CN106906228B

CN106906228B - Gh L MM gene capable of remarkably improving disease resistance of cotton and application thereof

Info

Publication number: CN106906228B
Application number: CN201710204602.2A
Authority: CN
Inventors: 郭旺珍; 柴启超
Original assignee: Nanjing Agricultural University
Current assignee: Nanjing Agricultural University
Priority date: 2017-03-31
Filing date: 2017-03-31
Publication date: 2020-07-14
Anticipated expiration: 2037-03-31
Also published as: CN106906228A

Abstract

The invention discloses a Gh L MM gene capable of obviously improving disease resistance of cotton and application thereof, belonging to the field of biotechnology application and providing nucleotide sequences, ORF sequences and amino acid sequences of the Gh L MM gene in genome subgroup A and subgroup D of an alloploid uploid upland cotton genetic standard line TM-1. the Gh L MM gene is obtained by genetic analysis and fine positioning of a cotton lesion mutant gene discovered for the first time and a map-based cloning technology.

Description

Gh L MM gene capable of remarkably improving disease resistance of cotton and application thereof

Technical Field

The invention relates to a Gh L MM gene of cotton, which codes 5-aminolevulinic acid dehydratase (A L AD), a lesion-like mutant Ghlmm found in upland cotton for the first time is utilized, and the gene is obtained by a map-based cloning technology.

Background

Programmed Cell Death (PCD) is an actively ordered cell death process of multicellular organisms under the action of signal molecules and is one of the important ways for organisms to grow and develop and resist external stress. PCD during growth and development and environmentally induced PCD can be classified according to the factors that induce PCD. PCD in the growth and development process is necessary for the normal growth and development of plants, and participates in the differentiation and morphogenesis of plant tissues and organs, ensures the development of functional spores and gametophytes, and completes the reproduction process. The PCD induced by the environment mainly refers to hypersensitive reaction generated by abiotic stress such as salt, drought and the like and biotic stress such as pathogenic bacteria infection and the like, and plays an isolation role through rapid cell death of infected parts, thereby achieving the purpose of protecting adjacent healthy tissues.

In the case of biotic stress such as pathogenic bacteria, plants develop complex signals and defense mechanisms to protect themselves against the attack of pathogenic bacteria. The general classification is divided into two main categories of self-basic resistance and pathogen-induced resistance. When pathogenic bacteria are infected, the pathogenic-associated molecular characteristics of PAMP (pathogenic-associated molecular patterns) on the surfaces of the pathogenic bacteria are recognized by a plant-specific pathogen recognition receptor PRR (pathogenic-related proteins), and an immune response (PTI) activated by the PAMP is stimulated. Currently identified pathogen-associated molecules include flagellin of gram-negative bacteria, chitin and glucan of lipopolysaccharide fungi and oomycetes. PTI is manifested in plants that use their own intrinsic mediators to resist invasion by external pathogens, such as: waxy nature of the cell wall, cutin, and small molecule disease-resistant substances (phenolic compounds, cysteine-rich antimicrobial polypeptides, and related peroxidases) to destroy pathogenic osmolytes and ribosome inactivating proteins. PTI is the first line of defense against pathogen infestation. When the pathogen breaks through the first line of defense of the plant, effector proteins are secreted into the plant body and are recognized by the R protein of the plant, and then the immune response (ETI) activated by the effector proteins is triggered. This defense system can be divided into local resistance and systemic acquired resistance. Wherein, local resistance refers to Hypersensitivity (HR). When plants are infected by germs, the plants die locally and rapidly at or near the infected parts to form disease spots. Blocking the nutrition supply of pathogenic bacteria, and inducing the surrounding cells to generate substances for inhibiting the growth of pathogenic bacteria, so as to limit the further proliferation of the pathogenic bacteria. During the HR process, apoptosis occurs, and the process is completed under precise regulation of the relevant gene. Corresponding to local resistance is Systemic Acquired Resistance (SAR). After several days to one week after the infection of the germs, the whole plant generates new resistance at the level, and the resistance can be generated by the infection of the germs again. The marker event of SAR is that the SA content of the plant is increased and the PR gene expression is increased. Research shows that the disease-resistant signal path of plants is very complex, and a plurality of plant hormones are involved in the disease-resistant signal path, such as: SA, JA, ethylene, nitric oxide, ROS, etc. The signals of various hormones are mutually connected and interacted, so that the research on the normal wild type is very difficult, and the research process of a disease resistance mechanism can be accelerated by utilizing the mutant.

Pathomimetic mutants are mutants in which the plant itself produces a phenotype resembling pathogen infestation in the absence of biotic and abiotic stress. The generation of lesions on lesion-like mutants is similar to the cell death process of plant hypersensitivity reactions. Therefore, the lesion-like mutant is not only a powerful tool for revealing apoptosis, but also an excellent material for researching disease-resistant signal pathways and disease-resistant molecular mechanisms of plants. At present, at least 60 more types of lesion mutants are found in maize, rice, barley, Arabidopsis thaliana. Genetic analysis indicates that most lesion-like mutants are recessive mutations. Through forward genetics, some genes that result in mutants have been cloned. The mutant gene mainly relates to: 1. chlorophyll synthesis and degradation process. 2. The metabolism of fatty acids such as sphingolipids and oxidized lipids. 3. Defense immune pathways in plants. 4. Intracellular transport processes. 5. Integration of nuclear signals and regulation of gene expression processes (Bruggeman et al, 2015).

The study shows that although a few lesion-like mutants are more sensitive to pathogens, most lesion-like mutants show enhanced pathogen resistance, for example, chlorophyll synthesis and degradation processes can cause a plant lesion-like phenotype, gene mutation IN a tetrapyrrole metabolic pathway of a plant can cause formation of a lesion-like mutant, and plant disease resistance is enhanced, chlorophyll a, b, heme and heme belong to tetrapyrrole compounds, normal synthesis and metabolism of the tetrapyrrole compounds have great significance for photosynthesis, respiration, nitrogen and sulfur assimilation, and other processes, the arabidopsis thaliana rug1 mutant is characterized by accumulation of porphobilinogen deaminase (PBGD) function loss IN plants due to leaf shape change accompanied by necrotic spot production, flowering phase delay, plant height change and dwarfing, growth development inhibition, increase of contents of IN rug1 mutant and SA IN vivo, increase of expression of related genes (quassia, 2013) and L coding for fecal oxidase (ash et al, 20136) IN arabidopsis thaliana transgenic leaves, transgenic line mutant and transgenic line mutant expressing a transgenic line protein oxidase, transgenic line kinase expressing a gene expressing a.

Cotton is an important economic crop, not only providing natural fiber, but also an important oil crop. The cotton is threatened by a plurality of diseases in the growing process, wherein verticillium wilt is one of the diseases which threaten the cotton most at present. After the verticillium wilt infection, the cotton leaves can be yellowed, wilted and shed, so that the yield and the quality of the cotton are reduced, and even the cotton is not harvested. At present, the greensickness infected area in China reaches 250 million hectares, which causes billions of economic loss. The pathogenic Verticillium wilt found in China is Verticillium dahliae, which is a soil-borne fungus. The disease process is from bottom to top, firstly the edge of the leaves loses water and withers, then spots on the watermelon peel-shaped leaves are formed, and finally the leaves are burnt and fall off to become polished rods. Aiming at preventing and treating the verticillium wilt, a method for chemically controlling and cultivating high-resistance varieties is mainly adopted. However, the verticillium wilt is transported through the vascular system of the plant and is parasitic in the plant body, and the externally applied pesticide cannot effectively relieve the verticillium wilt. After the plant dies, verticillium wilt can produce sclerotia, which can survive in the soil for ten years. When the plant roots are damaged to generate exudates, the microsclerotia can be recovered and enter the plant body through wounds. At present, only a fumigation method can kill verticillium wilt bacteria in soil, but soil fumigation has great influence on the environment and consumes a great deal of financial resources. So that the cultivation of the verticillium wilt-resistant cotton variety is very important. Upland cotton is the main cultivated variety, and more than 90% of cotton planted in the world is upland cotton. However, the cotton on the land has poor verticillium wilt resistance, and the cotton on the land lacks immunity or high-resistance sources, which is a difficult problem which always troubles cotton breeders.

Genetic analysis indicates that Ghlmm is a recessive trait controlled by a single gene, localized to the D5 chromosome of cotton, fine localization and map cloning finds that Ghlmm is due to a single nucleotide mutation in the Gh _ D05G2237 coding region, causing premature termination of translated polypeptide, resulting in a loss of function, Gh _ D05G2237 encodes 5-aminolevulinic acid dehydratase (A L AD), which functions to convert 2 molecules of 5-aminolevulinic acid (A L A) into 1 molecule of Porphobilinogen (PBG), in heterotetraploid cotton named as 2 genes encoding A L, is a partial homolog gene, one is localized to the sub-genome of D, one is found to have significant resistance to the gene, and the result indicates that the mutant has increased resistance to the gene, i.e.,

Ghlmm

2, 2 genes encoding the gene, a.27, a verticillium wilt resistance, 2 genes, 25, 29 g.g.27.

The greensickness of the cotton is serious and difficult to control, and the upland cotton occupying more than 90 percent of the global planting area is deficient in resistance. Therefore, the discovery of the upland cotton mutant Ghlmm and the research on the disease-resistant molecular mechanism can broaden the knowledge on the verticillium wilt resistance of cotton, realize the accurate regulation of the balance between the growth and the disease resistance of the cotton by regulating the expression of target genes, culture a new germplasm with remarkably improved resistance and apply the new germplasm in production, and provide an important guiding function for verticillium wilt resistance breeding of the cotton.

Disclosure of Invention

The invention aims to provide application of a cotton Gh L MM gene in improving disease resistance of cotton and breeding new cotton germplasm, wherein Gh L MMA or Gh L MMD gene function deletion mutant is hybridized with conventionally planted cotton varieties to prepare hybrid seeds for improving verticillium wilt resistance of cotton, the gene is used as a target gene, expression of the Gh L MM gene is reduced within a certain range through gene engineering methods such as an antisense RNA technology and the like, and the new cotton germplasm which is normal in growth and development and remarkably improved in resistance is bred and applied to production.

Another object of the present invention is to provide a method for improving verticillium wilt resistance of cotton.

The invention also aims to provide a cotton Gh L MM gene, and provides a full-length cDNA ORF and a genome sequence of the gene in a cotton upland inheritance standard line TM-1A subgroup (Gh L MMA) and a cotton upland inheritance standard line D subgroup (Gh L MMD). additionally, the invention also provides a protein coded by the cotton Gh L MM gene, and an amino acid sequence coded by the gene in the cotton upland inheritance standard line TM-1A subgroup and the cotton upland inheritance standard line D subgroup.

The purpose of the invention is realized by the following technical scheme:

the Gh L MM gene shown in SEQ ID NO.1 or SEQ ID NO.2 is applied to the broad-spectrum improvement of the disease resistance of cotton and the cultivation of new cotton germplasm.

The application is characterized in that the functional deletion mutant of the Gh L MM gene is hybridized with a cotton variety which is planted conventionally to prepare a hybrid to improve the disease resistance of cotton.

The application is characterized in that the Gh L MM gene is used as a target gene, the expression of the Gh L MM gene is reduced within a certain range by gene engineering methods such as antisense RNA technology and the like, and a new germ plasm which is normal in growth and development and remarkably improved in resistance is cultured and applied to production.

A method for improving verticillium wilt resistance of cotton is provided, which regulates and controls the expression dosage of Gh L MM gene with the nucleotide sequence shown as SEQ ID NO.1 or SEQ ID NO.2 in cotton.

A Gh L MM gene capable of remarkably improving disease resistance of cotton is any one of (1) to (2):

(1) the nucleotide sequence of the gene in the genome A subgroup (Gh L MMA) of the upland cotton genetic standard system TM-1 is shown as SEQID NO. 1;

(2) the nucleotide sequence of the gene in the genome D subgroup (Gh L MMD) of the upland cotton genetic standard line TM-1 is shown as SEQID NO. 2.

The gene Gh L MMA described in (1) has an ORF sequence shown in SEQ ID No.3, and the gene Gh L MMD described in (2) has an ORF sequence shown in SEQ ID No. 4.

The protein coded by the Gh L MM gene has an amino acid sequence shown in SEQ ID NO.5, and the protein coded by the Gh L MMD has an amino acid sequence shown in SEQ ID NO. 6.

A recombinant vector, an expression cassette, a transgenic cell line or a recombinant bacterium containing the Gh L MM gene.

The recombinant vector, the expression cassette, the transgenic cell line or the recombinant strain are applied to improving the broad-spectrum disease resistance of cotton and cultivating new cotton germplasm.

The disease resistance is verticillium wilt disease resistance.

The invention has the advantages that:

(1) a lesion-like mutant Ghlmm is found in cotton for the first time, and a key gene of the lesion-like mutant Ghlmm is cloned.

We have found a lesion-like mutant Ghlmm in tissue-cultured offspring using the heterotetraploid gossypium hirsutum material W0 as the recipient, genetic analysis showed that the mutant trait is a recessive trait controlled by a single gene, map-based cloning showed that the mutant trait is due to SNP mutation in the Gh L MMD gene coding region of the heterotetraploid cotton D subgroup resulting in premature termination of translation and loss of gene function, while the Gh L MMA function of the A subgroup is normal, Ghlmm mutant can complete the growth cycle with no significant difference in fiber quality and yield compared to wild type Gh L MM encodes 5-aminolevulinic acid dehydratase (A L AD) which functions by converting 2 molecules of 5-aminolevulinic acid (A L A) into 1 molecule of Porphobilinogen (PBG), 2 genes in heterotetraploid cotton encoding A L AD, which are part of the autoploidy gene, thus, the gene encoding a tetraploid gene encoding a L AD, is a gene with 2 copies of the tetraploid gene, thus, the gene encoding a gene L, the MMaMMA gene, and the gene sequence sharing the same expression level of Ghlmm 99% of the MMd gene, which is difficult to create a similar effect in tissue-expressing the MMd gene, compared to wild type, the same level, Gh L, Gh 469, and the same.

(2) The lesion-like mutant Ghlmm is an excellent material for researching cotton disease-resistant signal paths and molecular mechanisms, and the disease resistance of cotton can be enhanced by regulating and controlling the expression of Gh L MM.

Compared with a normal material W0, the accumulation of 5-aminolevulinic acid (A L A) in the mutant, the synthesis of ROS and SA is remarkably increased, and the expression of PR gene is remarkably improved.

(3) The study on the dose effect of the Gh L MM gene can realize the optimal balance between plant growth and resistance, thereby achieving precise regulation and breeding.

Wild type W0 of Gossypium hirsutum has 4 copies of Gh L MM gene (AtAtAtDtDt, 2 copies in subgroups A and D), and mutant has two copies of Gh L MM (AtAtatdtdt) gene, and hybridization with W0 and Ghlmm mutant can obtain 3 copies of F₁The gene is used as a target gene, a transgenic homozygous material is obtained by means of agrobacterium infection and other genetic engineering methods, the expression of the Gh L MM gene is reduced within a certain range, the balance between cotton growth and disease resistance is accurately regulated, and the novel cotton germplasm with obviously improved resistance is cultivated and applied to production.

Drawings

FIG. 1 Fine mapping and map cloning of Ghlmm mutants

The mutant gene of the Ghlmm mutant is finely positioned, c 12 candidate genes expressed in the leaf are further quantitatively verified in W0 and Ghlmm, and d is a single mutation of nucleotide G to T at 127bp in Gh L MMD in the Ghlmm mutant, so that translation is terminated early.

FIG. 2 silencing of Gh _ D05G2254 in wild-type W0 failed to produce a Ghlmm mutant phenotype

a: phenotype after silencing of Gh _ D05G2254 in W0. b: quantitative validation of Gh _ D05G2254 expression after VIGS silencing.

FIG. 3 silencing Gh L MM in W0 resulting in a Ghlmm mutant phenotype

a phenotype after silencing Gh L MM in W0 b quantitative verification of expression after silencing Gh L MM in VIGS, wherein the expression of part of homologous genes of A, D subgroups of the gene down-regulates the contents of A L A, hydrogen peroxide and MDA after silencing VIGS.

FIG. 4 phylogenetic analysis of tissue-organ expression, subcellular localization and homologous genes of Gh L MM gene

The expression of partial homologous genes of the gene in a A, D subgroup is basically consistent b, the subcellular localization of the Gh L MM gene is analyzed by phylogenetic analysis of the Gh L MM homologous gene (A L AD gene) from different species.

FIG. 5 Gh L MMD gene function loss resulted in increased mutant A L A content and increased ROS content.

The expression of Gh L MMA and Gh L MMD genes between W0 and Ghlmm, b-d A L AD enzyme activities of W0 and Ghlmm, A L A, PBG content comparison, e-f hydrogen peroxide and MDA content comparison of W0 and Ghlmm, g ROS staining, h hydrogen peroxide staining.

FIG. 6 spraying of 20mM L A resulted in W0 exhibiting a Ghlmm mutant phenotype.

Spraying L A (A L AD inhibitor) with 20mM results in W0 showing Ghlmm mutant phenotype, b spraying L A with 20mM results in A L A accumulation, c spraying L A with 20mM results in increased hydrogen peroxide content.

FIG. 7 identification of verticillium wilt resistance of Ghlmm mutant.

a: and (5) identifying the resistance of the Ghlmm verticillium wilt. Mutant acceptor upland cotton material W0, susceptible upland cotton variety Scirpus 1, and disease-resistant sea island cotton variety H7124 were used as controls. b: disease level survey c: relative verticillium wilt of the first true leaf 16 days after inoculation.

FIG. 8 shows the split-stem and germ recovery experiments after 16 days of inoculation.

a: the stem splitting experiment and the free-hand slicing experiment of 1cm of cotyledon knots are upward 16 days after inoculation. b: and after 16 days of inoculation, the first true leaf and cotyledon knot are upwards to 1cm of stem section, and the germ recovery experiment is carried out after the potato culture medium is cultured for 4 days. c: controls did not treat the stem split bar experiment and the free-hand slicing experiment. d: controls were performed in the leaf and stem germ resuscitation experiments without treatment.

FIG. 9 shows that the SA content of the Ghlmm mutant is increased, and the PR gene expression is increased.

a: SA content b of Ghlmm and W0: PR gene expression between W0 and Ghlmm. And c, enrichment analysis of the differential gene GO expressed by the transcriptome.

FIG. 10 ROS and SA have a cyclic amplification effect

A, SA signaling pathway genes EDS1, PAD4 and PA L are highly expressed by hydrogen peroxide, b, SA signaling pathway genes EDS1, PAD4 and PA L are highly expressed in a Ghlmm mutant, c, CAT enzyme activity in the Ghlmm is inhibited, d, after the SA synthesis of the Ghlmm is inhibited by 2-aminoindan-2 phosphoric Acid (AIP), a Ghlmm phenotype disappears, and the content of ROS is reduced, e, the SA content of the Ghlmm and the SA content of W0 are reduced after the AIP treatment.

FIG. 11 inhibition of SA synthesis and reduction of PR Gene expression in Ghlmm mutant

After inhibition of the synthesis of the Ghlmm mutant SA, PR gene expression was reduced compared to uninhibited.

FIG. 12 SA-induced expression of PR gene

After the PR gene is induced by SA, the expression level is obviously increased.

FIG. 13 dose effect of the Gh L MM gene in cell death and induction of disease resistance gene expression mimicking treatment with varying concentrations of L A

a leaf phenotype after treatment with 0, 1, 5, 10, 20 and 30mM L A and W0, b A L A and hydrogen peroxide after treatment with different concentrations of L A and SA content, and c PR gene expression after treatment with different concentrations of L A.

FIG. 14 dose effect of the Gh L MM gene in combating greensickness

Configuring 4 copies of material W0(At At Dt Dt), 2 copies of material Ghlmm mutant (At dt dt), and 3 copies of material (W0 × lmm) F₁And (5) carrying out verticillium wilt resistance identification.

a：W0、lmm、(W0×lmm)F₁The identification result of the verticillium wilt resistance. b: and (5) disease level investigation.

FIG. 15 Gh L MM Gene dose effects on A L A, ROS, SA content, and PR Gene expression

a, Gh L MM gene is in W0, (W0 × Ghlmm) F₁B, A L AD enzyme activity, A L A, PBG content, c hydrogen peroxide, SA content and CAT enzyme activity, d, the expression of the PR gene of the disease-resistant gene.

FIG. 16 Ghlmm mutant used for breeding cotton with verticillium wilt resistance

After Ghlmm mutant is respectively hybridized with TM-1 and army cotton No.1, F thereof₁The verticillium wilt resistance is obviously improved.

a：TM-1、(TM-1×Ghlmm)F₁Army cotton No.1, (army cotton No.1 × Ghlmm) F₁Identification of verticillium wilt resistance. b: and (5) disease level investigation.

FIG. 17 regulates the dose effect of the Gh L MM gene, achieving efficient balance of plant growth and disease resistance

A4: 4 copy Gh L MM gene W0(At At Dt) plants grew normally, but no A L A accumulated and the disease-resistant signaling pathway was not activated, b 3: 3 copy Gh L MM gene (W0 × Ghlmm) F₁C, 2 copies of a Ghlmm mutant of A L AD gene are accumulated in a large amount, but the A L A shows that leaf cells die, the contents of ROS and SA are obviously increased, the disease-resistant signal path is activated, the disease resistance is obviously improved, d, the VIGS is utilized to silence the Gh L MM gene of the cotton, the tetrapyrrole synthesis of the plant is blocked, the plant cannot normally grow and develop due to energy shortage, and then the plant dies.

Detailed Description

Discovery, fine positioning and map cloning of cotton lesion mutant Ghlmm

We found a lesion-like mutant in tissue culture regenerated plantlets of the gossypium hirsutum variety W0 (L esiomic mutant) which spontaneously formed lesions on leaves in the absence of any biotic or abiotic stress we named the gossypium hirsutum lesion mutant ghlimmm. ghlimmm mutant could complete the normal growth cycle with substantially unaffected fiber quality and seed yield compared to the control W0 (table 1).

Crossing the cotton lesion Ghlmm with the genetic standard line TM-1, F₁The plant leaves have no disease spots, and the phenotype is wild type. F₁Selfing to produce F containing 763 strains₂Isolating the population. At F₂Leaf phenotype character investigation is carried out at three growth and development stages of a seedling stage, a bud stage and a flower bell stage of a colony, and the phenotype of a single plant is determined. The results show that in F₂The phenotype of 209 strains in the population is Ghlmm phenotype, 554 strains are wild type, the chi-square value is 2.202, the segregation ratio of leaf normal and mutation 3:1 is met, the Ghlmm mutant is a quality character controlled by a recessive single gene, a high-density genetic linkage map constructed by the laboratory positions the Gh L MM gene between markers NAU7928 and S2393 on a D5 chromosome, the physical distance between the two markers is 371 kb., 25 open reading frames are found in the interval through TM-1 genome sequencing results, 12 genes with FPKM values larger than 1 in leaves are found in the interval, only the expression amount of Gh _ D05G2237 and Gh _ D2254 in the mutant is remarkably reduced (figure 1), the two genes are cloned in TM-1, W0 and Ghlmm, the Gh _ D05G 4 has no difference, the Gh _ D05G 4 is silenced in W0 by using a GS _ D05G silencing technology, the mutation cannot generate mutation, the mutation is further amplified by a single nucleotide at a TGA codon 767, and the mutation cannot generate mutation result that the SNP of the Ghlmm is generated by using a SNP of GG 2257, and the SNP of a single nucleotide is generated in a SNP of a SNP, and the SNP of a SNP site which is generated in a SNP site which is not generated by using a SNP of Gh _ D22510-1, wherein₂The population is amplified, and all 209 Ghlmm phenotype plants are found to have amplification products. Gh _ D05G2237 was silenced in W0 using VIGS silencing technique, showed Ghlmm phenotype after 10 days of injection, continued plant culture failed to produce new young leaves and subsequently died, and qPCR showed that the gene was silenced in all copies of the Gossypium hirsutum A, D subgroup (FIG. 3). In conclusion, we determined that the mutant phenotype of the Ghlmm mutant is due to premature termination of the gene caused by a single nucleotide mutation in Gh _ D05G2237, resulting in workThe gene is named Gh L MM in the normal material of upland cotton and contains 2 partially homologous genes, one is positioned in the A subgenome and is named Gh L MMA (the genome sequence of the gene is shown as SEQ ID NO.1, the cDNA ORF sequence of the gene is shown as SEQ ID NO.3, and the protein sequence coded by the gene is shown as SEQ ID NO. 5), the other is positioned in the D subgenome and is named Gh L MMD (the genome sequence of the gene is shown as SEQ ID NO.2, the cDNA ORF sequence of the gene is shown as SEQ ID NO.4, and the cDNA ORF sequence of the gene is shown as SEQ ID NO. 6), Gh L MM encodes 5-aminolevulinic acid dehydratase (A L AD) and has the function of converting 2 molecules of 5-aminolevulinic acid (A L A) into 1 molecule of Porphobilinogen (PBG), and the primers used for the research are listed in Table 2.

Table 1: comparison of fiber quality and yield for receptor W0 and lesion-like mutant Ghlmm

Table 2: primers for fine positioning, cloning and functional verification of target gene

Primer name	Primer sequence (5'-3')	Use of
			S2470F	TAAGTATCGTGGCCCATGGA	Fine positioning
S2470R	TGTAACCCCATTGTGTCGCA	Fine positioning
			S3183F	TCGTGGCCCATGGATTAAACT	Fine positioning
S3183R	ACTGGACGAAGCCTTGACAT	Fine positioning
			NAU7928F	GGGTAAACAAACATTGCATC	Fine positioning
NAU7928R	TCCATTCATTAGACTGCTACTTCTG	Fine positioning
			S2393F	AATGTGATGTAGCTTAGACCAACTTCCAACCTAC	Fine positioning
S2393R	GCAAATATCCTGACATGAGAACATATGAATCCA	Fine positioning
			S3184F	ACCAACCATGCAATAGTCCC	Fine positioning
S3184R	GCAGAAGGGTTCGAGAAGCA	Fine positioning
			S2450F	GTTTAAGGTTCAATTCTGGTAGGACTTCAACCTTAT	Mutation site SNP primer
S2450R	TTGTCACAAATTCCTATCACATTACCCCCTATTT	Mutation site SNP primer
			S2657F	TTTAAGGAACGAAAAAGAAATAGA	cDNA sequence clone of Gh L MM
S2657R	TCATAGAAGGAAAATCAGACCAAG	cDNA sequence clone of Gh L MM
			S2346F	TTCATTGTGTACCCATTTCTTGT	Gh L MM genome fragment clone-1
S2346R	CATTGTCATTGTAGGCTTCATCC	Gh L MM genome fragment clone-1
			S2347F	CAGGATGTTATAGGCTTGGATGG	Gh L MM genome fragment clone-2
S2347R	GATTTGATAGGCGAAAAGGGATT	Gh L MM genome fragment clone-2
			S2348F	AGGTTTTACTTTCTTTTCACTTCC	Gh L MM genome fragment clone-3
S2348R	CATTCTAACAACTAGCACTCTCGA	Gh L MM genome fragment clone-3
			S2454F	CAATGACAATGGTTTAGTGCCT	Gh L MM VIGS vector construction
S2454R	TTCTCTGTAATTTGCTGGGTTC	Gh L MM VIGS vector construction
			S4349F	GTCGAGAGGGAATAACTGGGA	cDNA sequence clone of Gh _05D2254
S4349R	AGTCCAACCACCGTTGATGTT	cDNA sequence clone of Gh _05D2254
			S3649F	CGGCCACTTAAATCCCTCCA	Gh _05D2254 VIGS vector construction
S3649R	CTGAACCAAGCACTCAACCG	Gh _05D2254 VIGS vector construction

(2) Characterization and evolutionary analysis of the Gh L MM Gene

Based on the released tetraploid TM-1 genome sequence data of cotton and sequenced species sequence information, PFAM website http:// pfam.janelia.org, download seed file (Pfam 00490). We investigated algae, Chlamydomonas, Panicum, ferns, moss, lichen microphyllus, gymnosperm, Norway spruce, monocot, rice, millet, sorghum, brachypodium dicotyledon, Arabidopsis, soybean, grape, cacao, poplar, and three cotton species, Raymond cotton, Asian cotton, and upland G.benthamiana homologous gene (A L AD gene). The phylogenetic tree construction was performed using MEGA 865GA software.A L AD gene has the most number of only 2, different sources of A L AD gene has structural similarity, A L AD 2 gene has the most ploidy, function is very important, and the gene expression of the gene is analyzed by designing conservative primer L, quantitative PCR using MMA-PCR primer for different organ expression levels of different stem and leaf tissues, and organ expression of different stem, relative gene expression of Gmm 634, and gene expression of GmMMH 635, and L.A 635 AD gene is analyzed by using MMH 639. A635, and DNA for different expression of different relative gene expression of different stem, MMH, and L, and L.A.A.A.A.A.A.A.A.A.A.A.A.7, E.A.A.A.A.A.7, E.A.A.7, E.A.A.A.A.A.

Table 3: primers for amplification

Primer name	Primer sequence (5'-3')	Use of
			S2622F	TGGTGAGAAGAGGTGAACTTGGTCCG	Gh L MM-Dt quantitative PCR
S2622R	AGGCTTATGAAGATGCGGACTACGAACAG	Gh L MM-Dt quantitative PCR
			S2706F	TTATCCTTACATATTTTGCTCTACAAGCTGCAAGAG	Gh L MM-At quantitative PCR
S2706R	CTCCTCATCGTTTTAACAACTAGCACTCTCGA	Gh L MM-At quantitative PCR
			S2979F	GAACGATAGGGTACCCCCGGGATGGCTTCCACAATTGTAAA	Sub-cellular localization of Gh L MM
S2979R	GCCCTTGCTCACCATGGATCCCCTCTTCTCACCACATAAAG	Sub-cellular localization of Gh L MM

(3) Study of apoptosis mechanism of lesion-like mutant

The Gh MM gene encodes 5-aminolevulinic acid dehydratase (A AD), which is a key enzyme in the synthesis of tetrapyrrole compounds, and functions to convert A0A into PBG, We speculate that the mutation of Gh 2MM encoding the A1 AD gene in a Ghlmm mutant causes the accumulation of A3A, after the accumulation of A4A is excessive, enolization generates ROS, the accumulation of ROS generates oxidative stress on lipid molecules of plant cell membranes, causing the death of plant cells, taking W and Ghlmm as research materials, sampling at the stage when cotton grows to two leaves and one heart, detecting the expression of the Gh 5MM gene, finding that the expression of Gh 6MMA in W and Ghlmm is not different, but the early termination of the Gh 7MMD gene causes the loss of gene function, the expression of the Ghlmm is also significantly reduced, and simultaneously we detect the A8 AD enzyme activity, find that the Ghlmm has the A9 AD enzyme activity, but the enzyme activity level thereof is significantly reduced compared with the wild type, the Gh 6 MDA has the A activity of A0 type, the GMh 1AD gene, the GMh 2AD gene is equivalent to increase in vitro to cause the accumulation of ROS A, and the GMh A accumulation of the GMh 5A accumulation of ROS, and the GMh A accumulation of the GMh 5A are increased after the accumulation of the wild type GMh A.

(4) Disease resistance identification and disease resistance mechanism research of lesion-like mutant Ghlmm

The mutant Ghlmm, the receptor W0, the disease-resistant material H7124 and the disease-sensitive material army cotton No.1 are used as research materials to identify the verticillium wilt resistance of the Ghlmm mutant, 16 to 18 days after the cotton is planted, the plant is in the 2-leaf first heart period, and the cultured verticillium wilt bacteria V991, 20m L1 × 10 are used⁷The suspended spore liquid is used for grafting diseases in a mode of tearing the bottom and damaging the root. The disease grade was investigated after receiving the disease. W0 and Scutellaria armeniaca No.1 leaves showed a etiolated wilting phenotype 16 days after inoculation, while Ghlmm and H7124 showed no susceptible phenotype. Extracting DNA of a first true leaf of cotton, carrying out quantitative verification by using a verticillium dahliae internal standard gene primer, detecting the relative content of verticillium wilt in cotton leaves by using a histone 3 gene of cotton as an internal standard, and finding that Ghlmm and H7124 take part in the wiltAfter 16 days, verticillium wilt was not detected in the first true leaf, whereas verticillium wilt was higher in W0 and Scotton-cotton No. (FIG. 7). Stalk slicing experiments found that the bundle of No. 1D-fibers of W0 and Jun cotton became brownish black. The stem segment and the first true leaf of the same part of the plant are taken and placed in a potato culture medium for four days, and found that the stem of No. 1W 0 and army cotton has obvious bacterial plaque neutralization with the first true leaf verticillium. The Ghlmm and H7124 stem slicing experiments and the bacteria resuscitation experiments show that after the inoculation is carried out for 16 days, no obvious bacteria infection phenotype exists (figure 8). To further reveal the molecular mechanism of resistance to diseases of the Ghlmm mutant, W0 and Ghlmm are taken as research materials, and sampling is carried out when cotton grows to the period of two leaves and one heart. The increased SA content is a necessary condition for the plant System Acquired Resistance (SAR), and the SA content in Ghlmm is obviously increased compared with a control by detecting the SA content of the plant. The sign of SAR is the high expression of PR gene, and PR gene is the direct effect gene of plant to resist germ infection. In the period of two leaves and one heart, the expression characteristics of PR gene are detected by taking roots, stems and leaves of W0 and the mutant Ghlmm. The result shows that the expression level of PR gene in the leaf of Ghlmm is obviously increased, and the expression level of PR1 and PR5 is different by more than one hundred times compared with the control. On stems and roots, significantly high expression of the PR gene was also detected. To reveal the disease-resistant mechanism of ghlim at the genome-wide level. We extracted W0 and Ghlmm leaf RNA for transcriptome differential expression analysis. And screening expression difference genes according to a sequencing result, and carrying out GO enrichment. The results showed that genes associated with stress, defense response, plant immunity, etc. were significantly enriched in ghlim (fig. 9).

To further study the relationship between ROS and SA in the mutant, we sprayed W0 and ghlimm.1 mM with 2-aminoindan-2 phosphoric Acid (AIP), then we sprayed SA 0 and gmmm with SA 0, the phenotype of the leaf cells of gmmm disappears, and compared to the pre-mutant, the expression of the SA signal is significantly reduced, and the graph shows that the expression of the SA signal is also significantly reduced by the cyclic PR expression of the genes expressed by PR 11, PR-PR 12, PR-induced by the genes expressed in the early-mutant, which is also shown by the high expression of the genes expressed by PR-induced by the genes expressed in the early-PR-induced by the genes.

Table 4: primers for amplification

(5) Research on dose effect of Gh L MM gene between regulation of plant growth and disease resistance

Ghlmm mutant leaf cell death phenotype and disease resistance increase due to Gh L MMD gene mutation of receptor W0 Gh L MMA did not compensate for the loss of function of the Gh L MMD gene, indicating that the phenotypic and disease resistance differences between the two are due to the difference in copy number of the Gh L MM gene, therefore, the functional characteristics of Gh L MM had a dose effect.

Firstly, L A with different concentrations is externally applied to inhibit A L AD enzyme activity and simulate the inhibition of Gh L MM with different degrees, in the period from the growth of W0 to the two-leaf one-heart period, an in vitro spraying method is adopted, 0, 1, 5, 10, 20 and 30mM of L A is sprayed, after spraying for 24 hours, 20mM and 30mM of leaves show Ghlmm mutant phenotype, namely local cells of the leaves are browned and dead to form necrotic spots, and 10mM of leaves have unobvious cell death phenomena, after spraying of 0, 1 and 5mM L A, the cotton leaves do not form necrotic spots, through detection of A L A, hydrogen peroxide and SA contents, the contents of A L A, hydrogen peroxide and SA are increased along with the increase of the spraying concentration of L A, and the expression of PR genes is increased along with the concentration of L A,

the expression level was increased (FIG. 13).

Using W0(At At Dt) of four Gh L MM gene copies and Ghlmm (At At Dt) of two Gh L MM gene copies, hybridization produced three Gh L MM copies (W0 × Ghlmm) F₁(At Dt.) identification of verticillium wilt resistance of three materials results show that (W0 × Ghlmm) F₁The verticillium wilt resistance of the cotton is between W0 and Ghlmm, the disease level reaches 60 percent after 28 days of inoculation, the disease level of W0 exceeds 95 percent, and the Ghlmm is about 40 percent₁The expression of the gene Gh L MMD is among three materials, while the expression of Gh L MMA is not significantly different, A L AD enzyme activity detection also obtains similar results, along with the reduction of copy number, the accumulation of A L A is increased, the content of PBG is reduced, the content of hydrogen peroxide and the content of SA are also increased along with the reduction of copy number of Gh L MM (W0 × Ghlmm) F₁The expression of the PR gene in leaves was also significantly higher than W0, lower than ghlim, at an intermediate level, consistent with its disease resistance performance (fig. 15).

Through the simulation experiment of externally applied L A and the identification of the growth and disease resistance of different copies of Gh L MM gene material, the Gh L MM has a dose effect in regulating the growth and plant immunity of plants.

(6) Application of Ghlmm mutant in disease-resistant breeding of cotton

Upland cotton verticillium wilt resistance breeding is a difficult problem for cotton breeders, mainly because upland cotton lacks verticillium wilt resistance sources, upland cotton mutant Ghlmm has remarkably increased verticillium wilt resistance, and the fiber quality and seed yield of the upland cotton mutant are basically not influenced, (W0 × Ghlmm) F produced by hybridization with parent W0₁Also shows a significant improvement in the resistance to verticillium wilt. Therefore, we imagine that the Ghlmm mutant is used for crossbreeding to improve the existing upland cotton variety with poor verticillium wilt resistance. We select twoIndividual susceptible varieties: standard lines of upland cotton TM-1 and military cotton No.1, which are hybridized with Ghlmm to generate F₁The test shows that (TM-1 × Ghlmm) F is compared with the susceptible parent₁"(military cotton No.1 × Ghlmm) F₁In addition, the gene is taken as a target gene, and the expression of the Gh L MM gene is reduced within a certain range by gene engineering methods such as antisense RNA technology and the like, so that the balance between the growth and disease resistance of cotton can be accurately regulated, and a new germplasm with remarkably improved resistance is cultivated and applied to production.

SEQUENCE LISTING

<110> Nanjing university of agriculture

<120> Gh L MM gene capable of remarkably improving disease resistance of cotton and application thereof

<130>2017

<160>6

<170>PatentIn version 3.3

<210>1

<211>4642

<212>DNA

<213> upland cotton

<221> nucleotide sequence of Gh L MM in genome A subgroup of upland cotton genetic standard line TM-1

<400>1

tttcattgtg tacccatttc ttgttttagc tgatttgtgc tgttatttta gttagaattt 60

catcttttac gattgcagag atcgtgagaa ttttgtgtca tggcttccac aattgtaaat 120

gctccctgca cggttccttc tgttaaaggt tttgagactc aaaactacgt tggtcttaga 180

ccaatttcta gtttaaggtt caattctggt aggacttcaa cctcaggacg ttctcggggc 240

ctttttgtgg tgagggcatg cgaaaggcat gatggacatg tgaaaaagat tgaaatgagt 300

attgaagaat gtgaggctgc tgttgtagct gggaatgcgc ctgaagctcc tccagttccc 360

cctaagccag ctgctcctgt tgggactcct gtgattaaac cttatgtgag tgtttgaaat 420

gaaatgataa tattttatct tttgcccata ttttacggtg cttgcttatt tatgttcata 480

tgcaaatagg gggtaatgtg ataggaattt gtgacaaatt gattgtgttt gagtggtttt 540

agaatgtctc cgataagtgt ttggtctatt gaatggtgat ttgttttaga cttttatatg 600

tgtttgaaaa ttcacattca caggtttaat tttcttgttc gctgacatga atttgattta 660

atcattaatt gtttgttcat ctcatctcat caattcatga cattgaagta aaatagtttt 720

aagttataat agaggttttgaggtcaattg gtggacctct cctttctcct ttgctcactc 780

ggtgtttgtt tgtattagca acttaccagg cgtcctcgtc gtaaccgtaa gtcccctgca 840

ttgagagcat cattccagga aacaagtata tctcctgcaa attttgtata tcctcttttt 900

attcatgaag gttggtattc atggatctta gtcctttctt tttggtgaaa taagttagat 960

attaaaagtg gagcaatttt accaaagatc atgataagcg ccctcaaatt tgttacatga 1020

atattatatt gttgcagttt tcttttcttt tccttttttg ttgcgacttt tgtgatactt 1080

ttctgtttac tctctttctt accttccagt acgtgcttac atctacttgg tactgttccc 1140

ttgacctgca ggtcaggagg acacacccat tggagctatg ccaggatgtt ataggcttgg 1200

atggagacat ggacttgttg aagaggtgat cttttgtatt atgcatcctt tttcataaac 1260

aatttgcatt tgtccctcaa aactagttcc cgggtgctgt atgtgttgtt ttaatgactt 1320

atctatttta tgtaactgta tgatgataaa cattctattt gatatcaaag ttataaacat 1380

atacaagcat gttatatact tatttagtgt gtcaactgtg aagttgtttt gaagtgtgca 1440

ttatctattg caggtggcaa aggcctggga tgttggagtt aatagtattg tgctcttccc 1500

caaagttcca gatgctctga aggttttgat ctcccgctat aatgctattt gcttcatatg 1560

ttgatgtata taattggttt tttgcacttt agtctcccac aggagatgaa gcctacaatg 1620

acaatggttt agtgcctcga acaattcgtc tgcttaagga caagttccct gaccttgtaa 1680

gtcaatgaag ttcattcatt gatttttata ttgtttagtg cctccagcct tatgaaatca 1740

tggtgatatc ttatcggttt tttaggttat ctatacggat gttgctttag atccatactc 1800

ctcagatggg catgatggta ttgtcagaga agatggtaag acaagatatg cttcacacac 1860

ttttgcccgc taaaagaaga gtatcttatt tagaagacat gttttcacct tgttgaactg 1920

ttttttggtt tgccacattg aaatacaagt taacttagaa gaatgataca tgagctcttt 1980

cctaaaaaat gtcgtgtgca tactaattgg tcaaaataaa taatgttctt ataaagtcat 2040

agaaatacta attgcttctt tgttttttta ccctgtagga gtcataatga atgatgagac 2100

agtgcatcaa ttatgtaagc aagcggtgtc ccaggtaatt tttgtagttt ttttttttta 2160

aatatactct taggcagaag tttactgtct tcataagagt tctaaatgcc ataatggtga 2220

tgacttactg atgtttgttg tggtcactgg tgtctcataa aaaaaaatca gtgaccttgt 2280

tcgcttttgt taaattcttc tctcccctcc ccttgcttgt cttgatacat atccatggca 2340

taacttttaa taaatacttt gaggaactag tgtttcaaat gcttaaagca agcaaaaact 2400

tgctgttaca gctttaaatg gctagtcagt gtgatgcttg gagttttcta atcatttgaa 2460

tggatattgg aggtctccta tgctcgtttg tgtcctattc ttttttttgc tagatttaac 2520

ttgattggac atgttttaat ttttttgggt ggtgtattct taaaggctcg agctggagct 2580

gatgttatta gtcccagtga tatgatggat ggacgtgttg gagctattcg tgctgccctt 2640

gattctgaag gctttcacca tgtttctatc atgtcctata cagcaaagta atttcactat 2700

ctgccccctt gcattcctat agttgtttgt ttgtaggtct accagtttct aaaagtaggt 2760

ttgaagcatg gtaacagata tatgattatg ttaaaccacc gcaaaggttt tactttcttt 2820

tcacttcctg aagaactttt gagaaagatt attaagaagt catgaagagt tcaaagagaa 2880

attgagatga aaacttctta ctaatctgaa ttttacagcc ttattttccagctttatata 2940

cagaaaaaaa tttaactata ataagaaaga aaattttact attaaaacta aaatctctcc 3000

tatgaataaa gaataaaata gctgtaccta gtccactaat tttgcagtat tccgtccttc 3060

aaattagtct atcaaatccc ttttcgccta tcaaatcttg agaatcttgg aataagagtc 3120

ccaggtttcc acacttgccc actatgcaag tagaatggta ttattcagtt gccttgctcg 3180

aaggcaatag tctttcttca tgttgttgtc taattgcata agacattatc atttttctta 3240

tcagttggtc actgaacact ttagaaaaat aaactatgtt gacagaagtt attctgagtt 3300

attcttggcg gctgggtgaa atttattgac acagtttgtc attctctttt tcttgggata 3360

acagatatgc aagttcattt tatggcccct tccgagaagc actggactct aacccacgct 3420

ttggagataa aaaaacgtat gaattcactt gcctgtactg tattttttgg gctttcatgc 3480

gctctttttg gtgcttacat ttgattgtta atcttgtttg ttaaaaacag gtatcagatg 3540

aacccagcaa attacagaga agcattagtt gaggctcatg aagatgaggc tgaaggtgct 3600

gacattctat tggtcagtat gacgctttta aggaattttg agttgttttt gttaatggct 3660

aagctcccat catgctgaag tctctctaac tggatcacag gtcaagcctg gtctccctta 3720

tttggatatc attagacttc tcagggatca atctcctttg cctattgctg cctaccaggt 3780

attctcttaa ctttccgtgt cctgcattaa ctaatattct tggcattgtt ttcattgcaa 3840

cttgaaacct ttcgataata attccccatg gtccctggaa atgaaaatga aaatgaaaat 3900

ttgaggcaac attcatatat attagtaatt gttttgtcag ttccagcact aggtccttag 3960

attccccctt ttggaattga tgcccttagc aaaactattc ttgacacgaa attatttata 4020

ttacattttt gttcttttta gcgaaatcag gggattggta tttttaacta cattgtctga 4080

ttcattcttg tagagtgtag ttcattctta ataggctgaa ggatgcagga agtaaggatg 4140

gcacgagaat agtagaaaac tgagaagggg gggaaaatat aagtgggttg cttttgcata 4200

tttcatgaac caatcattct tgtacgagat actcaagatt acgtctttat tactactaac 4260

tattctataa ttagtggtgt aaaaaaagaa aatatactat ttctcccccc cccccccgaa 4320

aaaaaaatgc agactttcac tatcctaccg ctatcaaaat ttgatttttt ttccaggttt 4380

caggtgaata ctccatgatc aaagccggta gtgttctcaa aatgattgat gaagaaaggg 4440

tcatgatgga atcattgatg tgcctccgcc gggctggtgc cgacattatc cttacatatt 4500

ttgctctaca agctgcaagg gctttatgtg gtgagaagag gtgaacttgg tctaattttc 4560

cttctatgaa gctttggttg attctgcaaa aaaggcttga gacactaaat cttccattcg 4620

agagtgctag ttgttagaat ga 4642

<210>2

<211>4699

<212>DNA

<213> upland cotton

<221> nucleotide sequence of Gh L MM in genome D subgroup of upland cotton genetic standard line TM-1

<400>2

tttcattgtg tacccatttc ttgttttagc tgatttgtgc tgctatttta gttagaattt 60

catcttttac gattgcagag atcgtgagaa ttttatgtca tggcttccac aattgtaaat 120

gccccctgca cggttccttc tgttaaaggt tttgagactc aaaactacgt tggtcttaga 180

ccaatttcta gtttaaggtt caattctggt aggacttcaa cctcaggacg ttctcggggc 240

ctttttgtgg tgagggcatg cgaaaggcat gatggacatg tgaaaaagat tgaaatgagt 300

attgaagaat gtgaggctgc tgttgtagct gggaatgccc ccgaagctcc tccagttccc 360

cccaagccag ctgctcctgt tgggactcct gtgattaaac cttatgtgag tgtttgaaat 420

gaaatgataa tattttatct tctgcccata ttttacagtg cttgcttatt aatgttcata 480

tgcaaatagg gggtaatgtg ataggaattt gtgacaaatt gattgtgttt gagtggtttt 540

agaatgtctc cggcaagtgt ttggtctatt gaatggtgat ttgttttaga cttttatatg 600

tgtttgaaaa ttcacattca caggtttaat tttcttgttc gctgacatga atttgattta 660

atcagtaatt gtttgttcac ctcatctcat caattcatga cattggagta aaatagtttt 720

aagttataat tgaggttttg aggccaattg gtggacctct cctttctcct ttgctcactc 780

ggtgtttgtt tgtattagca acttaccagg cgtcctcgtc gtaaccgtaa gtcccctgca 840

ttgagagcat cattccagga aacaagtata tctcctgcaa attttgtata tcctcttttt 900

attcatgaag gttggtattc atggatctta gtcctttctt tttggtgaaa taagttagat 960

attaaaggtg gagcaatttt accaaagatc atgataagcg ccctcaaatt tgtaaaatga 1020

atattatatt gttgcagttt tcttttcttt tccttttttg ttgcgacttt tgtgatactt 1080

ttctgtttac tctctttctt accttccagt atgtgcttac atctactttg gtactgttcc 1140

ctcgacctgc aggtcaggag gacacaccca ttggagctat gccaggatgt tataggcttg 1200

gatggagaca tggacttgtt gaagaggtga ccttttgcat tatgcatcct ttttcataaa 1260

caatttgcat ttttccccat tatgcatcct ttttcataaa caatttgcat ttttccctca 1320

aaactagttc ccaggtgctg tatatgttgt tttaatgact tatctatttc atgtaactgt 1380

aaggtgataa acattctatt tgatatcgaa gttataaaca tatacaagca tgttatatac 1440

ttatttagtg tgtcaactgt gaagttgttt tgaagtgtgc attatctatt gcaggtggca 1500

aaggcccggg atgttggagt taatagtatt gtgctcttcc ccaaagttcc agatgctctg 1560

aaggttttga tctcccgcta taatgctatt tgcttcatat gttgatgtat ataattggtt 1620

ttttgcactt tagtctccca caggggatga agcctacaat gacaatggtt tagtgcctcg 1680

aacaattcgt ctgcttaagg acaaattccc tgaccttgta agtcaatgaa gttcattcat 1740

tgatttttat attgtttagt gcctccagcc ttatgaaatc atgttgatat cttatcggtt 1800

ttttaggtta tctatacgga tgttgcttta gatccatact cctcagatgg gcatgatggt 1860

attgtcagag aagatggtaa gacaagatat gcttcacaca cttttggctg ctaaaagaag 1920

agtatcttat ttacaagaca tgttttcacc ttgttgaact gttttttggt ttgccacatt 1980

gacatacaag ttaacttaga agaatgatac atgagctctt tcctaaaaaa tgtcgtgtgc 2040

ttactaattg gtcaaaataa atagtgttct tataaagtca tagaaatact aattgctact 2100

ttgttttttt cccctgtagg agtcataatg aatgatgaga cagtgcatca attatgtaag 2160

caagctgtgt cccaggtaat ttttgtaggg tttttttttt tttaaaatat actctttggc 2220

agaagtctac tgtcttcata agagttctaa atgccataat ggtgatgact tactgatgtt 2280

tgttgtggtc actggtgtct cataaaaaaa atcagtgacc ttgtttgctt ttgttatatt 2340

cttctctccc cctcccctcg cttgtcttga tacatatcca tggcataact tttaataaat 2400

actttgagga actagtgttt caaatgctta aagcaagcaa aaacttgctg ttacagcttt 2460

aaatggctag tcagtgtgat acttggagtt ctctaatcat ttgaatggat attggaggtc 2520

tcctatgctc atttgtgtcc tattcttttt tttgctagct ttaacttgat tggacatgtt 2580

ttaaattttt tgggtggtgt attcttaaag gcccgagctg gagctgatgt tgttagcccc 2640

agtgatatga tggatggacg tgttggagct attcgtgctg cccttgattc tgaaggcttt 2700

caccatgttt ctatcatgtc ctatacagca aagtaatttg actatctgcc cccttgcatt 2760

cctatagctg tttgtttgta ggtctaccag tttctaaaag taggtttgaa gcatggtaac 2820

agatatatga ttatgtaaac catcgcaaag gttttacttt cttttcactt cctgaagaac 2880

ttttgagaaa gattattaag aagtcttgaa gagttcaaag agaaattgag atgaaaactt 2940

cttactaatc tgaattttac agccttattt tccagcttta tatacacaaa aaaatttaac 3000

tataataaga aagaaaatct tactattaaa actaaaatct ctcccatgaa taaagaataa 3060

aatagctgta cctaatccac taatttagca gtattccgtc cttcaaatta gtctatcaaa 3120

tcccttttcg cctatcaaat ctggagaatc ttggaataag agccccaggt ttccacactt 3180

gcccactatg caagtagaat ggtattattc tgttgccttg ttcgaaggca atagtccttt 3240

tcatgttgtt gtctaattgc ataagacatt atcgtttttc ttattagttg gtcactgaac 3300

aatttagaaa agtaaactat gttgacagaa gttattctga gttattcttg gcggctgggt 3360

gagatttatt gacacagttt gtcattctct ttttcttggg ataacagata tgcgagttca 3420

ttttatggcc ccttccgaga agcactggac tctaacccac gctttggaga taaaaaaacg 3480

tatgaattca cttgcctgta ctgtatttta tgggctttca tgggctcttt ttggtgctta 3540

catttgattg ttaatcttgt ttgttaaaaa caggtatcag atgaacccag caaattacag 3600

agaagcatta gttgaggctc atgaagatga ggctgaaggt gctgacattc tattggtcag 3660

tatgacgctt ttaaggaatt ttgagttctt tttgttaatg gctaagctcc catcatgatg 3720

aagtctctct aactggatca caggtcaagc ctggtctccc ttatttggat atcataagac 3780

ttctcaggga tcaatctcct ttgcctattg ctgcctacca ggtattctct taactttttc 3840

gtgtcctgca ttaactaata ttcttgtcat tgttttcatt gcaacttgaa acctttcttt 3900

gataagaatt ccctatggtc cctggaaatg aaaatgaaaa tgaaaatttg aggcaacatt 3960

catatataac cagtaattgt tttgtcagtt cctgcactag gtccttggat tgcccctttt 4020

ggaattaatg cccttagcaa aacttttcgt gacacgaaat tatttatatt acatttttgt 4080

tctttttagc aaaatcaggg gattggtatt tttaactaca ttgtctgata ttgtctgatt 4140

cattcttgta gagtgtagtt catacttaat aggttgaagg atgcaggaag taaggatggc 4200

atgagaatag tagaaaacta agaaggggtg ggggaaatat aagcgggttg cttttgcata 4260

tttcatgaac caatcattct tgtacgagat actcaagatt acgtctttat tactactaac 4320

tgttctataa ttagtggtgg aaaaaaagaa aatatactat ttctcccccc cccccaaaaa 4380

aaatgcagac tttcactttc ctacccctat caaaatttga tttttttttc caggtttcag 4440

gtgaatactc catgatcaaa gctggtggtg ttctcaaaat gattgatgaa gaaagggtca 4500

tgatggaatc cttgatgtgt ctccgccgag ctggtgccga cattatcctt acatattttg 4560

ctctacaagc tgcaaggtct ttatgtggtg agaagaggtg aacttggtct gattttcctc 4620

ctatgaagct ttggttgatt ctgcaaaaaa ggcttgagac actaaatctt ccattcgaga 4680

gtgctagttg ttagaatga 4699

<210>3

<211>1293

<212>DNA

<213> Artificial sequence

<221> Gh L MM cDNA ORF sequence in the genomic A subgroup of the upland cotton genetic standard line TM-1

<400>3

atggcttcca caattgtaaa tgctccctgc acggttcctt ctgttaaagg ttttgagact 60

caaaactacg ttggtcttag accaatttct agtttaaggt tcaattctgg taggacttca 120

acctcaggac gttctcgggg cctttttgtg gtgagggcat gcgaaaggca tgatggacat 180

gtgaaaaaga ttgaaatgag tattgaagaa tgtgaggctg ctgttgtagc tgggaatgcg 240

cctgaagctc ctccagttcc ccctaagcca gctgctcctg ttgggactcc tgtgattaaa 300

ccttatcaac ttaccaggcg tcctcgtcgt aaccgtaagt cccctgcatt gagagcatca 360

ttccaggaaa caagtatatc tcctgcaaat tttgtatatc ctctttttat tcatgaaggt 420

caggaggaca cacccattgg agctatgcca ggatgttata ggcttggatg gagacatgga 480

cttgttgaag aggtggcaaa ggcctgggat gttggagtta atagtattgt gctcttcccc 540

aaagttccag atgctctgaa gtctcccaca ggagatgaag cctacaatga caatggttta 600

gtgcctcgaa caattcgtct gcttaaggac aagttccctg accttgttat ctatacggat 660

gttgctttag atccatactc ctcagatggg catgatggta ttgtcagaga agatggagtc 720

ataatgaatg atgagacagt gcatcaatta tgtaagcaag cggtgtccca ggctcgagct 780

ggagctgatg ttattagtcc cagtgatatg atggatggac gtgttggagc tattcgtgct 840

gcccttgatt ctgaaggctt tcaccatgtt tctatcatgt cctatacagc aaaatatgca 900

agttcatttt atggcccctt ccgagaagca ctggactcta acccacgctt tggagataaa 960

aaaacgtatc agatgaaccc agcaaattac agagaagcat tagttgaggc tcatgaagat 1020

gaggctgaag gtgctgacat tctattggtc aagcctggtc tcccttattt ggatatcatt 1080

agacttctca gggatcaatc tcctttgcct attgctgcct accaggtttc aggtgaatac 1140

tccatgatca aagccggtag tgttctcaaa atgattgatg aagaaagggt catgatggaa 1200

tcattgatgt gcctccgccg ggctggtgcc gacattatcc ttacatattt tgctctacaa 1260

gctgcaaggg ctttatgtgg tgagaagagg tga 1293

<210>4

<211>1293

<212>DNA

<213> Artificial sequence

<221> Gh L MM cDNA ORF sequence in the genomic D subgroup of the upland cotton genetic standard line TM-1

<400>4

atggcttcca caattgtaaa tgccccctgc acggttcctt ctgttaaagg ttttgagact 60

caaaactacg ttggtcttag accaatttct agtttaaggt tcaattctgg taggacttca 120

acctcaggac gttctcgggg cctttttgtg gtgagggcat gcgaaaggca tgatggacat 180

gtgaaaaaga ttgaaatgag tattgaagaa tgtgaggctg ctgttgtagc tgggaatgcc 240

cccgaagctc ctccagttcc ccccaagcca gctgctcctg ttgggactcc tgtgattaaa 300

ccttatcaac ttaccaggcg tcctcgtcgt aaccgtaagt cccctgcatt gagagcatca 360

ttccaggaaa caagtatatc tcctgcaaat tttgtatatc ctctttttat tcatgaaggt 420

caggaggaca cacccattgg agctatgcca ggatgttata ggcttggatg gagacatgga 480

cttgttgaag aggtggcaaa ggcccgggat gttggagtta atagtattgt gctcttcccc 540

aaagttccag atgctctgaa gtctcccaca ggggatgaag cctacaatga caatggttta 600

gtgcctcgaa caattcgtct gcttaaggac aaattccctg accttgttat ctatacggat 660

gttgctttag atccatactc ctcagatggg catgatggta ttgtcagaga agatggagtc 720

ataatgaatg atgagacagt gcatcaatta tgtaagcaag ctgtgtccca ggcccgagct 780

ggagctgatg ttgttagccc cagtgatatg atggatggac gtgttggagc tattcgtgct 840

gcccttgatt ctgaaggctt tcaccatgtt tctatcatgt cctatacagc aaaatatgcg 900

agttcatttt atggcccctt ccgagaagca ctggactcta acccacgctt tggagataaa 960

aaaacgtatc agatgaaccc agcaaattac agagaagcat tagttgaggc tcatgaagat 1020

gaggctgaag gtgctgacat tctattggtc aagcctggtc tcccttattt ggatatcata 1080

agacttctca gggatcaatc tcctttgcct attgctgcct accaggtttc aggtgaatac 1140

tccatgatca aagctggtgg tgttctcaaa atgattgatg aagaaagggt catgatggaa 1200

tccttgatgt gtctccgccg agctggtgcc gacattatcc ttacatattt tgctctacaa 1260

gctgcaaggt ctttatgtgg tgagaagagg tga 1293

<210>5

<211>430

<212>PRT

<213> Artificial sequence

<221> Gh L MM amino acid sequence in genome A subgroup of upland cotton genetic standard line TM-1

<400>5

Met Ala Ser Thr Ile Val Asn Ala Pro Cys Thr Val Pro Ser Val Lys

1 5 10 15

Gly Phe Glu Thr Gln Asn Tyr Val Gly Leu Arg Pro Ile Ser Ser Leu

20 25 30

Arg Phe Asn Ser Gly Arg Thr Ser Thr Ser Gly Arg Ser Arg Gly Leu

35 40 45

Phe Val Val Arg Ala Cys Glu Arg His Asp Gly His Val Lys Lys Ile

50 55 60

Glu Met Ser Ile Glu Glu Cys Glu Ala Ala Val Val Ala Gly Asn Ala

65 70 75 80

Pro Glu Ala Pro Pro Val Pro Pro Lys Pro Ala Ala Pro Val Gly Thr

85 90 95

Pro Val Ile Lys Pro Tyr Gln Leu Thr Arg Arg Pro Arg Arg Asn Arg

100 105 110

Lys Ser Pro Ala Leu Arg Ala Ser Phe Gln Glu Thr Ser Ile Ser Pro

115 120 125

Ala Asn Phe Val Tyr Pro Leu Phe Ile His Glu Gly Gln Glu Asp Thr

130135 140

Pro Ile Gly Ala Met Pro Gly Cys Tyr Arg Leu Gly Trp Arg His Gly

145 150 155 160

Leu Val Glu Glu Val Ala Lys Ala Trp Asp Val Gly Val Asn Ser Ile

165 170 175

Val Leu Phe Pro Lys Val Pro Asp Ala Leu Lys Ser Pro Thr Gly Asp

180 185 190

Glu Ala Tyr Asn Asp Asn Gly Leu Val Pro Arg Thr Ile Arg Leu Leu

195 200 205

Lys Asp Lys Phe Pro Asp Leu Val Ile Tyr Thr Asp Val Ala Leu Asp

210 215 220

Pro Tyr Ser Ser Asp Gly His Asp Gly Ile Val Arg Glu Asp Gly Val

225 230 235 240

Ile Met Asn Asp Glu Thr Val His Gln Leu Cys Lys Gln Ala Val Ser

245 250 255

Gln Ala Arg Ala Gly Ala Asp Val Ile Ser Pro Ser Asp Met Met Asp

260 265 270

Gly Arg Val Gly Ala Ile Arg Ala Ala Leu Asp Ser Glu Gly Phe His

275 280 285

His Val Ser Ile Met Ser Tyr Thr Ala Lys Tyr Ala Ser Ser Phe Tyr

290295 300

Gly Pro Phe Arg Glu Ala Leu Asp Ser Asn Pro Arg Phe Gly Asp Lys

305 310 315 320

Lys Thr Tyr Gln Met Asn Pro Ala Asn Tyr Arg Glu Ala Leu Val Glu

325 330 335

Ala His Glu Asp Glu Ala Glu Gly Ala Asp Ile Leu Leu Val Lys Pro

340 345 350

Gly Leu Pro Tyr Leu Asp Ile Ile Arg Leu Leu Arg Asp Gln Ser Pro

355 360 365

Leu Pro Ile Ala Ala Tyr Gln Val Ser Gly Glu Tyr Ser Met Ile Lys

370 375 380

Ala Gly Ser Val Leu Lys Met Ile Asp Glu Glu Arg Val Met Met Glu

385 390 395 400

Ser Leu Met Cys Leu Arg Arg Ala Gly Ala Asp Ile Ile Leu Thr Tyr

405 410 415

Phe Ala Leu Gln Ala Ala Arg Ala Leu Cys Gly Glu Lys Arg

420 425 430

<210>6

<211>430

<212>PRT

<213> Artificial sequence

<221> Gh L MM amino acid sequence in genome D subgroup of upland cotton genetic standard line TM-1

<400>6

Met Ala Ser Thr Ile Val Asn Ala Pro Cys Thr Val Pro Ser Val Lys

1 5 10 15

Gly Phe Glu Thr Gln Asn Tyr Val Gly Leu Arg Pro Ile Ser Ser Leu

20 25 30

Arg Phe Asn Ser Gly Arg Thr Ser Thr Ser Gly Arg Ser Arg Gly Leu

35 40 45

Phe Val Val Arg Ala Cys Glu Arg His Asp Gly His Val Lys Lys Ile

50 55 60

Glu Met Ser Ile Glu Glu Cys Glu Ala Ala Val Val Ala Gly Asn Ala

65 70 75 80

Pro Glu Ala Pro Pro Val Pro Pro Lys Pro Ala Ala Pro Val Gly Thr

85 90 95

Pro Val Ile Lys Pro Tyr Gln Leu Thr Arg Arg Pro Arg Arg Asn Arg

100 105 110

Lys Ser Pro Ala Leu Arg Ala Ser Phe Gln Glu Thr Ser Ile Ser Pro

115 120 125

Ala Asn Phe Val Tyr Pro Leu Phe Ile His Glu Gly Gln Glu Asp Thr

130 135 140

Pro Ile Gly Ala Met Pro Gly Cys Tyr Arg Leu Gly Trp Arg His Gly

145 150 155 160

Leu Val Glu Glu Val Ala Lys Ala Arg Asp Val Gly Val Asn Ser Ile

165 170 175

Val Leu Phe Pro Lys Val Pro Asp Ala Leu Lys Ser Pro Thr Gly Asp

180 185 190

Glu Ala Tyr Asn Asp Asn Gly Leu Val Pro Arg Thr Ile Arg Leu Leu

195 200 205

Lys Asp Lys Phe Pro Asp Leu Val Ile Tyr Thr Asp Val Ala Leu Asp

210 215 220

Pro Tyr Ser Ser Asp Gly His Asp Gly Ile Val Arg Glu Asp Gly Val

225 230 235 240

Ile Met Asn Asp Glu Thr Val His Gln Leu Cys Lys Gln Ala Val Ser

245 250 255

Gln Ala Arg Ala Gly Ala Asp Val Val Ser Pro Ser Asp Met Met Asp

260 265 270

Gly Arg Val Gly Ala Ile Arg Ala Ala Leu Asp Ser Glu Gly Phe His

275 280 285

His Val Ser Ile Met Ser Tyr Thr Ala Lys Tyr Ala Ser Ser Phe Tyr

290 295 300

Gly Pro Phe Arg Glu Ala Leu Asp Ser Asn Pro Arg Phe Gly Asp Lys

305 310 315320

Lys Thr Tyr Gln Met Asn Pro Ala Asn Tyr Arg Glu Ala Leu Val Glu

325 330 335

Ala His Glu Asp Glu Ala Glu Gly Ala Asp Ile Leu Leu Val Lys Pro

340 345 350

Gly Leu Pro Tyr Leu Asp Ile Ile Arg Leu Leu Arg Asp Gln Ser Pro

355 360 365

Leu Pro Ile Ala Ala Tyr Gln Val Ser Gly Glu Tyr Ser Met Ile Lys

370 375 380

Ala Gly Gly Val Leu Lys Met Ile Asp Glu Glu Arg Val Met Met Glu

385 390 395 400

Ser Leu Met Cys Leu Arg Arg Ala Gly Ala Asp Ile Ile Leu Thr Tyr

405 410 415

Phe Ala Leu Gln Ala Ala Arg Ser Leu Cys Gly Glu Lys Arg

420 425 430

Claims

1. As shown in SEQ ID NO.1 and SEQ ID number 2GhLMMThe application of the gene in improving the verticillium wilt resistance of cotton and cultivating new cotton germplasm is characterized in that the gene is shown as SEQ ID NO.1GhLMMThe gene expression is normal and is shown as SEQ ID NO.2GhLMMThe gene expression is deleted.

2. Use according to claim 1, characterized in that: by usingGhLMMThe functional deletion mutant of the gene and a cotton variety which is planted conventionally are hybridized to prepare a hybrid to improve the verticillium wilt resistance of cotton, wherein the mutant is shown as SEQ ID NO.1GhLMMThe gene expression is normal and is shown as SEQ ID NO2 is shown inGhLMMThe gene expression is deleted.

3. A method for improving verticillium wilt resistance of cotton is characterized by comprising the following steps: the nucleotide sequence regulated in cotton is shown as SEQ ID No.1 and SEQ ID number 2GhLMMThe expression dose of the gene is shown as SEQ ID NO.1GhLMMThe gene expression is normal and is shown as SEQ ID number 2GhLMMThe gene expression is deleted.