CN113461792A - Phytophthora capsici regulates and controls extracellular vesicle secretion key protein and coding gene and application thereof - Google Patents

Abstract

The invention discloses key proteins Pcec 4-1 and Pcec 4-2 for regulating secretion of extracellular vesicles from phytophthora capsici, and a coding gene and application thereof. The sequence of the key protein for regulating vesicle secretion provided by the invention is shown as a sequence 2 and a sequence 4; the coding gene is shown as sequence 1 and sequence 3. Experiments prove that the protein provided by the invention plays an important role in the growth and development process of Phytophthora capsici (Phytophthora capsicii), and the specific expression is that Phytophthora capsici hypha growth is slowed down, the number of zoospores is reduced, the pathogenicity is reduced, the secretion of extracellular vesicles is reduced and the like after the protein is deleted. The conclusion provides a technical basis for researching the development and pathogenic molecular mechanism of the phytophthora capsici and provides a potential molecular target for the research and development of a novel bactericide in the future.

Description

Phytophthora capsici regulates and controls extracellular vesicle secretion key protein and coding gene and application thereof

Technical Field

The invention belongs to the technical field of biology, and particularly relates to homologous Proteins Pcec 4-1 and Pcec 4-2 of a key protein Sec4(Small GTPase Family Proteins) protein for regulating and controlling extracellular vesicle secretion from Phytophthora capsici (Phytophthora capsicii), and a coding gene and application thereof.

Background

Phytophthora capsici is an important phytopathogen of oomycetes, which was first isolated from capsicum in 1918, 1922 and was named p.capsici Leonian by Leon h.leonian (Hausbeck and Lamour, 2004). On a taxonomic place, Phytophthora capsici belongs to the kingdom of algae (Chromista), the phylum Oomycetes (Oomycotes), the order Peronosporales (Peronosporaes), the family Peronosporaceae (Peronosporae), the genus Phytophthora (Phytophthora). Phytophthora capsici is a pathogenic bacterium distributed worldwide, and has wide host range and serious harm. More than 70 plants of the solanaceae, cucurbitaceae, leguminosae, etc. can be infected (Granke et al, 2012). After phytophthora capsici infects capsicums, the yield and quality of the capsicums are seriously affected, and the capsicums threaten crop production worldwide, and cause annual loss of the vegetable industry all over the world by up to $ 10 hundred million (Erwin and Ribeiro, 1996; Lamour et al, 2012). At present, the pathogenic oomycetes are classified into one of ten kinds of pathogenic oomycetes, and are widely concerned and researched by scholars at home and abroad.

Phytophthora capsici is a typical semi-biotrophic pathogen, and the Phytophthora capsici is a biotrophic pathogen at the early stage of infection, can release a large amount of pathogenic factors to inhibit plant immune reaction, and draws nutrition to promote the growth of the pathogen; late phytophthora capsici is a dead body nutritional type, produces a large amount of sporangia in plant cells, kills host cells, and releases sporangia to become a re-infection source (Tyler, 2006). Researches on the interaction of pathogenic bacteria and plants show that a plurality of pathogenic bacteria of phytophthora can release a large amount of pathogenic factors to promote the infection of the pathogenic bacteria in the infection process. These pathogenic agents include: 1) cell wall degrading enzymes, 2) secondary metabolite synthases, 3) proteases, 4) lipases, 5) toxin proteins, 6) ABC transporter proteins, and 7) effector proteins (Tyler, 2006).

Extracellular Vesicles (EVs) are a class of subcellular structures with a phospholipid bilayer membrane coating within which a cytoplasmic matrix and a variety of bioactive molecules are encapsulated, which are released by the cell into the extracellular environment (Latge et al, 2005; Nimrichter et al, 2005; Mitchell et al, 2006). Studies on the contents of extracellular vesicles have found that they can transport a variety of biologically active substances including carbohydrates, proteins, lipids, pigments, and nucleic acids (DNA, mRNA, sRNA), among others (Marina Colombo et al, 2014). The biological function research of the extracellular vesicles shows that the extracellular vesicles can transport a large number of pathogenic factors and play an important role in regulation and control in the physiology and pathogenic process of pathogenic bacteria. Recent studies have also found that extracellular vesicles also play an important role in plant and pathogen interaction and in trans-border material transport (Cai et al, 2018).

Phytophthora capsici can be infected and attacked in the whole plant growth cycle and multiple parts, mainly including roots, stems, leaves and fruits (Babadoost,2000), causing the symptoms of plant damping-off, wilting and fruit rot. Phytophthora capsici has high growth and propagation speed and large spore yield, and once the phytophthora capsici attacks in the field, the prevention and treatment difficulty is high and the phytophthora capsici is not easy to be cured radically. In the current study of phytophthora capsici resistance inheritance on capsicum, several important quantitative trait loci are found and defined (quelada-Ocampo, 2010).

However, the variety of resistant varieties in crops which are commercially cultivated at present is limited and the stability of resistance is poor, and chemical control is still the main control method in growth. Therefore, the opening of a novel medicament for preventing and treating the effective molecular target of the oomycetes has very important significance for preventing and treating the infection of the diseases of the oomycetes and ensuring the healthy growth of agricultural crops.

Disclosure of Invention

Through the research of the inventor, the Pcec 4-1 in the phytophthora capsici is closely related to the normal growth of the phytophthora capsici in vegetative growth stages such as hypha growth rate, zoospore release and germination of the resting spores. Disruption of the Pcec 4-1 gene resulted in a decrease in the production of extracellular vesicles and interfered with the pathogenicity of Phytophthora capsici under ex vivo conditions. Another functional study of the homologous gene Pcec 4-2 found that the gene was knocked out and then killed. These results indicate that the Pcec 4-1 and Pcec 4-2 proteins in P.capsici have important regulatory effects on the physiology and pathogenesis of pathogenic bacteria. The gene is developed as a molecular medicament target of pathogenic oomycete phytophthora capsici and has important application prospect.

Therefore, one of the objects of the present invention is to provide a protein of phytophthora capsici which regulates secretion of key proteins (Sec4 protein) from extracellular vesicles, and which is designated as Pcsec4-1 and Pcsec4-2, derived from phytophthora capsici strain LT1534, and is a1) or a2) A3) or a 4):

is A1) or A2) or A3) or A4) as follows:

A1) the amino acid sequence is the protein shown as the sequence 2 or 4;

A2) a fusion protein obtained by connecting a label to the N end and/or the C end of the protein shown as the sequence 2 or 4;

A3) protein derived from the protein shown in the sequence 2 or 4 with the same function, which is obtained by substituting and/or deleting and/or adding one or more amino acid residues of the amino acid sequence shown in the sequence 2 or 4;

A4) an amino acid sequence which has similarity of more than 75%, preferably more than 85%, more preferably more than 95% with the amino acid sequence shown in the sequence 2 or 4 and has the same function with the amino acid sequence shown in the sequence 2 or 4.

In order to facilitate the purification of the protein in A1), labels such as Poly-Arg (RRRRRRR), Poly-His (HHHHHHHHHHHH), FLAG (DYKDDDDK), Strep-tag II (WSHPQFEK), c-myc (EQKLISEEDL) and the like can be connected to the amino terminal or the carboxyl terminal of the protein consisting of the amino acid sequence shown in the sequence 2 or 4 in the sequence table.

The protein in A1) -A4) can be artificially synthesized, or can be obtained by synthesizing the coding gene and then carrying out biological expression. The coding gene of the protein in A2) -A4) can be obtained by deleting one or more codons of amino acid residues in the DNA sequence shown in the sequence 1 or 3 in the sequence table, and/or carrying out missense mutation of one or more nucleotide pairs, and/or connecting the coding sequence of the label at the 5 'end and/or the 3' end.

Wherein, in A1), the sequence 2 (Pcesec 4-1) in the sequence table is composed of 207 amino acid residues; sequence 4 (Pcec 4-2) in the sequence listing consists of 202 amino acid residues.

It is another object of the present invention to provide nucleic acid molecules encoding the desired Sec4 protein. The nucleic acid molecule may be DNA, such as cDNA, genomic DNA or recombinant DNA; the nucleic acid molecule can also be an RNA, such as an mRNA, hnRNA, or tRNA, and the like.

Wherein, the coding gene of the Sec4 protein is B1) or B2) or B3):

B1) a DNA molecule shown by a nucleotide sequence shown in a sequence 1 or 3 in a sequence table;

B2) a cDNA molecule or DNA molecule having 75% or more or 85% or more or 95% or more identity to the nucleotide sequence represented by B1) and encoding the aforementioned Pcesec 4-1 or Pcesec 4-2 protein;

B3) a cDNA molecule or a DNA molecule which hybridizes with the nucleotide sequence limited by B1) or B2) under strict conditions and codes the Pcesec 4-1 or Pcesec 4-2 protein.

The sequence 1 in the sequence table of the coding gene consists of 624 nucleotides; the 1 st to 624 th nucleotides from the 5' end of the sequence 1 are coding sequences and code a protein Pcesec 4-1 shown in a sequence 2 in a sequence table. Sequence 3 in the sequence table consists of 609 nucleotides; the 1 st to 609 th nucleotides from the 5' end of the sequence 1 are coding sequences and code a protein Pcesec 4-2 shown in a sequence 4 in a sequence table.

The RNA molecule is obtained by transcription of the coding gene;

preferably, the sequence of the RNA molecule is C1) or C2) as follows:

C1) an RNA sequence which has a similarity of 75% or more, more preferably 85% or more, and still more preferably 95% or more to an RNA sequence transcribed from a DNA sequence represented by SEQ ID No.1 or SEQ ID No.3 and has the same function as an RNA sequence transcribed from a DNA sequence represented by SEQ ID No.1 or SEQ ID No. 3;

C2) RNA sequence transcribed from the DNA sequence shown in sequence 1.

The DNA sequence of the invention can be molecularly hybridized with the DNA sequence shown as the sequence 1 or 3 under strict conditions and encodes the DNA sequence of the protein shown as the sequence 2 or 4. The stringent conditions may be hybridization with a solution of 6 XSSC, 0.5% SDS at 65 ℃ followed by washing the membrane once with each of 2 XSSC, 0.1% SDS and 1 XSSC, 0.1% SDS.

It is a further object of the present invention to provide biological materials related to the above-mentioned nucleic acid molecules, including recombinant vectors, expression cassettes, recombinant microorganisms or transgenic plant cell lines. The recombinant vector can be a recombinant expression vector and can also be a recombinant cloning vector. In the above biological material, the vector may be a plasmid, a cosmid, a phage, or a viral vector; the microorganism can be yeast, bacteria, algae or fungi, such as Agrobacterium; the transgenic plant cell line does not include propagation material. Specifically, any one of the following D1) to D10) may be mentioned as follows:

D1) an expression cassette containing the encoding gene;

D2) a recombinant vector containing the encoding gene or a recombinant vector containing the expression cassette of D1);

D3) a recombinant microorganism containing the encoding gene, or a recombinant microorganism containing D1) the expression cassette, or a recombinant microorganism containing D2) the recombinant vector;

D4) a transgenic plant cell line containing the coding gene or a transgenic plant cell line containing the expression cassette of D1);

D5) transgenic plant tissue containing the coding gene or transgenic plant tissue containing the expression cassette of D2);

D6) a transgenic plant organ containing said encoding gene, or a transgenic plant organ containing the expression cassette of D2);

D7) a nucleic acid molecule that inhibits expression of the encoded gene;

D8) an expression cassette, a recombinant vector, a recombinant microorganism or a transgenic plant cell line comprising the nucleic acid molecule of D7);

D9) a nucleic acid molecule that inhibits translation of the RNA molecule;

D10) producing an expression cassette, a recombinant vector, a recombinant microorganism or a transgenic plant cell line of D9) said nucleic acid molecule.

The fifth object of the present invention is to provide the use of a Phytophthora capsici Pcec 4-1 or Pcec 4-2 protein and a nucleic acid molecule encoding a Pcec 4-1 or Pcec 4-2 protein or a biological material comprising a nucleic acid molecule encoding a Pcec 4-1 or Pcec 4-2 protein.

The application is any one or more of the following 1) to 6):

1) the application in regulating (such as reducing) phytophthora capsici zoospore yield;

2) the application of the compound in regulating (such as reducing) the growth rate of phytophthora capsici mycelium;

3) the application of the phytophthora capsici resting spore in regulating (such as reducing) germination and host infection capacity;

4) the application of the compound in regulating (such as reducing) the yield of the phytophthora capsici extracellular vesicles;

5) use in modulating (e.g. reducing) the pathogenicity of Phytophthora capsici to a host;

6) the application in inhibiting and/or killing phytophthora capsici;

preferably, wherein, the application comprises inhibiting or inactivating the transcription of the coding gene of the sequence 1 or 3, or inhibiting the translation of the RNA molecule, or inhibiting and/or inactivating the activity of the Pcesec 4-1 or Pcesec 4-2 protein of the sequence 2 or 4 to realize the application of 1) -6).

In the application, the phytophthora capsici extracellular vesicle yield is regulated and controlled by inhibiting the transcription of the coding gene, or inhibiting the translation of the RNA sequence, or inhibiting and/or inactivating the activity of the Pcec 4-1 or Pcec 4-2 protein, the growth rate of hyphae is interfered, the zoospore yield is influenced, the germination of the resting spores is controlled, and the host infection capacity is regulated, so that the growth of phytophthora capsici can be inhibited and/or killed.

The sixth purpose of the invention is to provide the application of the protein Pcesec 4-1 or Pcesec 4-2 shown in the sequence 2 or the sequence 4 in the sequence table and the coding gene shown in the sequence 1 or the sequence 3 in screening the phytophthora capsici as the target of the bacteriostasis or the bactericide.

The seventh purpose of the invention is to provide a method for screening or auxiliary screening of phytophthora capsici bacteriostasis and/or bactericide, which comprises applying an object to be detected to the phytophthora capsici, wherein when the object to be detected can inhibit the transcription of the DNA sequence, or inhibit the translation of the RNA sequence, or inhibit and/or inactivate the Pcesec 4-1 or Pcesec 4-2 protein, the object to be detected is a candidate phytophthora capsici bacteriostat and/or bactericide.

The invention aims at providing a method for reducing the activity of phytophthora capsici, which comprises the following steps: inhibiting transcription or deleting the coding gene as described above, or inhibiting translation of the RNA molecule, or inhibiting and/or inactivating the activity of the Pcesec 4-1 or Pcesec 4-2 protein as described above;

the activity of the phytophthora capsici is reduced, namely the infection capacity and/or pathogenicity of the phytophthora capsici to a host are reduced, and/or the growth speed of the thallus of the phytophthora capsici is reduced, and/or the yield of zoospores of the phytophthora capsici is inhibited, and/or the germination of the resting spores of the phytophthora capsici is inhibited, and/or the secretion of extracellular vesicles of the phytophthora capsici is inhibited.

In the above method, the inactivation of the protein is achieved by inhibiting or reducing the expression of a gene encoding the activity to be inhibited or the protein to be inactivated, specifically, by gene knockout or by gene silencing.

The gene knockout refers to a phenomenon in which a specific target gene is inactivated by homologous recombination. Gene knockout is the inactivation of a specific target gene by a change in the DNA sequence.

The gene silencing refers to the phenomenon that a gene is not expressed or is under expression on the premise of not damaging the original DNA. Gene silencing can occur at two levels, one at the transcriptional level due to DNA methylation, differential staining, and positional effects, and the other post-transcriptional gene silencing, i.e., inactivation of a gene at the post-transcriptional level by specific inhibition of a target RNA, including antisense RNA, co-suppression (co-suppression), gene suppression (quelling), RNA interference (RNAi), and micro-RNA (mirna) -mediated translational suppression, among others.

Preferably, the gene shown as the sequence 1 or 3 in the sequence table in the phytophthora capsici is subjected to gene knockout so as to inactivate the protein shown as the sequence 2 or 4 in the sequence table;

in one embodiment of the invention, the method for knocking out the gene is based on the gene knocking out method of CRISPR/Cas9.

Specifically, the gene knock-out method based on CRISPR/Cas9 is to obtain the recombinant bacteria inactivated by the target knock-out protein by screening the target gene Donor vector, sgRNA expression vector and Cas9 expression plasmid transfected phytophthora capsici.

The Donor vector is a recombinant vector containing a sequence of 800-1500bp upstream of the target gene to be knocked out, a Dodor DNA sequence (which can be a gene sequence such as NPTII or GFP or RFP) and a sequence of 800-1500bp downstream of the target gene to be knocked out, which are connected in sequence.

The sgRNA expression plasmid is a sgRNA fragment vector for expressing a target gene to be knocked out, wherein the target gene to be knocked out is Pcec 4-1 and Pcec 4-2 genes, and the sgRNA sequence targeting the Pcec 4-1 gene is sgSec 4-1: CTCCTGCTGATCGGAGACAG, respectively; sgRNA sequence targeting Pcsec4-2 gene sgSec 4-2: GAAGGTGAAGCTGCAGATCT are provided.

Preferably, the sgRNA expression plasmid is obtained by taking a pYF2.3G-Ribo-sgRNA vector as a starting vector, annealing sgRNA of a Pcesec 4-1 or Pcesec 4-2 gene to obtain a double-stranded sgRNA coding sequence, and inserting the double-stranded sgRNA coding sequence between Nhe I and Bsa I enzyme recognition sites of the pYF2.3G-Ribo-sgRNA vector.

The application of the substance for inhibiting the expression and/or activity of the Pcesec 4-1 or Pcesec 4-2 protein in preparing the phytophthora capsici fungicide also belongs to the protection scope of the invention.

In the above-mentioned applications, the substance inhibiting the expression and/or activity of the Pcesec 4-1 or Pcesec 4-2 protein is a substance inhibiting the expression of the Pcesec 4-1 or Pcesec 4-2 protein and/or inhibiting the transcription of a gene encoding the Pcesec 4-1 or Pcesec 4-2 protein and/or inhibiting the translation of an RNA molecule transcribed from a gene encoding the Pcesec 4-1 or Pcesec 4-2 protein.

Experiments prove that the Pcec 4-1 or Pcec 4-2 protein provided by the invention plays a role in the growth and development process of phytophthora capsici. Compared with a wild parent strain, the growth and development of the knockout mutant obtained by the CRISPR/Cas9 gene editing technology are obviously changed, and the knockout mutant mainly comprises the following components: pcec 4-2 gene single knockout mutant strain lethal; the single knockout of the Pcec 4-1 gene resulted in slower growth rate of hyphae, lower zoospore production, decreased exocytosis of extracellular vesicles, and a diminished ability to infect host plants. Therefore, the Pcec 4-1 or Pcec 4-2 protein in the phytophthora capsici can play an important role in a plurality of processes such as vegetative growth, asexual reproduction and host infection of the phytophthora capsici. The invention provides technical support for the research of pathogenic mechanisms of phytophthora capsici and provides a potential molecular action target for the research and development of novel bactericides in the future.

Drawings

FIG. 1 is a histogram of colony diameters of Phytophthora capsici strain BYA5(WT), knockout empty vector control transformant (CK), Pcesec 4-1 single knockout transformants KD-1, KD-2 strain (cultured on V8 solid medium for 3 days); in FIG. 1, A is a histogram and B is a photograph of a colony. WT represents the parent strain; CK represents a knockout empty vector strain; KD-1 and KD-2 represent 2 homozygous knockout transformants.

FIG. 2 is a bar graph of the results of sporangium production, zoospore production, resting spore germination, and pathobiology trait assays for Phytophthora capsici strain BYA5(WT), an empty vector control strain, and a Pcesec 4-1 single knockout transformant. In the figure, A is the sporangial yield; b is zoospore release amount; c is the germination quantity of the resting spores; d is the pathogenicity of the in vitro tobacco leaves. WT represents the parent strain; CK represents a knockout empty vector; KD-1 and KD-2 represent 2 homozygous knockout transformants. The Turkey method was used to calculate the significant differences between wild-type strains and transformants (. P < 0.01).

FIG. 3 is a picture of pathogenicity of zoospores of a phytophthora capsici strain BYA5(WT), knockout empty vector control transformant CK, and single knockout transformants KD-1 and KD-2 strains of Pcesec 4-1. WT represents the parent strain; CK represents a knockout empty vector; KD-1 and KD-2 represent 2 homozygous knockout transformants.

FIG. 4 is a bar graph of extracellular vesicle yields of a strain of C.capsorum BYA5(WT), a knockout empty vector control transformant (CK), and single knockout transformants KD-1 and KD-2 of Pcesec 4-1.

Detailed Description

The following examples facilitate a better understanding of the invention, but do not limit it. The experimental procedures in the following examples are conventional unless otherwise specified. Materials, reagents and the like used in the following examples are commercially available unless otherwise specified.

Phytophthora capsici strain LT 1534: standard strains presented to professor Brett m.tyler, oregon state university, usa, were deposited at the seed pathology and fungicide pharmacology laboratory, the institute of plant protection, chinese agriculture university, and publicly available from chinese agriculture university.

Culture medium or reagent formula:

the culture preparation method used in the test is as follows:

10% V8 solid medium: 100ml of V8 raw juice is added with 1.4g of calcium carbonate, 15g of agarose and deionized water to be constant volume to 1l, and sterilized for 20min at 121 ℃.

LB liquid medium: 10g of tryptone, 5g of yeast extract, 10g of sodium chloride and deionized water are added until the volume is 1l, and the mixture is sterilized at 121 ℃ for 20 min.

LB solid medium: 10g of tryptone, 5g of yeast extract and 10g of sodium chloride, 15g of agarose is added, deionized water is added until the volume is 1l, the mixture is sterilized at 121 ℃ for 20 min.

Pea Mannitol medium (Pea Mannitol, PM): sterilizing green peas for 20min at 121 ℃ in 1l of deionized water, filtering the green peas with two layers of gauze, adding 91.1g of mannitol, 2g of calcium carbonate and 1g of calcium chloride into the filtered pea culture, fixing the volume to 1l with deionized water, centrifuging the mixture at 5,000rpm for 10min, taking the supernatant, and sterilizing the supernatant for 20min at 121 ℃. Adding 15g agar powder into solid culture medium (PMA), and performing moist heat sterilization for 20 min.

Nutrient pea medium (NPB): the preparation method comprises the steps of sterilizing 125g of green peas and 1l of ionized water at 121 ℃ for 20min, filtering the green peas by using 2 layers of gauze, adding 5g of D-mannitol, 5g of D-sorbitol, 5g of glucose, 3g of potassium nitrate, 2g of calcium carbonate, 2g of yeast extract, 1g of monopotassium phosphate, 1g of dipotassium phosphate, 0.5g of magnesium sulfate and 0.1g of calcium chloride into the filtered pea culture, centrifuging the mixture at 5,000rpm for 10min, taking supernatant, fixing the volume to 1l by using deionized water, adding 15g of agar powder, and sterilizing the mixture for 20 min. Before use, a vitamin stock solution and a trace element stock solution are added into a culture medium in an aseptic operating platform, and 2ml of the vitamin stock solution and 2ml of the trace element stock solution which are subjected to filtration sterilization are added into every 1l of the culture medium.

The preparation method of the reagent used in the test comprises the following steps:

ampicillin (Ampicillin, Amp): ampicillin 0.5g was weighed into 10ml of ddH₂In O, 5X 10⁴Mu.g/ml of the mother liquor is filtered by a sterile filter membrane (0.22 mu m), and then is subpackaged in a 2ml centrifuge tube and is stored at-20 ℃ for later use.

Geneticin (Geneticin, G418): 0.5g of geneticin was weighed out and added to 10ml of ddH₂In O, 5X 10⁴Mu.g/ml of the mother liquor is filtered by a sterile filter membrane (0.22 mu m), and then is subpackaged in a 2ml centrifuge tube and is stored at-20 ℃ for later use.

Hypha enzymatic hydrolysate (20 ml): 10ml of 0.8M mannitol, 0.8ml of 0.5M KCl, 0.8ml of 0.5M 4-morpholinoethanesulfonic acid, 0.4ml of 0.5M CaCl₂0.12g cellulase (Calbiochem, cat.No.219466), 0.12g lyase (Sigma, cat.No. L1412), sterile ultrapure water to 20ml, gently mixing and dissolving, filtering and sterilizing with a 0.22 μm filter membrane, and preparing the preparation on site.

MMG solution (250 ml): 18.22g of mannitol, 0.76g of MgCl₂·6H₂O, 2.0ml of 0.5M 4-morpholinoethanesulfonic acid (pH 5.7), ultrapure water was added to 250ml, and the mixture was filtered through a 0.22 μ M filter and sterilized.

W5 solution: 0.1g KCl, 4.6g CaCl₂·2H₂O, 2.25g NaCl, 7.8g glucose and ultrapure water are dissolved to a constant volume of 250ml, and the solution is filtered and sterilized by a 0.22 mu m filter membrane.

PEG-CaCl₂Solution (40% w/v): 12g PEG 4000, 3.75ml 0.5M CaCl₂3ml of sterile ultrapure water, and 0.22 μm filter membrane filtration sterilization.

0.8M Mannitol solution (1 l): 145.76g of mannitol, dissolved in ultrapure water to a volume of 1l, and sterilized by filtration through a 0.22 μm filter membrane.

0.5M MES-KOH solution (40 ml): 4.88g of 4-morpholinoethanesulfonic acid (MES), 9.76g of NaOH and ultrapure water were added to a volume of 40ml, and the mixture was filtered through a 0.22 μm filter membrane and sterilized.

Vitamin Stock (Vitamin Stock): biotin 6.7X 10^-7g/ml；Folic acid 6.7×10^{- 7}g/ml；L-inositol4.0×10^-5g/ml；Nicotinic acid 4.0×10^-5g/ml；Pyridoxine-HCl 6.0×10^-4g/ml；Riboflavin 5.0×10^-5g/ml；Thiamine-HCl 1.3×10^-3g/ml。

Trace element stock solutions (Trace Elements): FeC₆H₅O₇·3H₂O 5.4×10^-4g/ml；ZnSO₄·7H₂O 3.8×10^-4g/ml；CuSO₄·5H₂O 7.5×10^-4g/ml；MgSO₄·H₂O 3.8×10^-5g/ml；H₃BO₃ 2.5×10^-5g/ml；Na₂MoO₄·H₂O 3.0×10^-5g/ml。

The pBluescript II SK + homologous arm vector plasmid (Donor vector), sgRNA expression vector pYF2.3G-Ribo-sgRNA and Cas9 expression plasmid pYF2-PsNLS-hSpCas9 used in this example were given by professor Brett M.Tyler, Oregon State university, USA.

Example 1, Phytophthora capsici Pcec 4-1, Pcec 4-2 proteins and the genes encoding them

In this example, the P.capsorum Sec4 proteins Pcec 4-1, Pcec 4-2 and their coding genes (or cDNAs) were amplified using the DNA (or cDNA) of P.capsorum Standard strain LT1534 as a template with the primers shown in Table 1. Wherein the material extracted from DNA or RNA can be mycelium of Phytophthora capsici standard strain LT 1534. Wherein, the coding gene Pcec 4-1 is Pcec 4-1 shown as sequence 1 in the sequence table, and the sequence 1 in the sequence table is composed of 624 nucleotides; the 1 st to 624 th nucleotides from the 5' end of the sequence 1 are coding sequences and code a protein Pcesec 4-1 shown in a sequence 2 in a sequence table. The above proteins or genes may also be artificially synthesized. The coding gene Pcec 4-2 of Pcec 4-2 is shown as a sequence 3 in a sequence table, and the sequence 3 in the sequence table consists of 609 nucleotides; the 1 st to 609 th nucleotides from the 5' end of the sequence 1 are coding sequences and code a protein Pcesec 4-2 shown in a sequence 3 in a sequence table. The above proteins or genes may also be artificially synthesized.

Pcec 4 full-Length encoding Gene amplification primers

Example 2 construction of Phytophthora capsici Pcec 4-1 and Pcec 4-2 Gene knockout vectors

In this example, a method for constructing a gene knockout vector based on CRISPR/Cas9, a sequence of a related vector, and an NPT II gene sequence are disclosed in "Fang, y., and Tyler, B.M. (2016.). effective deletion and reproduction of an effector gene in the aforementioned yeast Phytophthora sojae using CRISPR/case 9.molecular plant Pathology,17(1)," 127- "and" Fang, y., Cui, l., Gu, b., Arredondo, F., and Tyler, B.M. (2017). effective genome editing in the aforementioned yeast Phytophthora sojae using CRISPR/9. current.Microbiol.44, 21a.1.1-21a.1.26 ". The pBluescript II SK + homology arm vector plasmid (Donor vector), sgRNA expression vector pYF2.3G-Ribo-sgRNA and Cas9 expression vector pYF2-PsNLS-hSpCas9 used in this example were given by professor Brett M.Tyler, Oregon State university, USA.

The Donor vectors pBS-NPTII-Pcec 4-1 and pBS-NPTII-Pcec 4-2 used in the present embodiment; sgRNA expression plasmids pYF2.3G-Pcec 4-1 and pYF2.3G-Pcec 4-2; the specific construction method is as follows:

1) construction of homology arm vector for pBS-NPTII-Pcec 4-1: using DNA of phytophthora capsici strain LT1534 as a template, a primer is designed and amplified by using TaKaRa-In-Fusion _ Tools online website (http:// www.clontech.com/US/Products/Cloning _ and _ component _ Cells/Cloning _ Resources/On line _ In-Fusion _ Tools) to obtain a 1000bp sequence upstream of a target gene Pcesec 4-1 (shown as a sequence 5 In a sequence table, and obtained by amplification of primers shown as Pbs-NPTII-Sec4-1-F1 and Pbs-NPTII-Sec4-1-R1 In a sequence table 2) and an NPTII gene sequence (shown as NPTII gene is pYF2-PsNLS-hSpCas9 backbone plasmid as template, the primer sequences of the fragments obtained by amplification of Pbs-NPTII-Sec4-1-F2 and Pbs-NPTII-Sec4-1-R2 shown in Table 2), the downstream 1000bp sequence of Pcsec4-1 (shown in sequence 6 in the sequence table, obtained by amplification of primers of Pbs-NPTII-Sec4-1-F3 and Pbs-NPTII-Sec4-1-R3 shown in Table 2), and the primer sequences are utilized

The HD Cloning Kit sequentially fuses and connects the three amplified fragments into a Cloning vector pBluescript II SK + (EcoR V restriction enzyme), the connection product is transferred into Escherichia coli DH5 alpha competent cells, after overnight culture at 37 ℃, the universal primer M13F (sequence: 5'-TGTAAAACGACGGCCAGT-3')/M13R (sequence: 5'-CAGGAAACAGCTATGACC-3') is used for amplification and sequencing to verify Cloning, and the recombinant expression vector which contains the sequentially connected Pcesec 4-1 upstream 1000bp sequence, NPTII gene sequence and Pcesec 4-1 downstream 1000bp sequence is named as pBS-NPTII-Pcesec 4-1 after verification.

2) The homology arm vector for pBS-NPTII-Pcec 4-2 was constructed as described above: the DNA of phytophthora capsici strain LT1534 is taken as a template, a designed primer is utilized to amplify a 1000bp sequence at the upstream of a target gene Pcesec 4-2 (shown as a sequence 7 in a sequence table and obtained by amplifying primers shown as Pbs-NPTII-Sec4-2-F1 and Pbs-NPTII-Sec4-2-R1 in the table 2), an NPTII gene sequence (the NPTII gene is a fragment obtained by amplifying a pYF2-PsNLS-hSpCas9 skeleton plasmid with primer sequences shown as Pbs-NPTII-Sec4-2-F2 and Pbs-NPTII-Sec4-2-R2 in the table 2), pcec 4-2 downstream 1000bp sequence (shown in sequence 8 in the sequence table, obtained by amplification of primers of Pbs-NPTII-Sec4-2-F3 and Pbs-NPTII-Sec4-2-R3 shown in Table 2) was used.

The HD Cloning Kit fuses and connects the three amplified fragments into a Cloning vector pBluescript II SK + (EcoR V restriction enzyme), the connection product is transferred into Escherichia coli DH5 alpha competent cells, after overnight culture at 37 ℃, the universal primer M13F (sequence: 5'-TGTAAAACGACGGCCAGT-3')/M13R (sequence: 5'-CAGGAAACAGCTATGACC-3') is used for amplification and sequencing to verify Cloning, and the forward 1000bp containing the sequentially connected Pcesec 4-2 with correct verification is subjected to Cloning verificationThe recombinant expression vector of the sequence, NPTII gene sequence and Pcec 4-2 downstream 1000bp sequence was named pBS-NPTII-Pcec 4-2.

TABLE 2 CRISPR/Cas9 mediated Pcec 4-1/2 gene knockout homology arm vector construction amplification primers

2) Construction of sgRNA and Cas9 co-expression plasmid: designing a website EuPaGDT (http:// grna. cteg. uga. edu /) and an RNA structure online analysis tool (http:// RNA. urmc. rochester. edu/RNAstructure Web/Servers/Predict1/predict1.html), selecting an sgRNA sequence which specifically targets the Pcec 4-1 gene and has a weak secondary structure (sgSec 4-1: CTCCTGCTGATCGGAGACAG, which targets positions 37-56 of SEQ ID No.1 of the Pcec 4-1 gene); the sgRNA sequences (sgSec 4-2: GAAGGTGAAGCTGCAGATCT, position 174. sub.193 of SEQ ID No.3 targeting Pcec 4-2 gene) which specifically target the Pcec 4-2 gene and have weaker secondary structures were selected and sent to the company for synthesis of forward and reverse sgRNA sequence primers with NheI and BsaI cleavage sites and HH ribozyme. Dissolved in sterile water to 100. mu.M solution. Annealing reaction to synthesize double-chain sgRNA sequence, wherein the reaction system comprises: mu.l of forward strand solution, 3. mu.l of reverse strand solution, 3. mu.l of 10 XT 4 DNA Ligase Buffer (NEB), 4. mu.l of 0.5M NaCl, 21. mu.l of ultrapure sterile water, pipetting, mixing, reacting at 100 ℃ for 2min, cooling naturally at room temperature for 4h, and then diluting the reaction solution by 500 times. Taking 2 mu.l of 10 XT 4 DNA Ligase Buffer (NEB), 50ng pYF2.3G-Ribo-sgRNA vector (Nhe I/Bsa I double digestion), 4 mu.l of diluted double-stranded sgRNA solution, 1 mu l T4 DNA Ligase and sterile ultrapure water to be supplemented to 20 mu.l, reacting at room temperature for 30min, transforming Escherichia coli DH5 alpha competent cells by using 5 mu.l of ligation product, carrying out colony PCR verification on RPL41_ Pseq _ F (sequence: 5'-CAAGCCTCACTTTCTGCTGACTG-3')/M13F (sequence: 5'-TGTAAAACGACGGCCAGT-3') by using primers after overnight culture at 37 ℃, verifying that the primers are shown in Table 3, sequencing and verifying positive clone, and naming the recombinant vector of the sgRNA which can express the PcSec4-1 gene correctly as pYFsec 2.3G-PcF 4-1; the recombinant vector of sgRNA that verified to correctly express the target Pcesec 4-2 gene was named pYF2.3G-Pcesec 4-2.

TABLE 3 Synthesis of Pcesec 4-1/2 Gene knockout sgRNA nucleotide sequences

Example 3 acquisition of knock-out transformants of Phytophthora capsici Pcec 4-1 Gene and Pcec 4-2 Gene

Using CaCl₂PEG-mediated protoplast transformation methods Pcesec 4-1 and Pcesec 4-2 knockout transformants were prepared and methods for genetic transformation of oomycetes were disclosed in the literature "Fang, Y., and Tyler, B.M. (2016.). effective disruption and replacement of an effector gene in the fungal Phytophthora sojae using CRISPR/case 9.molecular plant Pathology,17(1), 127. 139.).

Obtaining knockout transformants specifically comprises the knockout gene Pcnec 4-1Donor vector pBS-NPTII-Pcnec 4-1 obtained in the example 1, the sgRNA recombinant vector pYF2.3G-Pcnec 4-1 of the knockout gene and a Cas9 expression vector pYF2-PsNLS-hSpCas 9; the Donor vector pBS-NPTII-Pcec 4-1 of Pcec 4-2, the sgRNA recombinant vector pYF2.3G-Pcec 4-2 of the Pcec 4-2 and the Cas9 expression vector pYF2-PsNLS-hSpCas9 (after respective homologous arms and sgRNA vectors are mixed with the Cas9 expression vector) are transferred into protoplasts of phytophthora capsici LT1534, grown transformants are cultured and screened at 25 ℃ by a G418 resistant V8 solid medium plate, mycelium of suspected transformants is collected, DNA is extracted for PCR sequencing verification, and RNA is extracted from positive transformants for Q-PCR verification. A Pcesec 4-2 homozygous knockout transformant was not obtained in multiple knockout transformation experiments, indicating lethality after knockout of the gene. The Pcesec 4-1 single knockout transformant KD series strain obtained. No two knock-out transformants were obtained for Pcec 4-2 and Pcec 4-1. Meanwhile, a transformant which has been transformed into the same vector plasmid and has undergone the same transformation procedure but in which the target gene knockout has not occurred, is used as a CK control transformant, i.e., CK.

Example 4 biological shape analysis of Phytophthora capsici Pcesec 4-1 knock-out transformant

First, hypha growth rate detection

The wild-type phytophthora capsici strain BYA5(WT), the empty vector control transformant (CK) knocked out, and the knocked-out transformant obtained in example 3: pcesec 4-1 knock-out transformant KD series strains (KD-1, KD-2) were individually inoculated in the center of a sterile petri dish (diameter 9cm) containing 15ml of V8 solid medium, cultured at 25 ℃ for 3 days in the dark, and the colony diameter of each strain was measured by the cross method, and 3 replicates were obtained for each strain.

The results show that the hyphal growth rate of all tested Pcesec 4-1 single knockout transformant KD series strains was significantly reduced compared to wild-type Phytophthora capsici strain BYA5(WT) and control transformant CK (FIG. 1). The experimental result shows that the Pcec 4-1 protein is involved in regulating the hyphal growth of phytophthora capsici.

Secondly, detecting the number of sporangia and zoospores, germination of resting spores and in-vitro pathogenicity

A 10% V8 solid medium was prepared and the wild type phytophthora capsici strain BYA5(WT), the empty vector control transformant CK, the knockout transformant obtained in example 3: pcesec 4-1 gene knockout transformant KD series strains KD-1 and KD-2 are respectively inoculated on a V8 solid medium (diameter is 9cm), dark culture is carried out for 3 days at 25 ℃, and then the culture dish is placed in an illumination incubator with the front side facing upwards and 25 ℃ (RH ═ 60% -80%) for further culture for 5 days. Adding 10ml of sterile water into the cultured dish, placing the dish in a refrigerator at 4 ℃ for 30min, taking out the culture dish, placing the culture dish at room temperature (25 ℃) for 30min, collecting the released zoospore suspension, shaking the zoospore suspension on a vortex instrument for 1min, sucking 20 mu l of the released zoospore suspension, dripping the zoospore suspension onto a blood counting plate, observing the zoospore suspension by a microscope and counting the number of the zoospores; the number and morphology of sporangial production on the medium were observed through a 20-fold objective field, with 3 replicates per strain.

The results show that the Pcesec 4-1 knockout transformant KD series strains (KD-1 and KD-2 strains) obtained in example 3 have no obvious change in the number of sporangia and the number of released zoospores are significantly reduced compared with the wild-type phytophthora capsici strain BYA5(WT) and the empty vector control transformant CK, but the sporangia and the zoospores have normal morphology, which shows that the Pcesec 4-1 protein mainly affects the number of phytophthora capsici zoospores (Table 4, FIGS. 2-A and B).

Thirdly, detecting the shape of the reposed spore and counting the germination rate

The wild type phytophthora capsici strain BYA5(WT) and zoospore suspensions of knockout transformants obtained in example 3 were obtained by the above method, and the zoospore suspensions of the respective strains were subjected to shaking treatment on a vortex shaker for 1min to obtain a resting spore suspension. And (3) sucking 100 mu L of phytophthora capsici resting spore suspension by using a pipette, dripping the phytophthora capsici resting spore suspension on a concave glass slide, placing the concave glass slide in dark at 25 ℃ for culturing for 4h, observing the shape of each treated resting spore under an optical microscope, and randomly detecting the number of the germinated resting spores in each 100 resting spores, wherein each strain is provided with 3 repeats.

The results show that the germination rate of the aponeurosis of KD-1 in the Pcesec 4-1 gene knockout transformant obtained in example 3 is significantly reduced compared with that of the wild-type phytophthora capsici strain BYA5(WT) and the empty vector control transformant CK, while the germination rate of the aponeurosis of the knockout transformant KD-2 is not significantly reduced. This section of the results shows that the Pcec 4-1 protein has some effect on the regulation of germination of P.capsorum, but further validation of the experiment is required in view of the differences in phenotype of the 2 strains transformants, whether they are affected by functional complementation of Pcec 4-2 (FIG. 2-C).

Fourthly, counting and observing pathogenic results

Collecting zoospores of each strain treated by Phytophthora capsici according to the method, and adjusting the concentration of the zoospores of each strain to 10 by using a microscope⁵One per ml. Inoculating spore suspension to harvested allelochemically, same-age and robust pepper leaves, and inoculating 6 leaves to each treatment, wherein 5 drops of each pepper leaf is added, and the volume of each drop is 10 μ l. Placing the inoculated leaves on a glass frame, placing the glass frame in a 15cm glass dish paved with 3 layers of absorbent paper and a proper amount of clear water, placing the inoculated pepper leaves in an illumination incubator at 25 ℃ (RH ═ 60% -80%), illuminating for 12h, and alternately culturing for 3 days in darkness for 12 h. The lesion area was recorded and photographed and the whole experiment was repeated 3 times.

The results show that compared with the wild type phytophthora capsici strain BYA5(WT) and the empty vector control transformant CK, the pathogenicity of KD-2 in the Pcesec 4-1 knockout transformant obtained in example 3 is remarkably reduced compared with the pathogenicity of the wild type strain and the knockout empty vector strain, while the pathogenicity of the knockout transformant KD-1 is not remarkably changed compared with the pathogenicity of the wild type strain and the knockout empty vector strain. This result indicates that Pcec 4-1 protein is also involved in regulating the host plant infection process by Phytophthora capsici (FIG. 2-D, FIG. 3).

Fifthly, the secretion amount of the extracellular vesicles

A 10% V8 solid medium was prepared and the wild type phytophthora capsici strain BYA5(WT), the empty vector control transformant CK, the knockout transformant obtained in example 3: the KD series of Pcec 4-1 knockout transformants were inoculated on V8 solid medium (diameter 9cm) and cultured in the dark at 25 ℃ for 3 days. The method comprises the following steps of beating 15 fungus cakes by using a 5mm perforator for each strain, putting the fungus cakes into a potato glucose liquid culture medium, carrying out dark culture for 3 days at 25 ℃ under the condition of 120rpm, adding pepper leaves subjected to surface sterilization treatment into the potato glucose liquid culture medium after the culture is finished (the leaves are soaked in 75% ethanol for 1min, washed in sterile water for 3 times, soaked in 2% glutaraldehyde for 5min, washed in sterile water for 3 times, flatly putting the leaves into a sterile culture dish, carrying out ultraviolet irradiation for 30min in a sterile operating platform), putting the leaves into a light incubator at 25 ℃ (RH (60% -80%) for continuous culture for 4 days, extracting extracellular vesicles, and detecting the extracellular vesicle concentration of phytophthora capsici obtained in each strain by using a BCA protein detection kit (figure 4).

The results showed that the Pcesec 4-1 knockout transformant KD series strain obtained in example 3 showed a significant decrease in the yield of extracellular vesicles compared to the wild-type Phytophthora capsici strain BYA5(WT) and the empty vector control transformant CK, indicating that Pcesec 4-1 affected the secretion process of Phytophthora capsici extracellular vesicles (FIG. 4).

TABLE 4 phenotypic analysis of Pcec 4-1 Single Gene knockout mutants in strains of C.capsici

Note:^aWT represents the parent strain; CK represents a knockout empty vector; KD-1 and KD-2 represent 2 homozygous knockout transformants.

^bThe values in the table represent the mean. + -. standard deviation. The Turkey method in the one-way ANOVA analysis in DPS software was used to calculate the differences in biological traits between the wild-type strain and the different transformants, and the same letters in the same column indicate that there was no significant difference (P)<0.01)。

Sequence listing

<110> university of agriculture in China

<120> phytophthora capsici regulates and controls extracellular vesicle secretion key protein, and coding gene and application thereof

<130> WHOI210034

<160> 8

<170> SIPOSequenceListing 1.0

<210> 1

<211> 624

<212> DNA

<213> Phytophthora capsici (Phytophthora capsicii)

<400> 1

atggtgcata gcagcaagta cgatctgctc atcaagctcc tgctgatcgg agacagtggt 60

gttgggaaga gttgcgtgct cttgcgctac tcagacgatt cgttcacgac ctccttcatc 120

actaccatcg gcatcgactt taaggttaag accatcgacg tcgacggcaa gcgaataaag 180

ctgcagatat gggacactgc gggccaggaa cgtttccgga ctatcacaac agcttattat 240

cgcggtgcaa tgggaattct attggtatac gatgtgacgg atgaccactc cttccagaac 300

attcgcaatt ggatgactca aattcgacaa aacgcgtcgt ctaatgtgaa caaaatcctg 360

atcggcaaca agtgcgacgt ggacccgtcg gaaagagcag tgactacgaa acagggtcag 420

gatttggcgg acgagttcgg catcaagttc ttcgagacga gcgccaagag caatgaaaac 480

atcaacgagg ccttccgctc aatcgcagtg gacatccaga agcggctggc ggagagcgag 540

cacgatagat tagacgtggc caatggcagc aagttccgtg tggatgagtc tcaggagcag 600

acgaaagacg gttgctgctc gtga 624

<210> 2

<211> 207

<212> PRT

<213> Phytophthora capsici (Phytophthora capsicii)

<400> 2

Met Val His Ser Ser Lys Tyr Asp Leu Leu Ile Lys Leu Leu Leu Ile

1 5 10 15

Gly Asp Ser Gly Val Gly Lys Ser Cys Val Leu Leu Arg Tyr Ser Asp

20 25 30

Asp Ser Phe Thr Thr Ser Phe Ile Thr Thr Ile Gly Ile Asp Phe Lys

35 40 45

Val Lys Thr Ile Asp Val Asp Gly Lys Arg Ile Lys Leu Gln Ile Trp

50 55 60

Asp Thr Ala Gly Gln Glu Arg Phe Arg Thr Ile Thr Thr Ala Tyr Tyr

65 70 75 80

Arg Gly Ala Met Gly Ile Leu Leu Val Tyr Asp Val Thr Asp Asp His

85 90 95

Ser Phe Gln Asn Ile Arg Asn Trp Met Thr Gln Ile Arg Gln Asn Ala

100 105 110

Ser Ser Asn Val Asn Lys Ile Leu Ile Gly Asn Lys Cys Asp Val Asp

115 120 125

Pro Ser Glu Arg Ala Val Thr Thr Lys Gln Gly Gln Asp Leu Ala Asp

130 135 140

Glu Phe Gly Ile Lys Phe Phe Glu Thr Ser Ala Lys Ser Asn Glu Asn

145 150 155 160

Ile Asn Glu Ala Phe Arg Ser Ile Ala Val Asp Ile Gln Lys Arg Leu

165 170 175

Ala Glu Ser Glu His Asp Arg Leu Asp Val Ala Asn Gly Ser Lys Phe

180 185 190

Arg Val Asp Glu Ser Gln Glu Gln Thr Lys Asp Gly Cys Cys Ser

195 200 205

<210> 3

<211> 609

<212> DNA

<213> Phytophthora capsici (Phytophthora capsicii)

<400> 3

atggctcgtc atgaaaaccc cttcgatatg cagatcaagc tgttgatgat cggcgacagc 60

ggtgtgggga agacctgttt gttgctgcgt tatgccaacg actcgttctc tccgactttt 120

atcacgacca tcgggattga cttcaaaatc aagaacatag agctggacaa caagaaggtg 180

aagctgcaga tctgggacac agctggtcag gagcgcttcc gcaccattac gacgtcgtac 240

ttccgcggtg ctcagggtat tttattggtc tacgatgtca cggatcgcgc atctttccaa 300

agtatccgca actgggtggg tcagatccag cagcacgccg acgtgcacgt caacaagatc 360

ctcatcggca acaagtgcga tatgacggac gacaaagttg taagcacgga ggaaggtcag 420

gcattagcgg acgagtatgg tgtcaagttc ttcgagacga gtgcgaagaa caatatcaac 480

gtggaaggag gcttcatcga gatcgcgcgt gaagtgaaga acagactcat ggaagagggc 540

ggaccgcaca agaaagacaa tgtcaacctc agcgcaaaac cagcacccgt gaagaagggt 600

tgttgctaa 609

<210> 4

<211> 202

<212> PRT

<213> Phytophthora capsici (Phytophthora capsicii)

<400> 4

Met Ala Arg His Glu Asn Pro Phe Asp Met Gln Ile Lys Leu Leu Met

1 5 10 15

Ile Gly Asp Ser Gly Val Gly Lys Thr Cys Leu Leu Leu Arg Tyr Ala

20 25 30

Asn Asp Ser Phe Ser Pro Thr Phe Ile Thr Thr Ile Gly Ile Asp Phe

35 40 45

Lys Ile Lys Asn Ile Glu Leu Asp Asn Lys Lys Val Lys Leu Gln Ile

50 55 60

Trp Asp Thr Ala Gly Gln Glu Arg Phe Arg Thr Ile Thr Thr Ser Tyr

65 70 75 80

Phe Arg Gly Ala Gln Gly Ile Leu Leu Val Tyr Asp Val Thr Asp Arg

85 90 95

Ala Ser Phe Gln Ser Ile Arg Asn Trp Val Gly Gln Ile Gln Gln His

100 105 110

Ala Asp Val His Val Asn Lys Ile Leu Ile Gly Asn Lys Cys Asp Met

115 120 125

Thr Asp Asp Lys Val Val Ser Thr Glu Glu Gly Gln Ala Leu Ala Asp

130 135 140

Glu Tyr Gly Val Lys Phe Phe Glu Thr Ser Ala Lys Asn Asn Ile Asn

145 150 155 160

Val Glu Gly Gly Phe Ile Glu Ile Ala Arg Glu Val Lys Asn Arg Leu

165 170 175

Met Glu Glu Gly Gly Pro His Lys Lys Asp Asn Val Asn Leu Ser Ala

180 185 190

Lys Pro Ala Pro Val Lys Lys Gly Cys Cys

195 200

<210> 5

<211> 1000

<212> DNA

<213> Phytophthora capsici (Phytophthora capsicii)

<400> 5

caccagctac atcggagact ctgattgctg tctccccttc ctctcttcgc tcggtttctt 60

cttcggcggt agacatgaga agtcccgtcc ggcttccccg tggtttctgg aagtgaaaag 120

cattgcgtgc gtcgatctct gtgtaacgtc tggctagatc aaattcgata gtataatgaa 180

gtaaaacgcc aaagtaaggt agtcatggtg aaagagacat catttcatta atgaaatcaa 240

gtcattcacc gcatgactgt ctattttgag acaaagacac acatctagct ggtgtttgcc 300

cgtcgagcat tgtgctgtga tatctacagc tacatcgaac actgaaatcc gggcagcagg 360

ctatagttca agcgttatgt agaccaattt agggtgagcg ccgttggctc ggattgtggg 420

gtggctggaa gcccctgccc ccgtctattg aagttagaac cgtaagaaat ggagccggac 480

tcgtaattta tcctgggatc cacctgtatc tgtctctgta catttgtgca ttacgtgaac 540

aactgatcga cggcttggcc aatgaaaaaa ctcaccgttg attttgttca cagacacaaa 600

aattttagcc aatgaagaaa atgctcgaaa atattgaagg tagtaccgtg gttttgtgaa 660

aggggtcaaa ttgccccact tgagtgacct atccctccca attaccatct gtgcagaaag 720

gcttcctcaa agcgagtacc gtaaaattat gaaaggggtc aaattgcccc cgttcacttg 780

ttatcgtgct aactttgtat actatagtag ccaaagtcat taagctctgt tcgcgatagg 840

gttaataatt tataaaataa ttttttcccc tattgagtct caaaatgtct tatgatgggt 900

ttatgtgaat tagcaaaacg catattttgt ggtgcccacc aaaaaatggg acacgtgctt 960

cttcggcaca caacattctg caggcatcct agtcgtcgcc 1000

<210> 6

<211> 1000

<212> DNA

<213> Phytophthora capsici (Phytophthora capsicii)

<400> 6

ttccactgtc tttcgccttg ttcgtgcttg tcgttttgtg ccgaatggtt gccacgctct 60

agctgatagc ttagtaccct gcaactagcc ctcgaatgcg ataaactcat tatcatacat 120

agtacttctt gactcaggtt ccaaaatctc agatggctac atcatgacag tgtagccatc 180

tgacgcatcc gccaatcatt ttgattatct caacgtgcta ttggtggctg gtggttcatt 240

tgctgattga attgacgtaa ggaatggcgg agcgcgaaga catcgtggac ggcggcgaga 300

cgtgggacga ctgggtggac gacgggtcgt ccaccagcta cgactgcgtg ttctgcgccg 360

ataagttccc ggccgaggat ccgcttcatg cgcatctaca ggaggcgcac gacttttcac 420

tccgtagcga gatctcaagc cgcaagctgg acacatacgg catcattcaa ctgattaatt 480

tcttacgttg gcatacattg gatggagttt cagccgaaca ggtgaagcag acgctggcaa 540

cggaaggaaa cgctgccttc cagaaggacg agttcctcaa gcctgtggtg gtggacgacc 600

ctctgcttta ctgtctcgac tgcgatagtg acagtgatga tgacgaggac aatgccaacg 660

aggagcagaa aagtgcggaa gttgtggaga cccctgctac tgctggagat gacgctgctg 720

ctctgatcgc caggttgcag atggagaacc aagaacttaa gcagcagatg accaaatact 780

cgaaacttgt tcgcgacttt gtggtagatg gagagaacac cgcccctgtg gaggatgccg 840

ctgacaacga tacgtactac ttcgactcgt actcgcacgt gggtattcat cgtgagatga 900

tcacggacag gatccgtacc gatggctacc gcaatgccat cattaacaat ccccaggtat 960

ttgagggcaa ggtggtacta gatgttgggt gtggtactgg 1000

<210> 7

<211> 1000

<212> DNA

<213> Phytophthora capsici (Phytophthora capsicii)

<400> 7

tagtaactcc catcttgaac gcgaaggaat gtcaggtaag cactaccacc gctaaatggc 60

gtttctcctg tcagaagctg gtagacaatg caaccgaatg cccacatgtc gctagcataa 120

gtcggatctt tgttgtcgat cgtctccggt ggcatgtact ccggtgtgcc aacgaaattt 180

ggtccgttga gtttatcatc ggccatgttt ttagccgtgc caaagtcgat gagctttagg 240

tggttacctg catccttgca gacaaccatg ttctcaggct ttaagtcacg atgaatcacc 300

tggttcgcgt gcatgtactc gactgcgttc acaacgtcgg ccaagtaaaa ccgtgcaagt 360

tcctcatcca gtccaagctg gcggccttcg tgcagcaggt gggagagcag ttcacctccg 420

tccagtagtt ccagcaggaa atataagttg ttgtcgtctt ggaaggtctg atacagacgg 480

ataatgttgg ggtgcagcaa ccgattcagc acttccttct ccatgttgat ctcattgaag 540

atgttctggt gacgcaaccg cagccgcttg atgcgttgct tctcgatcac tttaagcgcg 600

aacttgtcac ccgtagcctt gtgtcgggcc tcaacgatgc gcgagaagtt gccttcgccc 660

agaggtttgc cctgcacgaa ctcgtcaata ctcggcttct ccgtcgcgtc cttcgctgta 720

acaacgcaac gacacaatcg tcagtgtcgt gaagtgaatt tacagtacaa tagacagcaa 780

tcactagact ggaaataaac aatgaagagc tctcaaggac gtacggctaa tggccatgat 840

ggaagtggtt ggtgcgtctt cgaatcgatt tttttcgttt tatgccgacg cttcaagtac 900

tcgtagggtt tcggtttttc gatttttcca gttttgatgt gtgccacatc gtgttcggtg 960

gctacgaata gaaccccttt tatatgcgtt acgtaggctg 1000

<210> 8

<211> 1000

<212> DNA

<213> Phytophthora capsici (Phytophthora capsicii)

<400> 8

gtttgccaga cagcttgctt gggctcggtg gcgtcgcaat ttgatatgct cgctcgctac 60

tatttcgcag atgcatgctg ccttactata gctactactt ccactcaact acttttttca 120

tggtttttat gttgtacttt tgctagtgtt tcgatttcaa gaacactgaa gattttcatc 180

taaactcgat taatctgcct cgcgttccca gacgcgaact gagctatcaa ttgatgctga 240

tagcgcaagt ttgccatcat aactaaagct gcagtcaaat acttcggctt cgtgaccgca 300

tagtatttgc tgacactcgc cggtgaaagc gttccacact cgagcggttc catctgtacc 360

agcagtgaga acttggagcc cttgcatgct gaagcagacc ttattgattg ccttttggtg 420

gccagacaat atgcaccgcc ttgtacctgt aagtgtgtca tatatgaatg catttccgtc 480

cttaccacac gatactacga gcgcgccgga agcattgaat gcagcgtggg taacttcata 540

accgttgtga tcatcccagt cataaagaca ttttccggtg cgagcatccc acaacttgca 600

tgtcccgtcg gaagaagaag acagtaaagt gttgcctttg ttgtcgaacg acacgctgga 660

aatatcagcg tcgtgatgct cgatacaacg gaaacagcca ccatatcgag tgtcccagag 720

cctcacagtc gagtcacaag aacctgtagc gatgagtttg gtgtcgatcg agtcgaatgc 780

caaacatgat acttctgcgg aatgtcccga aagcgtcagc ctggatgttt ccgttgcgat 840

atcccaaacc actccggtgc catcgaccga atagctaccg aagcactcat tgctacttga 900

tcccaaagca aacacagccc ccaccacctc tcctacgtgg caccggtagg ttccgatagc 960

cgatttcttt tttacatccc ataggcggca agtcttgtcg 1000

Claims (10)

1. A Phytophthora capsici (Phytophthora capsicii) regulates and controls extracellular vesicle secretion key protein, which is protein of A1) or A2) or A3) or A4):

A1) the amino acid sequence is a protein shown as a sequence 2 or a sequence 4;

A2) a fusion protein obtained by connecting a label to the N end and/or the C end of the protein shown as the sequence 2 or the sequence 4;

A3) protein which is obtained by substituting and/or deleting and/or adding one or more amino acid residues of the amino acid sequence shown in the sequence 2 or 4, has the same function and is derived from the protein shown in the sequence 2 or 4;

A4) an amino acid sequence which has a similarity of 75% or more, preferably 85% or more, more preferably 95% or more with the amino acid sequence shown in SEQ ID No.2 or SEQ ID No. 4 and has the same function as the amino acid sequence shown in SEQ ID No.2 or SEQ ID No. 4.

2. A gene encoding a key protein for controlling secretion of extracellular vesicles as set forth in claim 1; preferably, the coding gene is B1) or B2) or B3) as follows:

B1) a DNA molecule shown by a nucleotide sequence shown in a sequence 1 or a sequence 3 in a sequence table;

B2) a cDNA or DNA molecule which has more than 75% or more than 85% or more than 95% of identity with the nucleotide sequence shown in B1) and encodes a key protein for regulating the secretion of extracellular vesicles according to claim 1;

B3) hybridizes under stringent conditions with a nucleotide sequence defined in B1) or B2) and encodes a cDNA molecule or a DNA molecule which modulates secretion of a key protein by an extracellular vesicle as claimed in claim 1.

3. An RNA molecule transcribed from the coding gene of claim 2; preferably, the sequence of the RNA molecule is C1) or C2) as follows:

C1) an RNA sequence that has a similarity of 75% or more, more preferably 85% or more, and still more preferably 95% or more to an RNA sequence transcribed from a DNA sequence represented by SEQ ID No.1 or SEQ ID No.3 and that has the same function as an RNA sequence transcribed from a DNA sequence represented by SEQ ID No. 1;

C2) RNA sequence transcribed from the DNA sequence shown in sequence 1.

4. The biological material containing the nucleic acid molecule related to the coding gene of claim 2 or the RNA molecule of claim 3, which is any one of the following D1) to D10):

D1) an expression cassette comprising the encoding gene of claim 2;

D2) a recombinant vector comprising the gene encoding the gene of claim 2, or a recombinant vector comprising the expression cassette of D1);

D3) a recombinant microorganism containing the gene encoding the gene of claim 2, or a recombinant microorganism containing D1) the expression cassette, or a recombinant microorganism containing D2) the recombinant vector;

D4) a transgenic plant cell line comprising the gene encoding the gene of claim 2, or a transgenic plant cell line comprising the expression cassette of D1);

D5) transgenic plant tissue comprising the gene encoding the gene of claim 2, or transgenic plant tissue comprising the expression cassette of D2);

D6) a transgenic plant organ containing the gene encoding the gene of claim 2, or a transgenic plant organ containing the expression cassette of D2);

D7) a nucleic acid molecule that inhibits the expression of the encoding gene of claim 2;

D8) an expression cassette, a recombinant vector, a recombinant microorganism or a transgenic plant cell line comprising the nucleic acid molecule of D7);

D9) a nucleic acid molecule that inhibits translation of the RNA molecule of claim 3;

D10) producing an expression cassette, a recombinant vector, a recombinant microorganism or a transgenic plant cell line of D9) said nucleic acid molecule.

5. Use of the key protein for regulating extracellular vesicle secretion of claim 1, the coding gene of claim 2 or the RNA molecule of claim 3 or the biomaterial of claim 4, wherein: the application is any one or more of the following 1) to 6):

1) the application in regulating and controlling the phytophthora capsici zoospore yield;

2) the application in regulating and controlling the growth rate of phytophthora capsici mycelia;

3) the application in regulating and controlling phytophthora capsici resting spore germination and host infection capacity;

4) the application in regulating and controlling the yield of phytophthora capsici extracellular vesicles;

5) the application of the phytophthora capsici to regulation and control of the pathogenicity of host;

6) the application of the compound in inhibiting and/or killing phytophthora capsici.

6. The use according to claim 5, wherein the use according to 1) -6) is carried out by inhibiting or inactivating transcription of any combination of one or more than two of the coding genes according to claim 2, or inhibiting translation of any combination of one or more than two of the RNA molecules according to claim 3, or inhibiting and/or inactivating key proteins regulating secretion of extracellular vesicles according to claim 1.

7. Use of the key protein for regulating extracellular vesicle secretion according to claim 1, the coding gene shown in claim 2 or the RNA molecule according to claim 3 or the biomaterial according to claim 4 or the protein combination or DNA combination according to claim 5 as a bacteriostatic or bactericidal agent target for screening Phytophthora capsici as a bacteriostatic or bactericidal agent.

8. A method for screening or assisting in screening Phytophthora capsici bacteriostasis and/or bactericide, the method comprising applying an object to be detected to the Phytophthora capsici, wherein when the object to be detected is capable of inhibiting transcription of the coding gene of claim 2, or inhibiting translation of the RNA molecule of claim 3, or inhibiting or inactivating the activity of the key protein for regulating extracellular vesicle secretion of claim 1, the object to be detected is the Phytophthora capsici bacteriostasis and/or bactericide.

9. A method for reducing the activity of or killing Phytophthora capsici Leonian comprises the following steps: inhibiting transcription or deleting the coding gene of claim 2, or inhibiting translation in the RNA molecule of claim 3, or inhibiting or inactivating the activity of a key protein that regulates secretion from extracellular vesicles of claim 1;

wherein the activity of the phytophthora capsici is reduced to reduce the infection capacity and/or pathogenicity of the phytophthora capsici to a host, and/or reduce the hyphal growth speed of the phytophthora capsici, and/or inhibit the yield of sporangium and/or zoospore of the phytophthora capsici, and/or secrete the extracellular cysts of the phytophthora capsici;

preferably, the protein shown in the sequence 2 or the sequence 4 in the sequence table is inactivated by knocking out the gene shown in the sequence 1 or the sequence 3 in the sequence table in the phytophthora capsici.

10. The use of a substance for inhibiting the expression and/or activity of a key protein for regulating and controlling the secretion of extracellular vesicles according to claim 1 in the preparation of a phytophthora sojae fungicide; preferably, the substance for inhibiting the expression and/or activity of the key protein for regulating the secretion of the extracellular vesicles is a substance for inhibiting the expression of the key protein for regulating the secretion of the extracellular vesicles and/or inhibiting the transcription of a gene encoding the key protein for regulating the secretion of the extracellular vesicles and/or inhibiting the translation of an RNA molecule obtained by transcription of a gene encoding the key protein for regulating the secretion of the extracellular vesicles.

Images