate the reaction. The absorbance of the OD450 was read.

And selecting the antigen and antibody concentrations corresponding to the hole with the OD450 value closest to 1.0 as the optimal antigen coating concentration and the optimal positive serum dilution. The results are shown in Table 3, where the OD450 was closest to 1.0 and the P/N was maximal at antigen dilution 1:6400 and positive serum dilution 1: 1600. Thus, the optimal antigen coating concentration was 0.625. mu.g/mL, and the optimal serum dilution was 1: 6400.

TABLE 3 determination of optimal working concentration of coating antigen and serum

Note: p represents positive serum; n represents negative serum.

2.4 screening and cloning of Positive hybridoma cell lines secreting gD protein antibody

2.4.1 mouse serum Titers assay

5 days after the fourth immunization, blood sampling is carried out on the eyeballs of the mice in the immunization group, the mice are placed at 37 ℃ for 1h, then the mice are centrifuged at 3000rpm at 4 ℃ for 15min, and supernatants are sucked, subpackaged and stored in a refrigerator at 40 ℃ below zero. Sera were prepared from 1: 5X 10³Dilution to 1: 1.28X 10⁶The indirect ELISA method of 2.3.2 is adopted to measure the serum antibody titer of the mice, the mice with the highest serum antibody titer are subjected to fifth boosting immunization, and cell fusion can be carried out after about 3 days. The results are shown in Table 4, which shows the OD₄₅₀The value is 0.2 as the critical value of an ELISA method, and the serum antibody titer of the immunized mice can reach 1:8 multiplied by 10 at least⁴All above the minimum titer required for fusion, cell fusion can be performed after the 5 th boost.

TABLE 4 mouse serum antibody titer determination

Mouse	1:5000	1:10000	1:20000	1:40000	1:80000	1:160000	1:320000	1:640000	1:1280000
										1	2.389	1.874	1.451	1.06	0.654	0.37	0.207	0.135	0.093
2	1.55	1.192	0.881	0.56	0.356	0.225	0.123	0.088	0.069
										3	1.657	1.134	0.791	0.533	0.36	0.261	0.136	0.091	0.072
4	1.714	1.259	1.033	0.778	0.554	0.375	0.163	0.109	0.087
										5	1.117	0.666	0.423	0.329	0.235	0.184	0.093	0.075	0.065
Negative of	0.163	0.126	0.152	0.152	0.151	0.161	0.064	0.059	0.057

2.4.2 cell fusion

Spleens of immunized BALB/c mice are taken under a sterile environment in a super clean bench to prepare a splenocyte suspension. Spleen cells and myeloma cells SP2/0 cells were differentiated by 5: 1 in a 50mL centrifuge tube, centrifuged at 1000rpm for 10min, discarded the supernatant, resuspended cells in serum free DMEM (Gibco, C11995500 CP), and centrifuged again to remove the supernatant. Gently pat the cells away and place the tube in a 37 ℃ water bath. Adding 1mL of PEG-1500 to the cell pellet over a period of 60s using a 2.5mL syringe; then dripping 1mL of DMEM medium preheated to 37 ℃ into the cell suspension within 60 s; dripping 3 mL of DMEM medium preheated to 37 ℃ into the cell suspension within 180 s; finally, slowly adding 10 mL of DMEM medium preheated at 37 ℃ into the centrifuge tube, and carrying out water bath at 37 ℃ for 10 min; centrifuging at 1000rpm for 10min, and discarding the supernatant; after resuspending the cells in the appropriate amount of HAT medium (Sigma, H0262), they were added to a 96-well plate and incubated in a carbon dioxide incubator at 37 ℃. The action needs to be absolutely gentle in the whole fusion process, and the whole process needs to be carried out in a water bath at 37 ℃.

2.4.3 screening of Positive hybridoma cell lines

Half-and full-fluid exchanges were performed on the fused cells on days 7 and 10 after fusion, respectively. On the third day after the total fluid change, hybridoma cells secreting anti-gD protein antibody were screened by indirect ELISA. And (4) completely replacing the positive holes screened for the first time with liquid, and screening for the second time. And (3) carrying out enlarged culture on the holes which are still positive in the second screening and freezing, simultaneously carrying out subcloning for 3-5 times continuously until the positive rate is 100%, and freezing the positive cell strain (3E 8/4F 12/1B 4) in a liquid nitrogen tank.

2.5 preparation of ascites and purification of monoclonal antibodies

Intraperitoneal injection into SPF grade Balb/C mice1mL autoclaved liquid paraffin was used for sensitization, and a 1.0X 10 intraperitoneal injection was carried out 7 days later⁶A well-established hybridoma cell line (3E 8/4F 12/1B 4). The abdominal cavity of the mouse was observed every day, and ascites was collected when the mouse was distended and inconvenient to move. The ascites fluid was purified by Thermo Protein A/G purification column (FIG. 5), the concentration was measured and stored at-80 ℃.

2.6 ELISA potency assay of monoclonal antibodies

Hybridoma cell supernatants (3E 8/4F 12/1B 4) were purified from 1:100 times diluted to 1: 2.048X 10⁵And measuring the ELISA titer of the monoclonal antibody by using an indirect ELISA method of 2.3.2, wherein the ELISA titer is 100 muL/hole. As a result, as shown in Table 5, the ELISA titers of the cell supernatants of 3E8, 4F12, and 1B4 were 1: 1.024X 10, respectively⁵，1:5.12×10⁴，1:1.024×10⁵. Collected mouse ascites (3E 8/4F 12/1B 4) were treated with PBST from 1: 1.0X 10³Dilution to 1: 2.048X 10⁶And measuring the ELISA titer of the monoclonal antibody by using an indirect ELISA method of 2.3.2, wherein the ELISA titer is 100 muL/hole. As a result, as shown in Table 6, the ELISA titers for ascites production by 3E8, 4F12 and 1B4 were all 1: 1.024X 10⁶。

TABLE 5 hybridoma supernatant ELISA Titers determination

Degree of dilution	3E8	4F12	1B4
				1:100	1.302	1.429	1.4
1:200	1.409	1.397	1.333
				1:400	1.39	1.32	1.27
1:800	1.381	1.351	1.293
				1:1600	1.283	1.251	1.271
1:3200	1.306	1.08	1.226
				1:6400	1.141	0.842	1.174
1:12800	0.948	0.58	0.991
				1:25600	0.675	0.37	0.734
1:51200	0.446	0.226	0.561
				1:102400	0.295	0.148	0.373
1:204800	0.155	0.069	0.164

TABLE 6 ascites ELISA titre determination

Degree of dilution	3E8	4F12	1B4
				1:1000	1.409	1.347	1.369
1:2000	1.413	1.243	1.315
				1:4000	1.424	1.273	1.201
1:8000	1.343	1.225	1.293
				1:16000	1.349	1.109	1.156
1:32000	1.077	1.007	1.07
				1:64000	1.039	0.799	0.892
1:128000	0.765	0.702	0.68
				1:256000	0.542	0.472	0.519
1:512000	0.385	0.357	0.377
				1:1024000	0.268	0.227	0.265

2.7 measurement of neutralizing potency of monoclonal antibody

Inactivating monoclonal antibody at 56 deg.C in metal bath for 30min, diluting by 2 times, mixing with 100TCID50 (half of tissue culture infectious dose) of IBRV in equal volume, placing in 37 deg.C CO₂After being cultured for 2 hours in an incubator, the cells are inoculated on MDBK cells growing in a single layer, 100 muL/hole and CO at 37 DEG C₂And (5) observing the CPE condition after culturing for 3-4 days in the incubator. Meanwhile, a virus regression test is established, and the virus regression titer (the titer should be 100TCID50, and the allowable range is 30-300 TCID 50) is checked. The results of the neutralization tests show that the monoclonal antibodies 1B4 and 3E8 have the activity of neutralizing IBRV, and the monoclonal antibody 4F12 does not have the activity of neutralizing IBRV. The neutralizing antibody titers of mab 3E8 and 1B4 were both 1: 320.

2.8 Western blot identification of monoclonal antibodies

And uniformly mixing the purified IBRV with the protein loading buffer solution, boiling, performing SDS-PAGE, and transferring the proteins on the gel to a PVDF membrane by a conventional wet transfer method. Sealing the PVDF membrane by using 5% skim milk at room temperature for 2 h; adding monoclonal antibodies 1B4, 3E8 and 4F12 (1: 1000), incubating at room temperature for 2h, washing the membrane with PBST for 5 times, each time for 5 min; diluting HRP-labeled goat anti-mouse IgG (Sigma, A9309) by 1:10000 times (the dilution is PBST) to serve as a secondary antibody, incubating at 25 ℃ for 2h, and washing the membrane with PBST for 5 times for 5 min; chemiluminescence and storage by photography (fig. 6).

2.9 Indirect immunofluorescence identification of monoclonal antibodies

Adding autoclaved flyer and appropriate amount of MDBK cell suspension into six-well plate, and adding CO at 37 deg.C₂The cells were cultured in an incubator until the cell monolayer was full, and IBRV was inoculated at a viral load of 100TCID 50. When CPE reaches 70% -80% of pathological changes, PBST is washed for 5 times after being fixed for 8min by 4% cell tissue fixing solution; adding 0.1% Triton 100 (PBS for dilution), permeabilizing for 20min, and washing with PBST for 5 times; adding PBST containing 5% BSA, blocking at 25 deg.C for 2h, removing blocking solution, adding prepared anti-IBRV gD monoclonal antibodies 1B4, 3E8 and 4F12 (diluted with blocking solution at a ratio of 1: 1000), incubating at 37 deg.C for 1h, and washing with PBST for 5 times; adding FITC-labeled goat anti-mouse IgG (Sigma, A9309) diluted at the ratio of 1:200, incubating for 1h at room temperature in the dark, and washing for 5 times with PBST; observed under a fluorescent microscope and photographed (fig. 7).

2.10 optimal blocking monoclonal antibody screening

And (3) determining the combination blocking rate of the monoclonal antibodies 1B4, 3E8 and 4F12 and IBRV standard positive serum and standard negative serum by adopting a blocking ELISA method, and calculating the N/P value, wherein the monoclonal antibody with the maximum N/P value is the optimal monoclonal antibody for establishing the blocking ELISA method. The method comprises the following steps: coating a 96-hole enzyme label plate with purified recombinant gD protein; after being sealed, diluting IBRV standard negative serum and standard positive serum according to the volume ratio of 1:1 respectively, and adding the diluted IBRV standard negative serum and standard positive serum into an ELISA plate; three monoclonal antibodies with the same concentration are taken as primary antibodies; HRP-labeled goat anti-mouse IgG (Sigma, A9309) (diluted 1:10000 times with PBST) was used as a secondary antibody, and the secondary antibody was added with a substrate to develop color, and the N/P value was calculated. The results are shown in table 7, the N/P values of the mabs 1B4, 3E8 and 4F12 are 8.5, 12.7 and 9.2, respectively, the N/P value of the mab 3E8 is significantly different from that of the mabs IB4 and 4F12 (P < 0.05), which indicates that the blocking activity of the mab 3E8 is optimal, and the mab can be used as a candidate mab for establishing a blocking ELISA method, and hybridoma cells secreting the mab are preserved in the common microorganism center of the china committee for culture collection, with the collection number of CGMCC number 21015.

TABLE 7 identification of the blocking Activity of monoclonal antibodies

Example 2 establishment of blocking ELISA method for detecting antibody against infectious bovine rhinotracheitis Virus

1. Horse radish peroxidase labeled monoclonal antibody

Monoclonal antibody 3E8 was labeled with horseradish peroxidase (HRP) using sodium periodate.

(1) 5mg of HRP (SIGMA, SRE 0082) was weighed into 1000. mu.L of double distilled water, and 500. mu.L of newly formulated 0.1M NaIO was added₄Mixing, and incubating at 4 deg.C in dark for 30 min.

(2) Adding 500 μ L of new 0.2M ethylene glycol (SIGMA, 324558) solution, mixing, and incubating at 4 deg.C in dark for 30 min.

(3) 5mg of purified mAb 3E8 was added to the above solution, mixed well and placed in a pre-treated dialysis bag (Beijing Solebao, MW 14000) and dialyzed overnight in 0.1M carbonate buffer pH9.6 with three changes during dialysis.

(4) The dialyzed liquid was poured into a new centrifuge tube and 200. mu.L of newly formulated 5mg/mL NaBH was added₄Mixing, and incubating at 4 deg.C in dark for 2 h.

(5) The liquid was poured into a clean beaker and an equal volume of supersaturated (NH) was added slowly₄)₂SO₄The solution was centrifuged at 3000rpm for 30min, the supernatant was discarded and the pellet was resuspended in an appropriate amount of pre-cooled 0.1M PBS solution, pH 7.2.

(6) The solution was filled into dialysis bags and dialyzed overnight against 0.1M carbonate buffer pH9.6 with three medium changes.

(7) Collecting the liquid in the dialysis bag the next day, measuring the concentration, subpackaging and storing in 30% glycerol solution.

2. Direct ELISA for measuring titer of enzyme-labeled monoclonal antibody HRP-3E8

(1) Coating: 2mg/mL of recombinant gD protein was diluted 1:6400 times with 0.1M carbonate buffer pH9.6, added to an ELISA plate at 100. mu.L/well, incubated at 37 ℃ for 1h, and then incubated at 4 ℃ overnight.

(2) Washing the plate: the plate washer washes 5 times, each time 350. mu.L PBST per well, and blots the well off on absorbent paper.

(3) And (3) sealing: add 300. mu.L of 5% skim milk (PBST diluted) to each well, block at 37 ℃ for 2h and wash the plate.

(4) Incubating primary antibody: the marked monoclonal antibody HRP-3E8 is diluted from 1:100 and 1:200 to 1:12800 at a time ratio, each well is 100 mu L, and the plate is washed after 1h of incubation at 37 ℃.

(5) Color development: 100 μ L of TMB color developing solution was added to each well, and color development was carried out at 37 ℃ for 15min in the dark.

(6) And (4) terminating: add 50. mu.L of 2M H per well₂SO₄The microplate reader reads the absorbance at OD450 nm.

As shown in FIG. 8, when the titer of the enzyme-labeled monoclonal antibody HRP-3E8 is defined as OD450nm value of 0.2, the titer of the enzyme-labeled monoclonal antibody HRP-3E8 is 1: 6400. The titer is higher, and the method can be used for continuously establishing a blocking ELISA method.

3. Determination of optimal antigen antibody usage

And determining the optimal working concentration of the recombinant gD protein and the enzyme-labeled monoclonal antibody by adopting a chessboard method. The recombinant gD protein solution (2 mg/mL) is diluted from 1:100 and 1:200 to 1:6400, and the monoclonal antibody solution is diluted from 1:100 and 1:200 to 1: 3200. Blocking ELISA square matrix titration of IBRV standard positive serum and standard negative serum is carried out. The N/P value was chosen (the N/P value is the OD of the negative control well)₄₅₀OD with Positive control well₄₅₀Ratio of (d) the corresponding gD protein coating concentration at maximum was used as the optimal antigen usage for blocking the ELISA method. And then coating the enzyme label plate by using the optimal antigen usage amount, diluting the enzyme-labeled monoclonal antibody HRP-3E8 according to the proportion of 1:125, 1:250, 1:500, 1:1000, 1:2000, 1:4000 and 1:8000, and performing blocking ELISA of IBRV standard positive serum and standard negative serum to determine the optimal usage amount of the optimal enzyme-labeled monoclonal antibody HRP-3E 8.

The results are shown in Table 8, which have the highest N/P value of 10.62 when the antigen coating concentration was 1:800 fold diluted, i.e., 250 ng/well, and the mAb 3E8 (initial concentration of 1.72 mg/mL) was 1:1600 fold diluted. After HRP labeling of the monoclonal antibody 3E8 is completed, the optimal use concentration of the enzyme-labeled monoclonal antibody HRP-3E8 is determined by a chessboard method again. As shown in FIG. 9, the enzyme-labeled monoclonal antibody HRP-3E8 (initial concentration of 0.55 mg/mL) had the highest N/P value when diluted 1: 500-fold. In conclusion, the optimal antigen usage amount of the blocking ELISA method is 250 ng/hole, and the optimal enzyme-labeled monoclonal antibody HRP-3E8 usage concentration is 1: 500.

TABLE 8 selection of antigen coating concentration and mAb 3E8 working concentration

4. Optimization of coating liquid

In order to search for the optimal coating solution, the optimal antigen coating amount determined in the above process is adopted to perform blocking ELISA, and the following 5 antigen coating solutions are set:

0.1M Tris-HCl buffer pH 8.5: 12.114g Tris is weighed, 850mL distilled water is added, stirring and dissolving are carried out, HCl is added to adjust the pH value to 8.50, then distilled water is added to reach the constant volume of 1L, and mixing is carried out.

0.1M Tris-HCl buffer pH 8.0: 12.114g Tris is weighed, 850mL distilled water is added, stirring and dissolving are carried out, HCl is added to adjust the pH value to 8.00, then distilled water is added to fix the volume to 1L, and mixing is carried out.

0.1M phosphate buffer ph 7.2: 80g NaCl, 32.3g Na were weighed₂HPO₄·12H₂O，4.5g NaH₂PO₄·2H₂And O, adding 900mL of distilled water, mixing uniformly, adjusting the pH to 7.2 by using HCl/NaOH, adding distilled water to a constant volume of 1L, and mixing uniformly.

0.1M citrate buffer ph 5.0: 12.044g of sodium citrate dihydrate and 11.341g of citric acid are weighed, dissolved in 800mL of distilled water and mixed uniformly, the pH value is adjusted to 5.0 by HCl, and finally the distilled water is added to a constant volume of 1L and mixed uniformly.

0.1M carbonate buffer ph 9.6: 63.6g of anhydrous sodium carbonate and 33.6g of sodium bicarbonate are weighed, distilled water is added for mixing, and the volume is determined to be 1L.

Recombinant gD protein (2 mg/mL) was diluted with different coating solutions and plated at 250 ng/well according to the conventional blocking ELISA method. After blocking treatment with the same blocking solution (5% chicken serum), IBRV standard negative and positive serum was detected. The optimal concentration (1.1. mu.g/mL) of enzyme-labeled monoclonal antibody HRP-3E8 was used. And setting a repetition for each group of coating liquid, and determining the optimal coating liquid by calculating the N/P value. As shown in FIG. 10, the coating solution 2 has the largest N/P value, i.e., the blocking rate is the largest, so that the optimal coating solution for blocking the ELISA method is determined to be 0.1M Tris-HCl buffer solution with pH of 8.5.

5. Optimization of the closure conditions

In order to explore the optimal confining liquid, the enzyme label plate is coated under the optimal coating condition. Recombinant gD protein (2 mg/mL) was plated at 250 ng/well with 0.1M Tris-HCl buffer (pH8.5). Setting 6 serum confining liquids: 3% (v/v) egg white albumin, 5% (v/v) pig serum, 10% (v/v) horse serum, 1% (v/v) gelatin, 5% (v/v) sheep serum and 5% (v/v) chicken serum. The blocking solution is prepared by PBST. After 6 different sealing liquids are used for sealing treatment, IBRV standard negative and positive serum is detected. The optimal concentration (1.1. mu.g/mL) of enzyme-labeled monoclonal antibody HRP-3E8 was used. The blocking ELISA was performed in a conventional manner, and each blocking solution was repeated once, and the optimal blocking solution was determined by calculating the N/P value. As a result, as shown in FIG. 11, since the blocking rate was the greatest when the N/P value was the greatest for blocking solution 1, the blocking solution was determined to be the optimal blocking solution for blocking the ELISA method, i.e., 5% chicken serum.

In order to explore the optimal sealing time, the enzyme label plate is coated by the optimal coating condition, and the optimal sealing liquid is used for sealing. Recombinant gD protein (2 mg/mL) was diluted with 0.1M Tris-HCl buffer (pH8.5) and plated at 250 ng/well. After blocking for 1h, 1.5h and 2h at 37 ℃ by using 5% chicken serum, IBRV standard negative and positive serum is detected. The optimal concentration (1.1. mu.g/mL) of enzyme-labeled monoclonal antibody HRP-3E8 was used. The blocking ELISA was performed in a conventional manner, and each blocking time was repeated once, and the optimal blocking time was determined by calculating the N/P value. As shown in FIG. 12, the blocking time for blocking ELISA was 37 ℃ for 2h, since the corresponding N/P value was the largest when blocking was performed for 2h, i.e., the corresponding blocking rate was the largest. In conclusion, the optimal blocking conditions were 5% chicken serum at 37 ℃ for 2 h.

6. Optimal dilution of serum

To explore the optimal dilution of serum, recombinant gD protein (2 mg/mL) was diluted with 0.1M Tris-HCl buffer pH8.5 and plated at 250 ng/well. Blocking was performed with 5% chicken serum at 37 ℃ for 2 h. Diluting IBRV standard positive serum and IBRV standard negative serum by PBST according to the ratio of 1:1, 1:5, 1:10, 1:20 and 1:40, 100 microliter/hole, and incubating for 1h at 37 ℃; the optimal concentration (1.1. mu.g/mL) of enzyme-labeled monoclonal antibody HRP-3E8 was used. The optimal serum dilution was determined by calculating the N/P value by repeating the optimal dilution for each serum, according to the conventional blocking ELISA method. As shown in FIG. 13, the optimal serum dilution ratio for blocking ELISA was 1:2, since the N/P value was the largest at a serum dilution ratio of 1:2, i.e., the blocking rate was the largest at this time.

7. Determination of test establishment conditions

In order to judge the effectiveness of each test, the blocking ELISA method is established by adopting the optimal test conditions found out above, and the IBRV standard positive serum and the standard negative serum are respectively detected for 48 times. Conditions for establishing the blocking ELISA test were determined by observing the change in the A value (A value means absorbance) of the standard negative serum and the standard positive serum.

The blocking ELISA method established by the invention comprises the following steps:

(1) coating: recombinant gD protein (2 mg/mL) was diluted 1:800 fold with 0.1M Tris-HCl buffer (pH8.5), added to the microplate at 100. mu.L/well, incubated at 37 ℃ for 1h and then coated overnight at 4 ℃.

(2) Washing the plate: washing with plate washing machine for 5 times, adding 350 μ L PBST per hole, and completely removing residual washing liquid on absorbent paper after washing.

(3) And (3) sealing: mu.L of 5% (v/v) chicken serum (PBST diluted) per well was blocked for 2h at 37 ℃.

(4) Washing the plate: the same as (2).

(5) Sample adding: the serum to be tested (standard positive serum/standard negative serum) was diluted 1:2 with PBST, 100. mu.L/well and incubated at 37 ℃ for 1 h.

(6) Washing the plate: the same as (2).

(7) A first antibody: enzyme-labeled monoclonal antibody HRP-3E8 (0.55 mg/mL) was processed with PBST for 1:500 times diluted, 100 u L/hole, 37 degrees C were incubated for 1 h.

(8) Washing the plate: the same as (2).

(9) Color development: adding TMB single-component color development liquid, developing at 100 μ L/hole in a dark place at 37 deg.C for 15 min.

(10) And (4) terminating: plus 2M H₂SO₄50 mu L/hole, and after gently mixing, reading the light absorption value at OD450 in a microplate reader.

The results are shown in FIG. 14, the standard negative and positive serums are respectively tested for 48 times, and all the test A values are in accordance with normal distribution, so we select that when the positive control serum A value is less than or equal to 0.2, and the negative control serum A value is greater than or equal to 0.9, the test results are effective.

8. Determination of blocking ELISA cut-off values

715 parts of bovine serum collected from research centers for livestock and poultry epidemic diseases of agriculture and forestry academy of sciences of Beijing city are subjected to neutralization tests to determine whether the serum contains IBRV neutralizing antibodies. The neutralization test procedure was as follows:

(1) MDBK cells were transferred to 96-well plates one day in advance to ensure that the cells for the assay were in log phase growth.

(2) The serum was inactivated in a 56 ℃ water bath for 30 minutes.

(3) Serum to be detected, IBRV standard negative serum and standard positive serum are sequentially diluted to 1:256 from 1:4 and 1:8 by serum-free DMEM, the serum to be detected, the standard negative serum and the standard positive serum are respectively added into holes of a 96-hole cell culture plate, each hole is filled with 60 mu l of the serum to be detected, each group is repeatedly filled with 2 holes, and the serum to be detected is added in the last line to be used as serum toxicity control.

(4) Each well was loaded with 60. mu.l of 200TCID 50/100. mu.l of virus suspension. To the serotoxic control wells, 60 μ l serum-free DMEM was added instead of the virus diluent.

(5) 100TCID 50/100. mu.l of virus solution was serially diluted 3 times 10-fold in serum-free DMEM, 4 wells for each dilution, and 60. mu.l of virus suspension was added to each well to make a virus regression control.

(6) Place the plates at 37 ℃ CO₂The incubator was neutralized for 1 hour.

(7) Pipetting 100 μ l of the above mixture, adding to single layer of MDBK cells, incubating at 37 deg.C for 1 hr, replacing the well with a maintenance solution, and incubating at 37 deg.C with CO₂The incubator was used for 4 days.

(8) Cytopathic conditions were observed with an inverted microscope. The regression titer was checked and the virus regression control showed lesions in both 100TCID 50/100. mu.l and 10TCID 50/100. mu.l, half of the cells in 1TCID 50/100. mu.l wells and no lesions in 0TCID 50/100. mu.l wells. Cytopathic effect appears in negative serum control, and no pathological effect appears in serum poison control.

The results showed that in 715 bovine serum, 443 parts were positive for the IBRV antibody and 272 parts were negative for the IBRV antibody. 715 bovine sera were tested by the blocking ELISA method we established and the S/N value was calculated (S/N is the ratio of the OD450 of the sample wells to the OD450 of the negative control wells). The optimal cut-off value for blocking the ELISA was determined by plotting Receiver Operating Characteristics (ROC). In general, the cut-off value corresponding to the maximum john index is determined as cut-off value of the diagnostic method, john index = sensitivity + specificity-1.

715 parts of bovine serum are detected by the blocking ELISA method established by the invention, and an S/N value is calculated. Then correspondingly inputting the qualitative result of the neutralization test, and drawing an ROC curve by using SPSS22.0 software. As shown in fig. 15, the area under the curve is 0.977, the standard error is 0.006, the 95% confidence interval is 0.965-0.989, and P <0.001, indicating that the method of the present invention has high accuracy. And calculating the john index according to the sensitivity and specificity-1 of each tangent point of the ROC curve, wherein the tangent point with the maximum john index is the critical point of the blocking ELISA. As in Table 9, the cut-off value was 0.885, which has the greatest approximately Denton index of 0.88. Therefore, the result determination method is: when the S/N is more than or equal to 0.885, the IBRV antibody is negative; and the IBRV antibody is positive when the S/N < 0.885.

TABLE 9 coordinates of ROC curves

Standard S/N	Sensitivity of the device	1-specificity	Joden index	Standard S/N	Sensitivity of the device	1-specificity	Joden index
								-0.88	1	1	0	0.775	0.985	0.134	0.851
0.125	1	0.998	0.002	0.785	0.985	0.127	0.858
								0.14	1	0.991	0.009	0.795	0.985	0.116	0.869
0.16	1	0.989	0.011	0.805	0.985	0.114	0.871
								0.18	1	0.985	0.015	0.815	0.981	0.11	0.871
0.195	1	0.982	0.018	0.825	0.969	0.099	0.87
								0.205	1	0.98	0.02	0.835	0.965	0.096	0.869
0.215	1	0.969	0.031	0.845	0.958	0.092	0.866
								0.225	1	0.965	0.035	0.855	0.954	0.083	0.871
0.235	0.996	0.95	0.046	0.87	0.95	0.077	0.873
								0.245	0.996	0.941	0.055	0.885	0.946	0.066	0.88
0.255	0.996	0.925	0.071	0.895	0.938	0.066	0.872
								0.265	0.996	0.912	0.084	0.905	0.934	0.061	0.873
0.275	0.996	0.897	0.099	0.915	0.931	0.055	0.876
								0.285	0.992	0.884	0.108	0.925	0.927	0.053	0.874
0.295	0.992	0.857	0.135	0.935	0.919	0.044	0.875
								0.305	0.992	0.833	0.159	0.945	0.907	0.042	0.865
0.315	0.992	0.811	0.181	0.955	0.903	0.042	0.861
								0.325	0.992	0.783	0.209	0.965	0.888	0.039	0.849
0.335	0.992	0.75	0.242	0.975	0.865	0.039	0.826
								0.345	0.992	0.726	0.266	0.985	0.853	0.037	0.816
0.355	0.992	0.691	0.301	0.995	0.83	0.037	0.793
								0.365	0.992	0.664	0.328	1.005	0.815	0.033	0.782
0.375	0.992	0.643	0.349	1.015	0.78	0.031	0.749
								0.385	0.992	0.618	0.374	1.025	0.749	0.026	0.723
0.395	0.992	0.583	0.409	1.035	0.737	0.02	0.717
								0.405	0.992	0.561	0.431	1.045	0.726	0.013	0.713
0.415	0.992	0.531	0.461	1.055	0.71	0.011	0.699
								0.425	0.992	0.502	0.49	1.065	0.683	0.011	0.672
0.435	0.992	0.48	0.512	1.075	0.672	0.009	0.663
								0.445	0.992	0.452	0.54	1.085	0.656	0.009	0.647
0.455	0.992	0.43	0.562	1.095	0.637	0.009	0.628
								0.465	0.992	0.41	0.582	1.105	0.622	0.009	0.613
0.475	0.992	0.384	0.608	1.115	0.587	0.007	0.58
								0.485	0.992	0.366	0.626	1.125	0.537	0.007	0.53
0.495	0.992	0.36	0.632	1.135	0.494	0.007	0.487
								0.505	0.992	0.351	0.641	1.145	0.463	0.007	0.456
0.515	0.992	0.338	0.654	1.155	0.456	0.004	0.452
								0.525	0.992	0.325	0.667	1.165	0.429	0.004	0.425
0.535	0.992	0.318	0.674	1.175	0.398	0.004	0.394
								0.545	0.992	0.303	0.689	1.185	0.355	0.002	0.353
0.555	0.992	0.296	0.696	1.195	0.34	0.002	0.338
								0.565	0.992	0.281	0.711	1.205	0.309	0.002	0.307
0.575	0.992	0.268	0.724	1.215	0.286	0.002	0.284
								0.585	0.992	0.25	0.742	1.225	0.266	0.002	0.264
0.595	0.992	0.246	0.746	1.235	0.236	0.002	0.234
								0.605	0.992	0.241	0.751	1.245	0.216	0.002	0.214
0.615	0.992	0.232	0.76	1.255	0.185	0.002	0.183
								0.625	0.992	0.226	0.766	1.265	0.17	0	0.17
0.635	0.992	0.213	0.779	1.275	0.158	0	0.158
								0.645	0.988	0.206	0.782	1.285	0.143	0	0.143
0.66	0.988	0.197	0.791	1.295	0.131	0	0.131
								0.675	0.988	0.195	0.793	1.305	0.116	0	0.116
0.685	0.988	0.184	0.804	1.315	0.1	0	0.1
								0.695	0.988	0.18	0.808	1.325	0.085	0	0.085
0.705	0.988	0.178	0.81	1.345	0.077	0	0.077
								0.715	0.988	0.173	0.815	1.365	0.073	0	0.073
0.725	0.985	0.171	0.814	1.375	0.046	0	0.046
								0.735	0.985	0.167	0.818	1.39	0.039	0	0.039
0.745	0.985	0.154	0.831	1.405	0.027	0	0.027
								0.755	0.985	0.147	0.838	1.415	0.023	0	0.023
0.765	0.985	0.14	0.845	1.43	0.012	0	0.012

9. Assessment of specificity of blocking ELISA method

And (3) selecting standard positive serum of pathogen which has serious harm to the cattle industry at present, and carrying out blocking ELISA detection on the standard positive serum and the standard negative serum of IBRV at the same time. The positive sera of 5 bovine diseases were tested according to the blocking ELISA method established in "determination of test establishment conditions" of 7 (i.e., the blocking ELISA method of the present invention): the IBRV antibody is negative when the S/N is more than or equal to 0.885 and is positive when the S/N is less than 0.885. The results are shown in FIG. 16, except for the IBRV standard positive serum, the other 4 sera all show obvious negative reactions, which shows that the blocking ELISA method of the invention has no cross reaction with the 4 detected pathogens and has good specificity.

10. Sensitivity evaluation of blocking ELISA method

The blocking ELISA method is adopted to detect 40 parts of bovine serum (10 parts of IBRV antibody negative serum, 10 parts of IBRV antibody weak positive serum, 10 parts of IBRV antibody positive serum and 10 parts of IBRV antibody strong positive serum) and 30 parts of bovine serum positive for clinical infection IBRV antibody in a sample tray stored by the research center, wherein IBRV antibody is negative when S/N is more than or equal to 0.885, and IBRV antibody is positive when S/N is less than 0.885. The results are shown in Table 10, and the positive detection rate was 100% (60/60) and the negative detection rate was 100% (10/10).

TABLE 10 detection results of blocking ELISA method of the present invention on sample plate and clinically positive serum

Original numbering	Test number	Background of serum	OD value	S/N
					3	P1	Weak positive	0.646	0.679
10	P2	Weak positive	0.678	0.712
					11	P3	Weak positive	0.713	0.749
45	P4	Weak positive	0.608	0.639
					46	P5	Weak positive	0.612	0.643
47	P6	Weak positive	0.643	0.675
					63	P7	Weak positive	0.590	0.62
64	P8	Weak positive	0.634	0.666
					80	P9	Weak positive	0.583	0.612
81	P10	Weak positive	0.626	0.658
					169	P11	Positive for	0.284	0.298
180	P12	Positive for	0.409	0.43
					191	P13	Positive for	0.349	0.367
254	P14	Positive for	0.430	0.452
					2289	P15	Positive for	0.437	0.459
2294	P16	Positive for	0.330	0.347
					7125	P17	Positive for	0.274	0.288
7128	P18	Positive for	0.413	0.434
					9849	P19	Positive for	0.381	0.4
9868	P20	Positive for	0.329	0.346
					315	P21	Strong positive	0.068	0.071
318	P22	Strong positive	0.205	0.215
					364	P23	Strong positive	0.117	0.123
1724	P24	Strong positive	0.093	0.098
					1735	P25	Strong positive	0.167	0.175
2564	P26	Strong positive	0.167	0.175
					2578	P27	Strong positive	0.088	0.092
3655	P28	Strong positive	0.077	0.081
					3687	P29	Strong positive	0.061	0.064
14069	P30	Strong positive	0.146	0.153
					08194	N1	Negative of	0.880	0.924
08199	N2	Negative of	0.976	1.025
					08202	N3	Negative of	0.806	0.847
08209	N4	Negative of	1.175	1.234
					08217	N5	Negative of	0.816	0.857
08221	N6	Negative of	1.289	1.354
					08232	N7	Negative of	1.439	1.512
08242	N8	Negative of	1.355	1.423
					08249	N9	Negative of	0.931	0.978
08254	N10	Negative of	1.271	1.335
					12358	G1	Positive for infection	0.434	0.456
12364	G2	Positive for infection	0.265	0.278
					12368	G3	Positive for infection	0.306	0.321
12371	G4	Positive for infection	0.431	0.453
					12457	G5	Positive for infection	0.591	0.621
12546	G6	Positive for infection	0.150	0.158
					130014	G7	Positive for infection	0.085	0.089
130018	G8	Positive for infection	0.328	0.345
					130027	G9	Positive for infection	0.425	0.446
130031	G10	Positive for infection	0.384	0.403
					130034	G11	Positive for infection	0.370	0.389
140125	G12	Positive for infection	0.486	0.511
					140128	G13	Positive for infection	0.405	0.425
140122	G14	Positive for infection	0.339	0.356
					140129	G15	Positive for infection	0.603	0.633
140338	G16	Positive for infection	0.205	0.215
					140339	G17	Positive for infection	0.306	0.321
140442	G18	Positive for infection	0.430	0.452
					141132	G19	Positive for infection	0.053	0.056
141135	G20	Positive for infection	0.112	0.118
					141139	G21	Positive for infection	0.431	0.453
141147	G22	Positive for infection	0.242	0.254
					141151	G23	Positive for infection	0.335	0.352
160522	G24	Positive for infection	0.392	0.412
					160533	G25	Positive for infection	0.339	0.356
160544	G26	Positive for infection	0.083	0.087
					160577	G27	Positive for infection	0.497	0.522
151127	G28	Positive for infection	0.417	0.438
					151131	G29	Positive for infection	0.425	0.446
151137	G30	Positive for infection	0.526	0.552
						NC`X	/	0.952
	PC`X	/	0.136

Note: NC in table_{`X</sub>As a negative control (IBRV standard negative serum), PC<sub>`X}A positive control (IBRV standard positive serum) is indicated.

11. Sensitivity evaluation of blocking ELISA method

The bovine infectious rhinotracheitis virus antibody positive serum is diluted according to the ratio of 1:8, 1:16, 1:32, 1:64, 1:128, 1:256, 1:512 and 1:1024, and the diluted bovine infectious rhinotracheitis virus antibody positive serum is detected by the blocking ELISA method and the neutralization test (refer to the neutralization test step in the "determination of blocking ELISA threshold value of 8") of the present invention, so as to determine the sensitivity of the blocking ELISA method of the present invention. As shown in table 11, the sensitivity of the blocking ELISA method of the invention was 1:256, neutralization assay can detect 1: dilution of 32.

TABLE 11 sensitivity test for blocking ELISA method of the present invention

Note: NC in table_{`X</sub>As a negative control (IBRV standard negative serum), PC<sub>`X}A positive control (IBRV standard positive serum) is indicated. IDEXX kits refer to the results of detection using the us IDEXX IBRV gE antibody detection kit.

12. Reproducibility evaluation of blocking ELISA method

(1) Repeat in batch: 3 parts of IBRV standard positive serum and 2 parts of IBRV standard negative serum are detected by using the enzyme label plate coated with recombinant gD protein in the same batch, each serum is repeated for 5 times, and the batch repeatability and the plate repeatability of the blocking ELISA method are evaluated by calculating an S/N value, a standard deviation and a variation coefficient.

(2) Batch-to-batch repetition: and (3) detecting IBRV standard positive serum and 2 IBRV standard negative serum by using different batches of ELISA plates coated with recombinant gD protein, and evaluating the batch repeatability of the blocking ELISA method by calculating an S/N value, a standard deviation and a variation coefficient.

Batch-to-batch variability was determined by comparing the S/N values of 3 positive sera and 2 negative sera. The blocking ELISA method of the invention is used for repeatedly detecting 5 parts of serum between the same ELISA plate and three different ELISA plates. The results are shown in Table 12, where the S/N values between batches had a coefficient of variation of 2.69% to 8.3%, with an average value of 4.16%, the S/N values between batches had a coefficient of variation of 2.9% to 4.6%, and an average value of 3.64%. The above data show that the blocking ELISA method established by the present invention has good repeatability.

TABLE 12 reproducibility of the blocking ELISA method of the invention

13. Assessment of compliance with blocking ELISA method

715 bovine sera were tested using the blocking ELISA method of the invention and the american IDEXX IBRV gE antibody test kit (see procedures in the kit instructions), respectively, and the compliance of the blocking ELISA method was evaluated by analyzing the total compliance and consistency between the methods. The inter-method consistency is analyzed by introducing a Kappa statistic, and generally the higher the Kappa value, the better the consistency of the two methods. The results of the comparison of the blocking ELISA method of the present invention with the commercial kit are shown in Table 13, the total coincidence rate of the two methods is 93.85%, and the Kappa is 0.992 (P < 0.001), indicating that the two methods have a high coincidence rate.

TABLE 13 comparison of compliance of the blocking ELISA method of the invention with commercial kits

Example 3 preparation of ELISA kit for detecting antibody against infectious bovine rhinotracheitis Virus

Assembling a kit: the recombinant gD protein (the recombinant gD protein prepared in example 1), an enzyme label plate, a confining liquid (chicken serum), an enzyme-labeled monoclonal antibody (the HRP-labeled anti-IBRV monoclonal antibody prepared in example 2, the preservation number of a hybridoma cell secreting the monoclonal antibody is CGMCC number 21015), a TMB color development liquid and a stop solution (2M H)₂SO₄) And respectively and aseptically packaging, then completely packaging into the kit, and attaching a kit label on a kit shell. The recombinant gD protein is pre-coated onto the microplate, or is packaged separately from the microplate, and is coated by the user immediately prior to use.

The use method of the kit comprises the following steps:

(1) coating: preparing a recombinant gD protein solution with the concentration of 2.5-5 mu g/mL by using 0.1M Tris-HCL buffer solution with the pH value of 8.5, adding the recombinant gD protein solution into an ELISA plate according to the concentration of 100 mu L/hole, incubating for 1h at 37 ℃, and coating overnight at 4 ℃.

(2) Washing the plate: washing with plate washing machine for 5 times, adding 350 μ L PBST per hole, and completely removing residual washing liquid on absorbent paper after washing.

(3) And (3) sealing: mu.L of 5% (v/v) chicken serum (PBST diluted) was added to each well and blocked for 2h at 37 ℃.

(4) Washing the plate: the same as (2).

(5) Sample adding: the serum sample to be detected is diluted by PBST at a ratio of 1:2, and then incubated for 1h at a temperature of 37 ℃ at a concentration of 100 mu L/well.

(6) Washing the plate: the same as (2).

(7) A first antibody: PBST is used for preparing enzyme labeled monoclonal antibody solution with the concentration of 0.54-2.15 mug/mL, 100 mug/hole is used for incubation for 1h at 37 ℃.

(8) Washing the plate: the same as (2).

(9) Color development: adding TMB single-component color development liquid, developing at 100 μ L/hole in a dark place at 37 deg.C for 15 min.

(10) And (4) terminating: plus 2M H₂SO₄50 mu L/hole, and after gently mixing, reading the light absorption value at OD450 in a microplate reader.

(11) And (4) judging a result: the ratio of the OD450 of the sample well to the OD450 of the negative control well is the S/N value; if the S/N value is more than or equal to 0.885, the sample does not contain the antibody of the infectious bovine rhinotracheitis virus; if the S/N value is less than 0.885, the sample contains antibody of bovine infectious rhinotracheitis virus.

Example 4 use of blocking ELISA kit for detection of neutralizing antibodies to infectious bovine rhinotracheitis Virus

1. Blocking ELISA method and neutralization test conformity evaluation

715 bovine sera were tested using the neutralization assay (see neutralization assay step in "determination of blocking ELISA threshold" above) and the blocking ELISA kit of the invention (example 3), respectively, and the compliance of the blocking ELISA method was evaluated by analyzing the total compliance rate and consistency between the methods. The results are shown in Table 14, where the total agreement for both methods is 99.58% and Kappa is 0.991 (P < 0.001), indicating that both methods have very high agreement.

TABLE 14 comparison of the compliance of the blocking ELISA method of the invention with the neutralization assay

2. Evaluation of the immune Effect of vaccines

The blocking ELISA kit of the present invention (example 3) was used to test the sera of 59 healthy immunized cattle collected from different immunization stages in the Dacron cattle farm in Beijing, using the neutralization test (see the neutralization test procedure in "8. determination of blocking ELISA threshold" above), respectively, and a protocol for evaluating the immune effect of the bovine IBRV vaccine was established by comparing the neutralization titers of these sera with the S/N value of the blocking ELISA method.

The results are shown in FIG. 17, and we have establishedS/N values of blocking ELISA as a function of log2 values of serum neutralization titers: y = 9.3161e^-2.335x(R = 0.9795), which shows that the blocking ELISA method of the present invention can replace neutralization assay to be a fast and sensitive new method for evaluating vaccine immunization effect. In addition, the neutralizing antibody titer of the sera tested by us is more than 1:8, the lowest titer of the vaccine protection is determined by calculating the difference between the average value of S/N and 3 times of standard deviation, and the result shows that the antibody produced by the vaccine can effectively protect the host when the S/N value is not higher than 0.68.

In the above experiments, the optimal antigen-antibody usage, the optimal coating condition, the optimal blocking condition, and the N/P value of serum dilution, the normal distribution of the judgment test establishment condition, and the specificity, sensitivity, repeatability, and compliance rate in the blocking ELISA evaluation were all calculated and analyzed by Microsoft excel's CORREL when the blocking ELISA method was established; the T test, ROC curve and Kappa value of the blocking activity of the monoclonal antibody were calculated by the software SPSS 20.

Sequence listing

<110> agriculture and forestry academy of sciences of Beijing City

<120> blocking ELISA kit for detecting neutralizing antibody of infectious bovine rhinotracheitis virus and application thereof

<130> P200902-NLK

<160> 7

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1029

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

atggtgacgg tatacgtcga cccgccggcg tacccgatgc cgcgatacaa ctacactgaa 60

cgctggcaca ctaccgggcc cataccgtcg cccttcgcag acggccgcga gcagcccgtc 120

gaggtgcgct acgcgacgag cgcggcggcg tgcgacatgc tggcgctgat cgcagacccg 180

caggtggggc gcacgctgtg ggaagcggta cgccggcacg cgcgcgcgta caacgccacg 240

gtcatatggt acaagatcga gagcgggtgc gcccggccgc tgtactacat ggagtacacc 300

gagtgcgagc ccaggaagca ctttgggtac tgccgctacc gcacaccccc gttttgggac 360

agcttcctgg cgggcttcgc ctaccccacg gacgacgagc tgggactgat tatggcggcg 420

cccgcgcggc tcgtcgaggg ccagtaccga cgcgcgctgt acatcgacgg cacggtcgcc 480

tatacagatt tcatggtttc gctgccggcc ggggactgct ggttctcgaa actcggcgcg 540

gctcgcgggt acacctttgg cgcgtgcttc ccggcccggg attacgagca aaagaaggtt 600

ctgcgcctga cgtatctcac gcagtactac ccgcaggagg cacacaaggc catagtcgac 660

tactggttca tgcgccacgg gggcgtcgtt ccgccgtatt ttgaggagtc gaagggctac 720

gagccgccgc ctgccgccga tgggggttcc cccgcgccac ccggcgacga cgaggcccgc 780

gaggatgaag gggagaccga ggacggggca gccgggcggg agggcaacgg cggcccccca 840

ggacccgaag gcgacggcga gagtcagacc cccgaagcca acggaggcgc cgagggcgag 900

ccgaaacccg gccccagccc cgacgccgac cgccccgaag gctggccgag cctcgaagcc 960

atcacgcacc ccccgcccgc ccccgctacg cccgcggccc ccgacgccgt gccggtcagc 1020

gtcgggatc 1029

<210> 2

<211> 343

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 2

Met Val Thr Val Tyr Val Asp Pro Pro Ala Tyr Pro Met Pro Arg Tyr

1 5 10 15

Asn Tyr Thr Glu Arg Trp His Thr Thr Gly Pro Ile Pro Ser Pro Phe

20 25 30

Ala Asp Gly Arg Glu Gln Pro Val Glu Val Arg Tyr Ala Thr Ser Ala

35 40 45

Ala Ala Cys Asp Met Leu Ala Leu Ile Ala Asp Pro Gln Val Gly Arg

50 55 60

Thr Leu Trp Glu Ala Val Arg Arg His Ala Arg Ala Tyr Asn Ala Thr

65 70 75 80

Val Ile Trp Tyr Lys Ile Glu Ser Gly Cys Ala Arg Pro Leu Tyr Tyr

85 90 95

Met Glu Tyr Thr Glu Cys Glu Pro Arg Lys His Phe Gly Tyr Cys Arg

100 105 110

Tyr Arg Thr Pro Pro Phe Trp Asp Ser Phe Leu Ala Gly Phe Ala Tyr

115 120 125

Pro Thr Asp Asp Glu Leu Gly Leu Ile Met Ala Ala Pro Ala Arg Leu

130 135 140

Val Glu Gly Gln Tyr Arg Arg Ala Leu Tyr Ile Asp Gly Thr Val Ala

145 150 155 160

Tyr Thr Asp Phe Met Val Ser Leu Pro Ala Gly Asp Cys Trp Phe Ser

165 170 175

Lys Leu Gly Ala Ala Arg Gly Tyr Thr Phe Gly Ala Cys Phe Pro Ala

180 185 190

Arg Asp Tyr Glu Gln Lys Lys Val Leu Arg Leu Thr Tyr Leu Thr Gln

195 200 205

Tyr Tyr Pro Gln Glu Ala His Lys Ala Ile Val Asp Tyr Trp Phe Met

210 215 220

Arg His Gly Gly Val Val Pro Pro Tyr Phe Glu Glu Ser Lys Gly Tyr

225 230 235 240

Glu Pro Pro Pro Ala Ala Asp Gly Gly Ser Pro Ala Pro Pro Gly Asp

245 250 255

Asp Glu Ala Arg Glu Asp Glu Gly Glu Thr Glu Asp Gly Ala Ala Gly

260 265 270

Arg Glu Gly Asn Gly Gly Pro Pro Gly Pro Glu Gly Asp Gly Glu Ser

275 280 285

Gln Thr Pro Glu Ala Asn Gly Gly Ala Glu Gly Glu Pro Lys Pro Gly

290 295 300

Pro Ser Pro Asp Ala Asp Arg Pro Glu Gly Trp Pro Ser Leu Glu Ala

305 310 315 320

Ile Thr His Pro Pro Pro Ala Pro Ala Thr Pro Ala Ala Pro Asp Ala

325 330 335

Val Pro Val Ser Val Gly Ile

340

<210> 3

<211> 1047

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

atggtgacgg tatacgtcga cccgccggcg tacccgatgc cgcgatacaa ctacactgaa 60

cgctggcaca ctaccgggcc cataccgtcg cccttcgcag acggccgcga gcagcccgtc 120

gaggtgcgct acgcgacgag cgcggcggcg tgcgacatgc tggcgctgat cgcagacccg 180

caggtggggc gcacgctgtg ggaagcggta cgccggcacg cgcgcgcgta caacgccacg 240

gtcatatggt acaagatcga gagcgggtgc gcccggccgc tgtactacat ggagtacacc 300

gagtgcgagc ccaggaagca ctttgggtac tgccgctacc gcacaccccc gttttgggac 360

agcttcctgg cgggcttcgc ctaccccacg gacgacgagc tgggactgat tatggcggcg 420

cccgcgcggc tcgtcgaggg ccagtaccga cgcgcgctgt acatcgacgg cacggtcgcc 480

tatacagatt tcatggtttc gctgccggcc ggggactgct ggttctcgaa actcggcgcg 540

gctcgcgggt acacctttgg cgcgtgcttc ccggcccggg attacgagca aaagaaggtt 600

ctgcgcctga cgtatctcac gcagtactac ccgcaggagg cacacaaggc catagtcgac 660

tactggttca tgcgccacgg gggcgtcgtt ccgccgtatt ttgaggagtc gaagggctac 720

gagccgccgc ctgccgccga tgggggttcc cccgcgccac ccggcgacga cgaggcccgc 780

gaggatgaag gggagaccga ggacggggca gccgggcggg agggcaacgg cggcccccca 840

ggacccgaag gcgacggcga gagtcagacc cccgaagcca acggaggcgc cgagggcgag 900

ccgaaacccg gccccagccc cgacgccgac cgccccgaag gctggccgag cctcgaagcc 960

atcacgcacc ccccgcccgc ccccgctacg cccgcggccc ccgacgccgt gccggtcagc 1020

gtcgggatcc atcaccatca ccatcac 1047

<210> 4

<211> 42

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

cggcgcattc tgcctttgcg catatgatgg tgacggtata cg 42

<210> 5

<211> 43

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

cttgtggtgg tggtggtggt gctcgaggat cccgacgctg acc 43

<210> 6

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

cccagtcacg acgttgtaaa acg 23

<210> 7

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

agcggataac aatttcacac agg 23

Claims (10)

1. The monoclonal antibody with neutralizing activity for resisting the infectious bovine rhinotracheitis virus is secreted by hybridoma cells with the preservation number of CGMCC number 21015.

2. A hybridoma cell strain secreting the monoclonal antibody of claim 1, having a collection number of CGMCC number 21015.

3. A kit for detecting neutralizing antibodies against infectious bovine rhinotracheitis virus, comprising the monoclonal antibody having neutralizing activity against infectious bovine rhinotracheitis virus of claim 1.

4. The kit of claim 3, wherein: the kit also comprises truncated gD protein of the infectious bovine rhinotracheitis virus, and the amino acid sequence of the truncated gD protein is shown as SEQ ID NO. 2.

5. The kit of claim 4, wherein: the kit also comprises an enzyme label plate; the truncated gD protein is pre-coated on an ELISA plate or coated on an ELISA plate just before use.

6. The kit of claim 5, wherein: the coating amount of the truncated gD protein on the ELISA plate is 0.25-0.5 mu g/hole.

7. The kit of claim 5, wherein: the coating solution of the truncated gD protein was 0.1M Tris-HCl buffer, pH 8.5.

8. The kit of claim 6, wherein: the working concentration of the monoclonal antibody is 0.54-2.15 mu g/mL.

9. The kit according to any one of claims 3 to 8, wherein: the kit also comprises a sealing solution, a washing solution, a developing solution and a stop solution; the confining liquid is 5% chicken serum.

10. A blocking ELISA method for the detection of neutralizing antibodies to infectious bovine rhinotracheitis virus, not for diagnostic purposes, characterized in that: the use of the kit according to any one of claims 4 to 9 for detection, comprising the steps of:

(1) dissolving the truncated gD protein by using 0.1M Tris-HCL buffer solution with the pH value of 8.5, then adding the solution into an ELISA plate, and incubating, wherein the protein coating amount is 0.25-0.5 mu g/hole; washing an enzyme label plate;

(2) adding 5% chicken serum, and sealing; washing an enzyme label plate;

(3) diluting a serum sample to be detected by 2 times, adding the diluted serum sample into an enzyme label plate, and incubating; washing an enzyme label plate;

(4) making the monoclonal antibody carry a color mark, preparing an antibody solution with the concentration of 0.54-2.15 mu g/mL, adding the antibody solution into an ELISA plate, and incubating; washing an enzyme label plate;

(5) adding a color development liquid for color development;

(6) adding a stop solution, slightly and uniformly mixing, and reading a light absorption value at 450nm in an enzyme-linked immunosorbent assay;

(7) the ratio of the OD450 of the sample well to the OD450 of the negative control well is the S/N value; if the S/N value is more than or equal to 0.885, the sample does not contain the antibody of the infectious bovine rhinotracheitis virus; if the S/N value is less than 0.885, the sample contains antibody of bovine infectious rhinotracheitis virus.

Images