CN113444739A

CN113444739A - Construction of broad-host plasmid for inducible expression of green fluorescent protein and application of broad-host plasmid in fluorescent tracing

Info

Publication number: CN113444739A
Application number: CN202110682180.6A
Authority: CN
Inventors: 田明星; 于圣青; 李子晨; 王少辉; 尹伊; 胡海; 丁铲; 李涛; 祁晶晶
Original assignee: Shanghai Veteromaru Research Institute Caas China Animal Health And Epidemiology Center Shanghan Branch Center
Current assignee: Shanghai Veteromaru Research Institute Caas China Animal Health And Epidemiology Center Shanghan Branch Center; Shanghai Veterinary Research Institute CAAS
Priority date: 2021-06-20
Filing date: 2021-06-20
Publication date: 2021-09-28

Abstract

The invention discloses construction of broad-host plasmid for inducible expression of green fluorescent protein and application of the broad-host plasmid in fluorescent tracing. The pBT-iEGFP plasmid is constructed based on a wide-host plasmid pBBR1MCS framework and comprises a tetracycline repressor protein TetR, a tetracycline promoter Pzt-1 and an enhanced green fluorescent protein EGFP sequence. Has broad host range and can replicate in at least Escherichia coli, Salmonella and Brucella, but not limited to them. The bacteria containing the plasmid can induce host bacteria to emit green fluorescence under the induction condition of anhydrous tetracycline with specific concentration. Has the advantages of universality, controllable expression, specific tracing viable bacteria, strong fluorescence and the like of various bacteria. The plasmid can be used for fluorescence labeling of various bacteria, bacteria morphology observation, fluorescence dynamic tracing and other technologies.

Description

Construction of broad-host plasmid for inducible expression of green fluorescent protein and application of broad-host plasmid in fluorescent tracing

Technical Field

The invention belongs to the field of genetic engineering, and particularly relates to a construction method of a wide-host plasmid pBT-iEGFP capable of inducing expression of enhanced green fluorescent protein. The plasmid is constructed based on a broad-host plasmid, can be used for various bacteria, and not only can be used for fluorescent tracing of escherichia coli, salmonella and brucella.

Background

Fluorescent protein is often used to mark and trace specific protein, virus or bacteria photoprotein, and compared with fluorescent antibody marking, it has the characteristics of low cost, convenient operation, high fluorescence intensity and low background value. At present, many proteins are used for fluorescent labeling in the market, such as green fluorescent protein GFP, red fluorescent proteins mCherry and DsRed, blue fluorescent protein BFP, yellow fluorescent protein YFP and the like. The enhanced green fluorescent protein EGFP is used in the invention, and the fluorescence intensity is stronger, thereby being more beneficial to observation.

The engineering bacteria of Escherichia coli, such as DH5 alpha, is a commonly used tool strain for expressing foreign proteins or performing genetic engineering operation, facilitates the genetic operation by using a chemical transformation method, and also facilitates the evaluation of the expression condition of target genes. Avian pathogenic escherichia coli is an important bacterial pathogen for infecting poultry, and is caused by a plurality of serological pathogenic escherichia coli infections, and clinical symptoms comprise air sacculitis, perihepatitis, pericarditis and the like. Salmonella typhimurium is an important pathogenic bacterium of zoonosis, mainly causes food poisoning, and has high fatality rate in infants. Brucella is also an important zoonosis bacterial pathogen, which infects pregnant animals to cause abortion, and infects people to cause wave heat, and has great influence on public health and animal husbandry development.

The fluorescence labeling of bacteria is an important common experimental labeling technology, and is used for researching the physiological and biochemical characteristics of bacteria, host in-vivo tracing, bacterial infected cell tracing, pathogenic mechanism research and the like. Bacteria of different species, such as escherichia coli, salmonella, brucella and the like, are generally constructed with own special fluorescence labeling plasmids, and although the fluorescence labeling plasmids have obvious fluorescence activity when being used independently, because of the replication characteristics of the plasmids, the types of promoters are different, different types of plasmids are needed by different bacteria, and the same plasmid cannot be commonly used among bacteria of different species, such as the plasmid capable of expressing fluorescence in the escherichia coli, but cannot be used in the brucella, even can be degraded, and the plasmid capable of expressing fluorescence in the brucella cannot be compatible in the escherichia coli and the salmonella. In addition, most of fluorescent plasmids for escherichia coli, salmonella and brucella on the market are persistently expressed fluorescent plasmids, and in the infection process, no matter dead bacteria or live bacteria can emit fluorescence, so that the infected bacteria can not be effectively distinguished as live bacteria or dead bacteria. Therefore, a plasmid universal for various bacteria is constructed, the fluorescent protein can be controllably expressed, and the method can be used for tracing the live bacteria in infection and has very important significance.

Disclosure of Invention

In view of the above-mentioned technical drawbacks of the prior art, the present invention provides a technical contribution,

the invention firstly provides a pBT-iEGFP plasmid vector which is characterized by having a nucleotide sequence shown in SEQ ID NO.1

Furthermore, the invention provides a preparation method of a fluorescent tracer plasmid, which uses a broad-host plasmid pBBR1MCS (Kovach ME, Phillips RW, Elzer PH, Roop RM, 2nd, Peterson KM. pBBR1MCS: a hybrid-host-range cloning vector, BioTechniques, 1994; 16: 800-.

Further, the specific construction method is as follows: 1) PCR amplification is carried out on a green fluorescent protein induced expression fragment TetR-Pzt-1-iEGFP by taking pZT-EGFP as a template and iEGFP-F and iEGFP-R as primers; 2) carrying out double digestion on the pBBR1MCS plasmid by restriction enzymes KpnI and XbaI, and recovering a linear pBBR1MCS fragment by a Tiangen DNA gel recovery kit after agarose gel electrophoresis; 3) the seamless cloning kit is connected with a TetR-Pzt-1-iEGFP fragment and a pBBR1MCS linearized plasmid, a product is transformed into escherichia coli DH5 alpha, positive clones are identified by PCR, and the plasmid with correct determination is named as a pBT-iEGFP plasmid.

Further, the invention provides a primer used in the construction method, and the specific sequence of the primer is as follows:

iEGFP-F: AGGGAACAAAAGCTGGGTACCCCGTTTCCATTTAGGTGGGTA（SEQ ID NO.2）

iEGFP-R: CGCGGTGGCGGCCGCTCGATCGATTATTTATTTCCTG（SEQ ID NO.3）

further, the invention provides an application of the fluorescent tracing plasmid, wherein the pBT-iEGFP plasmid can be transformed into escherichia coli engineering bacteria or avian pathogenic escherichia coli in a chemical transformation or electric transformation mode, and is induced by anhydrous tetracycline, smeared, observed by a fluorescent microscope for bacterial fluorescence, and used for in vitro fluorescent tracing of escherichia coli.

Further, the application specifically comprises: 1) the chemical transformation method of the escherichia coli engineering bacteria DH5 alpha comprises the following steps: 100 mu L of escherichia coli competent cells are taken, ice water mixture is slowly melted, 20 ng of pBT-iEGFP plasmid is added, after uniform mixing, ice bath is carried out for 30 min, heat shock is carried out for 90 s at 42 ℃, ice bath is carried out for 2 min, 1 mL of LB solution is added, shake culture is carried out for 45 min at 37 ℃, chloramphenicol LB plate is coated to screen positive clones, the positive clone strains are inoculated into the chloramphenicol LB solution, 0 ng/mL, 10 ng/mL, 25 ng/mL, 50 ng/mL and 100 ng/mL of anhydrous tetracycline are respectively added to induce for 12h, 500 mu L of culture solution is taken, PBS is washed twice, sterile water is used for suspension, 5-10 mu L of suspension is taken to coat a glass slide, an alcohol lamp is used for drying, and fluorescence of bacteria is observed through a fluorescence microscope. 2) The avian pathogenic escherichia coli AH50 electrotransformation method comprises the following steps: LB culture of avian pathogenic escherichia coli AH50 to logarithmic growth prophase (OD600= 0.4-0.6), ice bath for 10 min, washing thalli twice with sterile precooled water, precooled 10% glycerol sterile water suspending cells, subpackaging 100 muL per tube, adding 1 mug pBT-iEGFP plasmid, ice bath for 10 min, adding the mixture into a 1 mm electrotransformation cup, electrotransforming the plasmid into avian pathogenic escherichia coli AH50 under the condition of 1.8 kV 200 omega, coating chloramphenicol LB plate to screen positive clones, inoculating the positive clone strains into chloramphenicol LB solution, respectively adding 0 ng/mL, 5 ng/mL, 10 ng/mL, 25 ng/mL, 50 ng/mL and 100 ng/mL anhydrous tetracycline to induce 12h, taking 100 muL culture bacteria liquid, washing twice with PBS, suspending with sterile water, taking 5-10 muL suspension to coat glass slides with 5-10 muL suspension, drying by an alcohol lamp, and observing the fluorescence of the bacteria by a fluorescence microscope.

Further, the invention provides an application of the pBT-iEGFP plasmid in fluorescent tracing of salmonella typhimurium, which comprises the following steps: can be transformed into salmonella typhimurium in an electric transformation mode, induced by anhydrous tetracycline, smeared, observed by a fluorescence microscope for bacterial fluorescence, and traced by in vitro fluorescence.

Further, the application specifically operates as follows: culturing a standard strain SL1344 LB of Salmonella typhimurium to the early logarithmic growth stage (OD600= 0.4-0.6), carrying out ice bath for 10 min, washing the strain twice with sterile precooled water, carrying out precooled 10% glycerol sterile water suspension on cells, subpackaging 100 muL of each tube, adding 1 mug of pBT-iEGFP plasmid, carrying out ice bath for 10 min, adding the mixture into a 1 mm electrotransformation cup, carrying out electrotransformation on the plasmid into SL1344 under the condition of 1.8 kV 200 omega, coating a chloramphenicol LB plate to screen positive clones, inoculating the positive clone strains into a chloramphenicol LB solution, respectively adding 0 ng/mL, 5 ng/mL, 10 ng/mL, 25 ng/mL, 50 ng/mL and 100 ng/mL anhydrous tetracycline to induce for 12h, taking 500 muL of PBS to culture the strain, washing twice, carrying out sterile water suspension, taking 5-10 muL of suspension, coating a glass slide, drying by an alcohol lamp, and observing the fluorescence of the bacteria by a fluorescence microscope.

Further, the invention provides an application of the pBT-iEGFP plasmid in tracing brucella melitensis, wherein the application comprises the steps of inducing by anhydrous tetracycline, inactivating a smear, observing bacterial fluorescence by a fluorescence microscope, and tracing brucella melitensis in vitro by fluorescence.

Further, the application specifically operates as follows: inoculating a brucella abortus vaccine strain M5 into a TSB, culturing to logarithmic growth prophase (OD600= 0.6-0.8), carrying out ice bath for 10 min, washing the strain twice with sterile precooled water, subpackaging 100 mu L of precooled 10% glycerol sterile water suspension cells in each tube, adding 1 mu g of pBT-iEGFP plasmid, carrying out ice bath for 10 min, adding the mixture into a 1 mm electrotransformation cup, carrying out electrotransformation on the plasmid into M5 under the condition of 2.4 kV 400 omega, coating a chloramphenicol LB flat plate to screen positive clones, inoculating the positive clone strain into a chloramphenicol TSB solution, respectively adding 0 ng/mL, 5 ng/mL, 10 ng/mL, 25 ng/mL, 50/mL and 100 ng/mL anhydrous tetracycline to induce 24 h, adding a 0.3% formalin solution to inactivate 24 h, taking 100 mu L of bacterial solution, washing twice with PBS, suspending in sterile water, taking 5-10 muL of turbid liquid to coat a glass slide, drying by an alcohol lamp, and observing bacterial fluorescence by a fluorescence microscope.

Further, the pBT-iEGFP plasmid provided by the invention can be used for tracing live brucella melitensis in the cell infection process, after brucella melitensis infects cells, the live brucella melitensis is induced to generate green fluorescence through anhydrous tetracycline, and the plasmid can be used for distinguishing live bacteria and dead bacteria of the infected cells through red fluorescent antibody tracing.

Further, the application specifically operates as follows: TSB culture the above-constructed Brucella melitensis M5(pBT-iEGFP) containing pBT-iEGFP plasmid to logarithmic growth phase, determine OD600 value, and adjust bacterial concentration; furthermore, RAW264.7 cells were cultured to monolayers in 24-well cell culture plates pre-loaded with slides, according to bacterial: the cells are 1: 200, infecting for 1 h at 37 ℃, adding 100 ng/mL anhydrous tetracycline into cells for inducing for 6 h after infection, activating live bacteria to express EGFP, then fixing a slide by 4% formaldehyde solution, washing by PBS for 2 times, washing by 0.05% Tween20-PBS (PBST) solution for 3 times, permeabilizing cells by 0.5% Triton X-100-PBS at room temperature for 15 min, washing by PBST for 3 times, washing by 5% blocking the slide for 1 h, washing by PBST for 3 times, diluting by 1: 500 times by 0.5% BSA-PBS solution, adding mouse anti-Brucella antibody, incubating for 1 h at 37 ℃, washing by PBST for 3 times, diluting by 1: 1000 times by 0.5% PBS solution, adding Alexa Flur 555-labeled goat anti-mouse IgG secondary antibody, washing by PBST for 3 times, washing by sterile deionized water for 1 time, drying the slide, adding 1 drop of the encapsulated tablet, reversely buckling on a glass slide, and observing the fluorescence of the Brucella intracellularis by a fluorescence microscope. The live brucella intracellulare shows green fluorescence, and is marked by the antibody to emit red fluorescence; the intracellular dead brucella did not show green fluorescence, but was only labeled red fluorescence by the antibody.

Furthermore, because the pBT-iEGPF plasmid is constructed based on a broad-host plasmid, the plasmid can be replicated in a plurality of different bacteria simultaneously, and can be applied to the bacteria supporting the replication of the pBBR1MCS plasmid in principle, and under the induction of anhydrous tetracycline, the live bacteria can emit green fluorescence, the dead bacteria can not emit fluorescence, and the plasmid can be used for tracing the live bacteria in various scientific research activities, such as observing the biofilm formation capacity of the live bacteria and eliminating the interference of the dead bacteria; the method is used for tracing the intracellular transportation and migration conditions of live bacteria in an infected state and eliminating observation artifacts caused by dead bacteria; meanwhile, the method can be used for cell infection analysis of various bacteria, determination of intracellular replication capacity of the bacteria, evaluation of pathogenic characteristics of the bacteria and other scientific research activities.

Advantageous effects

The shuttle plasmid of inducible expression enhanced green fluorescent protein is constructed based on a wide-host plasmid pBBR1MCS framework and a universal promoter Pzt1, can replicate and express the green fluorescent protein in different species of bacteria, is suitable for escherichia coli, salmonella, brucella and other common bacteria, can controllably express the green fluorescent protein under the induction of tetracycline anhydrous, and can successfully trace live bacteria in an infection process. Therefore, the plasmid constructed by the invention has the following advantages: 1) the universal convenience is realized, and various bacteria can be suitable; 2) controllable expression, the fluorescent protein is expressed under the induction condition of adding anhydrous tetracycline; 3) tracing live bacteria, activating the live bacteria to express green fluorescent protein by using anhydrous tetracycline after bacteria infect cells, and eliminating the interference of dead bacteria. 4) The fluorescent protein has strong fluorescent activity, and the essence granule uses the enhanced green fluorescent protein gene, can emit stronger green fluorescence than GFP, and is more beneficial to observation. In conclusion, the plasmid constructed by the invention provides convenience for the fluorescent tracing research of bacteria.

Drawings

FIG. 1 pBT-iEGFP plasmid map

FIG. 2 shows that pBT-iEGFP plasmid is induced and expressed in Escherichia coli engineering bacteria DH5 alpha

FIG. 3 growth curves of avian pathogenic E.coli AH50(pBT-iEGFP) at different anhydrotetracycline concentrations

FIG. 4 genetic stability analysis of pBT-iEGFP plasmid in avian pathogenic E.coli AH50, wherein 1-5 are the first, second, third, fourth and fifth generations of bacterial non-resistance culture.

FIG. 5 expression is induced in the avian pathogenic E.coli AH50 by the pBT-iEGFP plasmid.

FIG. 6 growth curves of Salmonella typhimurium SL1344(pBT-iEGFP) at different anhydrotetracycline concentrations

FIG. 7 genetic stability analysis of the pBT-iEGFP plasmid in Salmonella typhimurium SL1344, wherein 1 to 5 are the first, second, third, fourth and fifth generations of non-resistant bacterial cultures, respectively.

FIG. 8 expression of the pBT-iEGFP plasmid was induced in Salmonella typhimurium SL 1344.

FIG. 9 shows growth curves of Brucella melitensis M5(pBT-iEGFP) at different concentrations of anhydrotetracycline.

FIG. 10 genetic stability analysis of the pBT-iEGFP plasmid in Brucella melitensis M5, wherein 1-5 are the first, second, third, fourth and fifth generations of non-resistant culture of the bacteria, respectively.

FIG. 11 expression of pBT-iEGFP plasmid was induced in Brucella melitensis M5.

FIG. 12 the pBT-iEGFP plasmid tracks intracellular replication of viable Brucella. Wherein, the bacteria which can emit green fluorescence and red fluorescence marked by the antibody are live bacteria; the bacteria which are labeled by the antibody and can emit red fluorescence and green fluorescence are dead bacteria, as shown by the arrow.

Detailed Description

The invention is further illustrated below with reference to specific examples. These examples are intended to illustrate the invention and are not intended to limit the scope of the invention. The experimental procedures, in which specific conditions are not noted in the following examples, are generally carried out according to conventional conditions or according to conditions recommended by the manufacturers. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art.

The reagents and raw materials which are not labeled in the invention are all purchased from the market.

The sequence of the pBT-iEGFP plasmid constructed in the invention is detailed in a sequence table.

Example 1 construction of pBT-iEGFP plasmid

An inducible plasmid pZT-EGFP plasmid (Tian M, Qu J, Bao Y, Gao J, Liu J, Wang S, Sun Y, Ding C, Yu S. Construction of pTM series plasmids for gene expression in the early stage of a laboratoryBrucellaJ Microbiol Methods, 2016; 123: 18-23.) as a template, iEGFP-F and iEGFP-R as primers, as follows:

iEGFP-F: AGGGAACAAAAGCTGGGTACCCCGTTTCCATTTAGGTGGGTA（SEQ ID NO.2）

iEGFP-R: CGCGGTGGCGGCCGCTCGATCGATTATTTATTTCCTG（SEQ ID NO.3）

PCR amplification of a gene fragment TetR-Pzt-1-iEGFP, which can induce expression of green fluorescent protein, using the fidelity enzyme PrimeSTAR Max DNA Polymerase (Dalianbao Bio Inc.), wherein the PCR reaction system is 50 muL and comprises: 25 muL of PrimeSTAR Max Premix (2 x), 2 muL of each of the upstream primer and the downstream primer, 2 muL of pZT-EGFP (5 mug/muL), and supplementing sterile water to 50 muL; the PCR reaction program is: 30 cycles of 98 ℃ for 10 s, 55 ℃ for 15 s and 72 ℃ for 30 s. The size of the product is 1908 bp, after electrophoresis of 1% agarose gel, DNA fragments are recovered by a Tiangen DNA agarose gel recovery kit, and the DNA fragments are reserved at 4 ℃.

1. The broad-host plasmid pBBR1MCS is subjected to double digestion by restriction enzymes Kpn I and Xba I, and the digestion system is as follows: 2 mug of pBBR1MCS plasmid, 2 mug of Kpn I and 2 mug of Xba I respectively, 4 mug of 10 xM Buffer, adding water to complement to 40 mug; the enzyme is cut for 2h at 37 ℃, after 1 percent agarose gel electrophoresis, the linearized pBBR1MCS fragment is recovered by a Tiangen DNA agarose gel recovery kit, and is reserved at 4 ℃.

2. The TetR-Pzt-1-iEGFP and pBBR1MCS linearized fragments recovered from the gel were recombined and seamlessly ligated using the Novozan Clon express II One Step Cloning Kit, and the reaction system was as follows: linearizing 1 muL of pBBR1MCS plasmid, 1 muL of iEGFP fragment, 4 muL of 5 XCE II Buffer and 4 muL of Exnase II 2 muL, and adding sterile water to complement 20 muL; after gentle mixing, the mixture reacts at 37 ℃ for 30 min, the mixture is immediately placed on ice for cooling, 10 mu L of recombinant product is taken and transformed into escherichia coli DH5 alpha, a chloramphenicol LB plate is coated, a single clone is selected, a positive colony is identified by PCR, a plasmid with correct sequencing is named pBT-iEGFP, the plasmid map is shown in figure 1, and the full-length sequence is shown in SEQ ID No. 1.

Example 2 inducible expression of the Green fluorescent protein by the pBT-iEGFP plasmid in E.coli

The pBT-iEGFP plasmid is induced to express the green fluorescent protein in Escherichia coli engineering bacteria DH5a

Taking 100 mu L of escherichia coli competent cells (Beijing Tiangen organisms), slowly melting the escherichia coli competent cells on an ice-water mixture, adding 20 ng of pBT-iEGFP plasmid, uniformly mixing, carrying out ice bath for 30 min, carrying out heat shock for 90 s at 42 ℃, carrying out ice bath for 2 min, adding 1 mL of LB solution, carrying out shake culture at 37 ℃ for 45 min, coating a chloramphenicol LB plate to screen positive clones, carrying out PCR (polymerase chain reaction) identification on positive colonies, and naming the positive bacteria as DH5 alpha (pBT-iEGFP); the method comprises the steps of inoculating DH5 alpha (pBT-iEGFP) into a chloramphenicol LB solution, respectively adding 0 ng/mL, 10 ng/mL, 25 ng/mL, 50 ng/mL and 100 ng/mL of anhydrous tetracycline to perform induced expression for 12 hours, taking 500 mu L of culture bacterial liquid, washing twice with PBS, performing sterile water suspension, taking 5-10 mu L of suspension to coat a glass slide, drying with an alcohol lamp, and observing bacterial fluorescence with a fluorescence microscope. As shown in FIG. 2, DH5 alpha (pBT-iEGFP) showed no green fluorescence under the condition of 0 ng/mL anhydrous tetracycline; when the concentration of the anhydrous tetracycline reaches 10 ng/mL, DH5 alpha (pBT-iEGFP) presents obvious green fluorescence; when the concentration of the anhydrous tetracycline reaches 25 ng/mL, DH5 alpha (pBT-iEGFP) presents stronger fluorescence; DH5 alpha (pBT-iEGFP) exhibited strong fluorescence when the concentrations reached 50 ng/mL and 100 ng/mL. The example shows that the pBT-iEGFP plasmid can successfully induce and express the green fluorescent protein in the escherichia coli engineering bacteria DH5a, and the green fluorescent expression is obviously enhanced along with the increase of the concentration of the anhydrous tetracycline.

1. Genetic stability of pBT-iEGFP plasmid in avian pathogenic escherichia coli AH50, sensitivity of recombinant bacteria to anhydrotetracycline and inducible expression of green fluorescent protein

2.1 recombinant Strain construction: inoculating the avian pathogenic escherichia coli AH50 into an LB liquid culture medium, culturing to the early logarithmic growth stage (OD600= 0.4-0.6), carrying out ice bath for 10 min, washing thalli twice with sterile precooled water, subpackaging 100 mu L of precooled 10% glycerol sterile water suspension cells in each tube, adding 1 mu g of pBT-iEGFP plasmid, carrying out ice bath for 10 min, adding the mixture into a 1 mm electrotransformation cup, carrying out electrotransformation on the plasmid into avian pathogenic escherichia coli AH50 under the condition of 1.8 kV 200 omega, coating a chloramphenicol LB plate to screen positive clones, carrying out PCR (polymerase chain reaction) identification on the positive clones, and identifying the positive strain to be named as AH50 (pBT-iEGFP).

2.2 sensitivity of recombinant bacteria to anhydrotetracycline: AH50(pBT-iEGFP) is inoculated in LB liquid culture medium, the culture is carried out for 12h, the OD600 value of bacteria is measured, the OD600 value is adjusted to 1.0, the LB liquid culture medium is inoculated in 3 mL according to the proportion of 1:10, the OD600 values of the bacteria are respectively added into the culture medium, the concentration of anhydrous tetracycline is 0 ng/mL, 5 ng/mL, 10 ng/mL, 25 ng/mL, 50 ng/mL and 100 ng/mL, the inhibition effect of the anhydrous tetracycline on recombinant bacteria AH50(pBT-iEGFP) is observed at intervals of 1 h. The result is shown in figure 3, and the addition of different concentrations of anhydrotetracycline has no obvious inhibition effect on AH50(pBT-iEGFP), which indicates that anhydrotetracycline has no bactericidal activity on AH50(pBT-iEGFP) at the concentration of 5-100 ng/mL, and is suitable for being used as an inducer for expressing green fluorescent protein of AH50 (pBT-iEGFP).

2.3 plasmid genetic stability assay: to investigate the stability of pBT-iefp in avian pathogenic escherichia coli AH50, AH50 (pBT-iefp) was inoculated in antibiotic-free LB liquid medium for 5 passages blind, each passage was diluted 10-fold with PBS, LB plates and chloramphenicol LB plates were coated, respectively, incubated overnight at 37 ℃, chloramphenicol-resistant LB plates and non-resistant LB plates, respectively, the percentage of recombinant AH50 (pBT-iefp) = chloramphenicol-resistant plate CFU/non-resistant plate CFU × 100%, and the stability of pBT-iefp in AH50 during five passages blind was compared. As shown in FIG. 4, the percentage of AH50(pBT-iEGFP) was above 90% during the five-generation blind passage, indicating that pBT-iEGFP is very stable in AH 50.

2.4 the recombinant bacterium expresses green fluorescent protein: AH50(pBT-iEGFP) is inoculated into chloramphenicol LB solution, 0 ng/mL, 5 ng/mL, 10 ng/mL, 25 ng/mL, 50 ng/mL and 100 ng/mL of anhydrous tetracycline are respectively added for induction for 12h, 500 mu L of culture solution is taken, PBS is used for washing bacteria twice, sterile water is used for suspension, 5-10 mu L of suspension is taken and coated on a glass slide, an alcohol lamp is used for drying, and fluorescence of the bacteria is observed through a fluorescence microscope. The results are shown in FIG. 5, in the condition of 0 ng/mL anhydrous tetracycline, AH50(pBT-iEGFP) showed no green fluorescence; when the concentration of the anhydrous tetracycline reaches 5 ng/mL, AH50(pBT-iEGFP) presents weak green fluorescence; when the anhydrous tetracycline concentration reaches 10 ng/mL, AH50(pBT-iEGFP) shows obvious green fluorescence; when the concentration of the anhydrous tetracycline reaches 25 ng/mL, AH50(pBT-iEGFP) presents stronger fluorescence; AH50(pBT-iEGFP) exhibited strong fluorescence when concentrations reached 50 ng/mL and 100 ng/mL. The example shows that the pBT-iEGFP plasmid can successfully induce and express the green fluorescent protein in the avian pathogenic escherichia coli worker AH50, and the green fluorescent expression is obviously enhanced along with the increase of the concentration of the anhydrous tetracycline.

Example 3 inducible expression of the Green fluorescent protein by the pBT-iEGFP plasmid in Salmonella typhimurium

1. Construction of recombinant bacteria: inoculating salmonella typhimurium SL1344 into an LB liquid culture medium, culturing to early logarithmic growth (OD600= 0.4-0.6), carrying out ice bath for 10 min, washing the thalli twice with sterile precooled water, subpackaging each tube with 100 mu L of precooled 10% glycerol sterile water suspension cells, adding 1 mu g of pBT-iEGFP plasmid, carrying out ice bath for 10 min, adding the mixture into a 1 mm electrotransformation cup, carrying out electrotransformation on the plasmid into salmonella typhimurium SL1344 under the condition of 1.8 kV 200 omega, coating a chloramphenicol LB plate to screen positive clones, carrying out PCR (polymerase chain reaction) identification on the positive clones, and identifying the positive strains to be named as SL1344 (pBT-iEGFP).

2. The recombinant bacteria are sensitive to anhydrous tetracycline: SL1344(pBT-iEGFP) is inoculated in LB liquid culture medium, the culture is carried out for 12h, the OD600 value of bacteria is measured, the OD600 value is adjusted to 1.0, the LB liquid culture medium is inoculated into 3 mL according to the proportion of 1:10, anhydrous tetracycline with the concentration of 0 ng/mL, 5 ng/mL, 10 ng/mL, 25 ng/mL, 50 ng/mL and 100 ng/mL is respectively added into the culture medium, the OD600 value of the bacteria is measured at intervals of 1 h, and the inhibition effect of the anhydrous tetracycline on the SL1344(pBT-iEGFP) is observed. The result is shown in FIG. 6, the addition of different concentrations of anhydrotetracycline has no obvious inhibition effect on SL1344(pBT-iEGFP), which indicates that anhydrotetracycline has no bactericidal activity on SL1344(pBT-iEGFP) at a concentration of 5-100 ng/mL, and is suitable for serving as an inducer for SL1344(pBT-iEGFP) to express green fluorescent protein.

3. Determination of genetic stability of plasmids: to investigate the stability of pBT-iefp in salmonella typhimurium SL1344, SL1344 (pBT-iefp) was inoculated in antibiotic-free LB liquid medium for 5 passages blind, bacteria of each passage were diluted 10-fold with PBS, LB plates and chloramphenicol LB plates were coated, respectively, incubated overnight at 37 ℃, chloramphenicol-resistant LB plates and non-resistant LB plates bacteria CFU were counted, respectively, the percentage of SL1344 (pBT-iefp) recombinant bacteria = chloramphenicol-resistant plate CFU/non-resistant plate CFU × 100%, and the stability of pBT-iefp in SL1344 during five passages blind was compared. The results are shown in FIG. 7, where the percentage of SL1344(pBT-iEGFP) was higher than 92% during the five blind passages, indicating that pBT-iEGFP is very stable in SL 1344.

4. The recombinant bacterium expresses green fluorescent protein: the method comprises the steps of inoculating chloramphenicol LB solution into SL1344(pBT-iEGFP), adding 0 ng/mL, 5 ng/mL, 10 ng/mL, 25 ng/mL, 50 ng/mL and 100 ng/mL of anhydrous tetracycline respectively, inducing for 12 hours, taking 500 mu L of culture bacterial liquid, washing twice with PBS, suspending in sterile water, taking 5-10 mu L of suspension, coating a glass slide with the suspension, drying with an alcohol lamp, and observing bacterial fluorescence with a fluorescence microscope. The results are shown in FIG. 8, and SL1344(pBT-iEGFP) shows no green fluorescence under the condition of 0 ng/mL anhydrous tetracycline; when the concentration of the anhydrous tetracycline reaches 5 ng/mL, SL1344(pBT-iEGFP) presents weak green fluorescence; SL1344(pBT-iEGFP) exhibits apparent green fluorescence when the concentration of anhydrotetracycline reaches 10 and 25 ng/mL; SL1344(pBT-iEGFP) shows stronger fluorescence when the concentration of the anhydrous tetracycline reaches 50 ng/mL; SL1344(pBT-iEGFP) exhibits strong fluorescence when the concentration reaches 100 ng/mL. The example shows that the pBT-iEGFP plasmid can successfully induce and express the green fluorescent protein in the salmonella typhimurium SL1344, and the green fluorescent expression is obviously enhanced along with the increase of the concentration of the anhydrous tetracycline.

Example 4 inducible expression of Green fluorescent protein by pBT-iEGFP plasmid in Brucella melitensis

1. Construction of recombinant bacteria: inoculating brucella melitensis M5 into a TSB liquid culture medium, culturing to the early logarithmic growth stage (OD600= 0.6-0.8), carrying out ice bath for 10 min, washing the thallus twice with sterile precooled water, subpackaging each tube with 100 mu L of precooled 10% glycerol sterile water suspension cells, adding 1 mu g of pBT-iEGFP plasmid, carrying out ice bath for 10 min, adding the mixture into a 1 mm electrotransformation cup, carrying out electrotransformation on the plasmid into M5 under the condition of 2.4 kV 400 omega, coating a chloramphenicol TSB plate to screen positive clones, carrying out PCR (polymerase chain reaction) identification on the positive clones, and identifying the positive strains to be named as M5 (pBT-iEGFP).

2. The recombinant bacteria are sensitive to anhydrous tetracycline: m5(pBT-iEGFP) is inoculated in a TSB liquid culture medium, the culture is carried out for 24 h, the OD600 value of bacteria is measured, the OD600 value is adjusted to 1.0, the bacteria is inoculated in 3 mL LB culture medium according to the proportion of 1:100, the anhydrous tetracycline is respectively added into the culture medium, the concentration is 0 ng/mL, 5 ng/mL, 10 ng/mL, 25 ng/mL, 50 ng/mL and 100 ng/mL, the OD600 value of the bacteria is measured at intervals of 4 h, and the inhibition effect of the anhydrous tetracycline on M5(pBT-iEGFP) is observed. The result is shown in FIG. 9, when the concentration of the anhydrotetracycline is 5-50 ng/mL, no obvious inhibition effect is generated on M5(pBT-iEGFP), and when the concentration is 100 ng/mL, the growth of M5(pBT-iEGFP) is slightly slow, which shows that the anhydrotetracycline has no bactericidal activity on M5(pBT-iEGFP) at the concentration of 5-50 ng/mL, and is suitable for being used as an inducer for expressing green fluorescent protein by M5 (pBT-iEGFP).

5. Determination of genetic stability of plasmids: to investigate the stability of pBT-iefp in brucella melitensis M5, M5 (pBT-iefp) was inoculated in antibiotic-free TSB liquid medium for 5 passages blindly, each passage was diluted 10-fold with PBS, TSB plates and chloramphenicol TSB plates were coated, respectively, incubated overnight at 37 ℃, chloramphenicol-resistant TSB plates and non-resistant TSB plate bacteria CFU were counted, respectively, the percentage of M5 (pBT-iefp) recombinant bacteria = chloramphenicol-resistant plate CFU/non-resistant plate CFU × 100%, and the stability of pBT-iefp in M5 during five passages blindly was compared. As shown in FIG. 10, the percentage of M5(pBT-iEGFP) was higher than 93% during the five-generation blind passage, indicating that pBT-iEGFP is very stable in M5.

3. The recombinant bacterium expresses green fluorescent protein: inoculating chloramphenicol TSB solution with M5(pBT-iEGFP), adding 0 ng/mL, 5 ng/mL, 10 ng/mL, 25 ng/mL, 50 ng/mL and 100 ng/mL of anhydrous tetracycline respectively, inducing for 24 hours, adding 0.3% formalin solution, inactivating for 24 hours, taking 500 mu L of culture solution, washing twice with PBS, suspending with sterile water, taking 5-10 mu L of suspension, coating a glass slide, drying with an alcohol lamp, and observing bacterial fluorescence with a fluorescence microscope. The results are shown in FIG. 11, where 5 ng/mL shows no green fluorescence under 0 ng/mL and 5 ng/mL anhydrous tetracycline conditions; when the concentration of the anhydrous tetracycline reaches 10 ng/mL, M5(pBT-iEGFP) presents very weak green fluorescence; when the concentration of the anhydrous tetracycline reaches 25 ng/mL, M5(pBT-iEGFP) presents obvious green fluorescence; when the concentration of the anhydrous tetracycline reaches 50 ng/mL, M5(pBT-iEGFP) presents stronger fluorescence; when the concentration reached 100 ng/mL, M5(pBT-iEGFP) exhibited strong fluorescence. The example shows that the pBT-iEGFP plasmid can successfully induce and express the green fluorescent protein in the brucella melitensis M5, and the green fluorescent expression is obviously enhanced along with the increase of the concentration of the anhydrous tetracycline.

Example 5 application of pBT-iEGFP plasmid to tracing intracellular infection of Brucella

1. Cell preparation: mouse RAW264.7 cells according to 2.5X 10⁵cells/mL were plated in 24-well cell culture plates preloaded with 14 mm diameter circular slides at 37 ℃ with 5% CO₂The cells are cultured in an incubator overnight until the cells grow into a monolayer ready for use.

2. Cell infection: the M5 (pBT-iefp) strain constructed in example 4 was cultured by TSB to logarithmic growth phase, the bacterial OD600 value was measured, and the bacterial concentration was adjusted in accordance with the bacterial: inoculating Brucella in monolayer cells at a ratio of (200:1), centrifuging the culture plate at 400 Xg for 5 min to uniformly infect the cells with bacteria, and then inoculating with 5% CO at 37 deg.C₂Infection for 1 h under the condition; washing the cells for 3 times by PBS, removing non-adhered bacteria, adding 100 mug/mL gentamicin DMEM to sterilize for 1 h, washing the cells for 3 times by PBS to remove non-invaded bacteria outside the cells, and then adding 20 mug/mL gentamicin and 2% calf serum DMEM to maintain the cells to complete the process of infecting the cells by Brucella.

EGFP inducible expression and slide preparation: m5(pBT-iEGFP) infects RAW264.7 cells for 20 h, adding anhydrous tetracycline with the final concentration of 100 ng/mL into a cell culture solution to induce intracellular brucella to express EGFP, wherein the induction time is 6 h, washing the cells for 3 times by PBS, adding 4% formaldehyde PBS solution into cell slide for fixation, fixing at room temperature for half an hour, and taking out the slide for later use.

4. Indirect immunofluorescence assay: washing the slide by PBS for 2 times, washing the slide by 0.05 percent Tween20-PBS (PBST) solution for 3 times, 5 min each time, permeabilizing the cells by 0.5 percent TritonX-100-PBS at room temperature for 15 min, washing the slide by PBST for 3 times, 5 min each time, sealing the slide by 5 percent BSA for 1 h, washing the slide by PBST for 3 times, 5 min each time, diluting the 0.5 percent BSA-PBS solution by 1: 500 times, adding the mouse anti-brucella antibody, incubating for 1 h at 37 ℃, washing the slide by PBST for 3 times, diluting the 0.5 percent BSA-PBS solution by 1: 1000 times, adding the Alexa Flour555-labeled goat anti-mouse IgG secondary antibody, washing the slide by PBST for 3 times, 5 min each time, washing the slide by sterile deionized water for 1 time, airing the slide, adding 1 drop of the sealed tablet, reversely buckling the slide on a glass slide and observing the fluorescence of the brucella intracellulare.

5. And (3) fluorescence observation: adding a drop of cedar oil to the prepared glass slide, observing the slide by a 1000-magnification positive microscope of Nikon Eclipse 80i, wherein brucella M5(pBT-iEGFP) infected cells emit obvious green fluorescence under the condition of adding anhydrous tetracycline, and under the same condition, through antibody fluorescence staining, all bacteria in cells emit red fluorescence, but the bacteria with partial red fluorescence can not emit green fluorescence under the condition of anhydrous tetracycline induction (as the bacteria indicated by white arrows in figure 12), which shows that only brucella living in cells can successfully express EGFP and emit green fluorescence under the condition of anhydrous tetracycline induction, while the bacteria dying in cells can not successfully induce and express EGFP and emit green fluorescence due to the absence of viable bacteria, and the example proves that pBT-iEGFP plasmid can effectively indicate live bacteria in the infection process, the method can eliminate bacteria dead in cells, can successfully identify whether the infected bacteria are live bacteria or dead bacteria, and has important value of tracing live bacteria.

The above-mentioned embodiments only express the embodiments of the present invention, and the description thereof is more specific and detailed, but not construed as limiting the scope of the present invention. It should be noted that, for a person skilled in the art, several variations and modifications can be made without departing from the inventive concept, which falls within the scope of the present invention. Therefore, the protection scope of the present patent shall be subject to the appended claims.

Sequence listing

<110> Shanghai animal doctor institute of Chinese academy of agricultural sciences (Shanghai center of Chinese centers of animal health and epidemiology)

<120> construction of broad-host plasmid for inducible expression of green fluorescent protein and application of broad-host plasmid in fluorescent tracing

<160> 3

<170> PatentIn version 3.3

<210> 1

<211> 6538

<212> DNA

<213> full-length sequence of pBT-iEGFP plasmid

<400>

ACCTTCGGGAGCGCCTGAAGCCCGTTCTGGACGCCCTGGGGCCGTTGAATCGGGATATGCAGGCCAAGGCCGCCGCGATCATCAAGGCCGTGGGCGAAAAGCTGCTGACGGAACAGCGGGAAGTCCAGCGCCAGAAACAGGCCCAGCGCCAGCAGGAACGCGGGCGCGCACATTTCCCCGAAAAGTGCCACCTGACGTCTAAGAAACCATTATTATCATGACATTAACCTATAAAAATAGGCGTATCACGAGGCCCTTTCGTCTTCGAATAAATACCTGTGACGGAAGATCACTTCGCAGAATAAATAAATCCTGGTGTCCCTGTTGATACCGGGAAGCCCTGGGCCAACTTTTGGCGAAAATGAGACGTTGATCGGCACGTAAGAGGTTCCAACTTTCACCATAATGAAATAAGATCACTACCGGGCGTATTTTTTGAGTTATCGAGATTTTCAGGAGCTAAGGAAGCTAAAATGGAGAAAAAAATCACTGGATATACCACCGTTGATATATCCCAATGGCATCGTAAAGAACATTTTGAGGCATTTCAGTCAGTTGCTCAATGTACCTATAACCAGACCGTTCAGCTGGATATTACGGCCTTTTTAAAGACCGTAAAGAAAAATAAGCACAAGTTTTATCCGGCCTTTATTCACATTCTTGCCCGCCTGATGAATGCTCATCCGGAATTCCGTATGGCAATGAAAGACGGTGAGCTGGTGATATGGGATAGTGTTCACCCTTGTTACACCGTTTTCCATGAGCAAACTGAAACGTTTTCATCGCTCTGGAGTGAATACCACGACGATTTCCGGCAGTTTCTACACATATATTCGCAAGATGTGGCGTGTTACGGTGAAAACCTGGCCTATTTCCCTAAAGGGTTTATTGAGAATATGTTTTTCGTCTCAGCCAATCCCTGGGTGAGTTTCACCAGTTTTGATTTAAACGTGGCCAATATGGACAACTTCTTCGCCCCCGTTTTCACCATGGGCAAATATTATACGCAAGGCGACAAGGTGCTGATGCCGCTGGCGATTCAGGTTCATCATGCCGTTTGTGATGGCTTCCATGTCGGCAGAATGCTTAATGAATTACAACAGTTTTTATGCATGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATGCAGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGAGCGCAACGCAATTAATGTGAGTTAGCTCACTCATTAGGCACCCCAGGCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGAATTGTGAGCGGATAACAATTTCACACAGGAAACAGCTATGACCATGATTACGCCAAGCGCGCAATTAACCCTCACTAAAGGGAACAAAAGCTGGGTACCCCGTTTCCATTTAGGTGGGTACGTTGGAGCCGCATTATTTTCGCTTTATGAATCTAAAGGGTGGTTAACTCGACATCTTGGTTACCGTGAAGTTACCATCACGGAAAAAGGTTATGCTGCTTTTAAGACCCACTTTCACATTTAAGTTGTTTTTCTAATCCGCATATGATCAATTCAAGGCCGAATAAGAAGGCTGGCTCTGCACCTTGGTGATCAAATAATTCGATAGCTTGTCGTAATAATGGCGGCATACTATCAGTAGTAGGTGTTTCCCTTTCTTCTTTAGCGACTTGATGCTCTTGATCTTCCAATACGCAACCTAAAGTAAAATGCCCCACAGCGCTGAGTGCATATAATGCATTCTCTAGTGAAAAACCTTGTTGGCATAAAAAGGCTAATTGATTTTCGAGAGTTTCATACTGTTTTTCTGTAGGCCGTGTACCTAAATGTACTTTTGCTCCATCGCGATGACTTAGTAAAGCACATCTAAAACTTTTAGCGTTATTACGTAAAAAATCTTGCCAGCTTTCCCCTTCTAAAGGGCAAAAGTGAGTATGGTGCCTATCTAACATCTCAATGGCTAAGGCGTCGAGCAAAGCCCGCTTATTTTTTACATGCCAATACAATGTAGGCTGCTCTACACCTAGCTTCTGGGCGAGTTTACGGGTTGTTAAACCTTCGATTCCGACCTCATTAAGCAGCTCTAATGCGCTGTTAATCACTTTACTTTTATCTAATCTAGACATCATTAATTCCTAATTTTTGTTGACACTCTATCGTTGATAGAGTTATTTTACCACTCCCTATCAGTGATAGAGAAAAGTGAAAATCCATATGACTAGTAGATCCTCTAGAGTCGACTAAGAAACCATTATTATCATGACATTAACCTATAAAAATAGGCGTATCACGAGGCCCTTTCGTCTTCACCTCGAGAAATCATAAAAAATTTATTTGCTTCCCTATCAGTGATAGAGTATAATAGAGTCGAATTGTTAGCGGAGAAGAATTTCACACAGAATTCATTAAAGAGGAGAAATTAACTATGCATCACCATCACCATCACGGATCCATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACAAGTAAAAGCTTGTCGACCTGCAGTCTAGATAGGTAATCTCTGCTTAAAAGCACAGAATCTAAGATCCCTGCCATTTGGCGGGGATTTTTTTATTTGTTTTCAGGAAATAAATAATCGATCGAGCGGCCGCCACCGCGGTGGAGCTCCAATTCGCCCTATAGTGAGTCGTATTACGCGCGCTCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTGGCGTTACCCAACTTAATCGCCTTGCAGCACATCCCCCTTTCGCCAGCTGGCGTAATAGCGAAGAGGCCCGCACCGATCGCCCTTCCCAACAGTTGCGCAGCCTGAATGGCGAATGGAAATTGTAAGCGTTAATATTTTGTTAAAATTCGCGTTAAATTTTTGTTAAATCAGCTCATTTTTTAACCAATAGGCCGACTGCGATGAGTGGCAGGGCGGGGCGTAATTTTTTTAAGGCAGTTATTGGTGCCCTTAAACGCCTGGTGCTACGCCTGAATAAGTGATAATAAGCGGATGAATGGCAGAAATTCGAAAGCAAATTCGACCCGGTCGTCGGTTCAGGGCAGGGTCGTTAAATAGCCGCTTATGTCTATTGCTGGTTTACCGGTTTATTGACTACCGGAAGCAGTGTGACCGTGTGCTTCTCAAATGCCTGAGGCCAGTTTGCTCAGGCTCTCCCCGTGGAGGTAATAATTGACGATATGATCATTTATTCTGCCTCCCAGAGCCTGATAAAAACGGTGAATCCGTTAGCGAGGTGCCGCCGGCTTCCATTCAGGTCGAGGTGGCCCGGCTCCATGCACCGCGACGCAACGCGGGGAGGCAGACAAGGTATAGGGCGGCGAGGCGGCTACAGCCGATAGTCTGGAACAGCGCACTTACGGGTTGCTGCGCAACCCAAGTGCTACCGGCGCGGCAGCGTGACCCGTGTCGGCGGCTCCAACGGCTCGCCATCGTCCAGAAAACACGGCTCATCGGGCATCGGCAGGCGCTGCTGCCCGCGCCGTTCCCATTCCTCCGTTTCGGTCAAGGCTGGCAGGTCTGGTTCCATGCCCGGAATGCCGGGCTGGCTGGGCGGCTCCTCGCCGGGGCCGGTCGGTAGTTGCTGCTCGCCCGGATACAGGGTCGGGATGCGGCGCAGGTCGCCATGCCCCAACAGCGATTCGTCCTGGTCGTCGTGATCAACCACCACGGCGGCACTGAACACCGACAGGCGCAACTGGTCGCGGGGCTGGCCCCACGCCACGCGGTCATTGACCACGTAGGCCGACACGGTGCCGGGGCCGTTGAGCTTCACGACGGAGATCCAGCGCTCGGCCACCAAGTCCTTGACTGCGTATTGGACCGTCCGCAAAGAACGTCCGATGAGCTTGGAAAGTGTCTTCTGGCTGACCACCACGGCGTTCTGGTGGCCCATCTGCGCCACGAGGTGATGCAGCAGCATTGCCGCCGTGGGTTTCCTCGCAATAAGCCCGGCCCACGCCTCATGCGCTTTGCGTTCCGTTTGCACCCAGTGACCGGGCTTGTTCTTGGCTTGAATGCCGATTTCTCTGGACTGCGTGGCCATGCTTATCTCCATGCGGTAGGGTGCCGCACGGTTGCGGCACCATGCGCAATCAGCTGCAACTTTTCGGCAGCGCGACAACAATTATGCGTTGCGTAAAAGTGGCAGTCAATTACAGATTTTCTTTAACCTACGCAATGAGCTATTGCGGGGGGTGCCGCAATGAGCTGTTGCGTACCCCCCTTTTTTAAGTTGTTGATTTTTAAGTCTTTCGCATTTCGCCCTATATCTAGTTCTTTGGTGCCCAAAGAAGGGCACCCCTGCGGGGTTCCCCCACGCCTTCGGCGCGGCTCCCCCTCCGGCAAAAAGTGGCCCCTCCGGGGCTTGTTGATCGACTGCGCGGCCTTCGGCCTTGCCCAAGGTGGCGCTGCCCCCTTGGAACCCCCGCACTCGCCGCCGTGAGGCTCGGGGGGCAGGCGGGCGGGCTTCGCCTTCGACTGCCCCCACTCGCATAGGCTTGGGTCGTTCCAGGCGCGTCAAGGCCAAGCCGCTGCGCGGTCGCTGCGCGAGCCTTGACCCGCCTTCCACTTGGTGTCCAACCGGCAAGCGAAGCGCGCAGGCCGCAGGCCGGAGGCTTTTCCCCAGAGAAAATTAAAAAAATTGATGGGGCAAGGCCGCAGGCCGCGCAGTTGGAGCCGGTGGGTATGTGGTCGAAGGCTGGGTAGCCGGTGGGCAATCCCTGTGGTCAAGCTCGTGGGCAGGCGCAGCCTGTCCATCAGCTTGTCCAGCAGGGTTGTCCACGGGCCGAGCGAAGCGAGCCAGCCGGTGGCCGCTCGCGGCCATCGTCCACATATCCACGGGCTGGCAAGGGAGCGCAGCGACCGCGCAGGGCGAAGCCCGGAGAGCAAGCCCGTAGGGCGCCGCAGCCGCCGTAGGCGGTCACGACTTTGCGAAGCAAAGTCTAGTGAGTATACTCAAGCATTGAGTGGCCCGCCGGAGGCACCGCCTTGCGCTGCCCCCGTCGAGCCGGTTGGACACCAAAAGGGAGGGGCAGGCATGGCGGCATACGCGATCATGCGATGCAAGAAGCTGGCGAAAATGGGCAACGTGGCGGCCAGTCTCAAGCACGCCTACCGCGAGCGCGAGACGCCCAACGCTGACGCCAGCAGGACGCCAGAGAACGAGCACTGGGCGGCCAGCAGCACCGATGAAGCGATGGGCCGACTGCGCGAGTTGCTGCCAGAGAAGCGGCGCAAGGACGCTGTGTTGGCGGTCGAGTACGTCATGACGGCCAGCCCGGAATGGTGGAAGTCGGCCAGCCAAGAACAGCAGGCGGCGTTCTTCGAGAAGGCGCACAAGTGGCTGGCGGACAAGTACGGGGCGGATCGCATCGTGACGGCCAGCATCCACCGTGACGAAACCAGCCCGCACATGACCGCGTTCGTGGTGCCGCTGACGCAGGACGGCAGGCTGTCGGCCAAGGAGTTCATCGGCAACAAAGCGCAGATGACCCGCGACCAGACCACGTTTGCGGCCGCTGTGGCCGATCTAGGGCTGCAACGGGGCATCGAGGGCAGCAAGGCACGTCACACGCGCATTCAGGCGTTCTACGAGGCCCTGGAGCGGCCACCAGTGGGCCACGTCACCATCAGCCCGCAAGCGGTCGAGCCACGCGCCTATGCACCGCAGGGATTGGCCGAAAAGCTGGGAATCTCAAAGCGCGTTGAGACGCCGGAAGCCGTGGCCGACCGGCTGACAAAAGCGGTTCGGCAGGGGTATGAGCCTGCCCTACAGGCCGCCGCAGGAGCGCGTGAGATGCGCAAGAAGGCCGATCAAGCCCAAGAGACGGCCCGAG

<210> 2

<211>42

<212> DNA

<213> iEGFP-F

<400>

AGGGAACAAAAGCTGGGTACCCCGTTTCCATTTAGGTGGGTA

<210> 3

<211>37

<212> DNA

<213> iEGFP-R

<400>

CGCGGTGGCGGCCGCTCGATCGATTATTTATTTCCTG

Claims

A pBT-iEGFP plasmid vector is characterized by having a nucleotide sequence shown in SEQ ID No. 1.
2. The method for constructing the pBT-iEGFP plasmid of claim 1, comprising the steps of:

1) the pZT-EGFP plasmid is used as a template, iEGFP-F and iEGFP-R are used as primers, a green fluorescent protein fragment TetR-Pzt-1-iEGFP is expressed in a PCR amplification inducing mode, and the sequences of the primers are as follows:

iEGFP-F: AGGGAACAAAAGCTGGGTACCCCGTTTCCATTTAGGTGGGTA

iEGFP-R: CGCGGTGGCGGCCGCTCGATCGATTATTTATTTCCTG

2) the broad host plasmid pBBR1MCS is cut by restriction enzymes KpnI and XbaI, and after agarose gel electrophoresis, the linearized pBBR1MCS plasmid is recovered by a gel recovery kit;

3) the seamless cloning kit is connected with a TetR-Pzt-1-iEGFP fragment and a pBBR1-MCS linearized plasmid, a product is transformed into escherichia coli DH5 alpha, positive clones are identified by PCR, and the plasmid with the correct determination is named as a pBT-iEGFP plasmid.
3. The method of claim 1, wherein the green fluorescent protein is induced and expressed by transforming the plasmid into a bacterium belonging to the genus Escherichia. The method is characterized by comprising the following steps:

1) the chemical transformation method of the escherichia coli engineering bacteria DH5 alpha comprises the following steps: 100 mu L of escherichia coli competent cells are taken, ice water mixture is slowly melted, 20 ng of pBT-iEGFP plasmid is added, after uniform mixing, ice bath is carried out for 30 min, heat shock is carried out for 90 s at 42 ℃, ice bath is carried out for 2 min, 1 mL of LB solution is added, shake culture is carried out for 45 min at 37 ℃, chloramphenicol LB plate coating is carried out to screen positive clones, positive clone strains are inoculated into chloramphenicol LB solution, anhydrous tetracycline with different concentrations of 0-100 ng/mL is respectively added to induce for 12h, 500 mu L of culture solution is taken, PBS is washed twice, sterile water is used for suspension, 5-10 mu L of turbid liquid is taken to coat a glass slide, an alcohol lamp is used for drying, and bacteria fluorescence is observed through a fluorescence microscope.

2) The avian pathogenic escherichia coli AH50 electrotransformation method comprises the following steps: LB culture of avian pathogenic Escherichia coli AH50 to logarithmic prophase (OD)₆₀₀= 0.4-0.6), ice-bath for 10 min, and washing the thallus with sterile precooled waterTwo times, pre-cooled 10% glycerol sterile water suspension bacteria are packaged into 100 muL of each tube, 1 mug of pBT-iEGFP plasmid is added, ice bath is carried out for 10 min, the mixture is added into a 1 mm electric conversion cup, ice bath is carried out for 10 min, the plasmid is electrically converted into avian pathogenic escherichia coli AH50 under the condition of 1.8 kV 200 omega, a chloramphenicol LB (LB) plate is coated to screen positive clones, the positive clone strains are inoculated into a chloramphenicol LB solution, anhydrous tetracycline with different concentrations of 0-100 ng/mL is respectively added to induce for 12h, 500 muL of culture solution is taken, PBS is washed twice, sterile water suspension is carried out, 5-10 muL of turbid liquid is taken to coat a glass slide, an alcohol lamp is dried, and fluorescence of the bacteria is observed through a fluorescence microscope.
4. The plasmid of claim 1 transformed with a salmonella bacterium to induce expression of green fluorescent protein. The method is characterized by comprising the following steps:

salmonella typhimurium SL1344 was cultured in LB to the pre-logarithmic growth phase (OD)₆₀₀= 0.4-0.6), ice-bathing for 10 min, washing the bacteria twice with sterile pre-chilled water, pre-chilled 10% glycerol sterile water suspending the bacteria, subpackaging 100 μ L per tube, adding 1 μ g pBT-iEGFP plasmid, ice-bathing for 10 min, adding the mixture into a 1 mm electric transformation cup, under the condition of 1.8 kV 200 Ω, electrically transforming the plasmid into SL1344, coating a chloramphenicol LB plate to screen positive clones, inoculating the positive clone strains into a chloramphenicol LB solution, respectively adding 0-100 ng/mL anhydrous tetracycline with different concentrations to induce for 12h, taking 500 μ L of culture bacteria solution, washing twice with PBS, suspending with sterile water, taking 5-10 μ L of suspension, coating a glass slide, drying with an alcohol lamp, and observing the fluorescence of the bacteria with a fluorescence microscope.
5. The plasmid of claim 1 is transformed into brucella bacteria to induce and express green fluorescent protein. The method is characterized by comprising the following steps:

the brucella melitensis vaccine strain M5 is inoculated in TSB and cultured to logarithmic growth prophase (OD)₆₀₀= 0.6-0.8), performing ice bath for 10 min, washing thalli twice with sterile pre-cooled water, packaging pre-cooled 10% glycerol sterile water suspension cells into each tube by 100 muL, adding 1 mug pBT-iEGFP plasmid, performing ice bath for 10 min, adding the mixture into a 1 mm electric transformation cup, under the condition of 2.4 kV 400 omega,electrically converting plasmids into M5, coating a chloramphenicol LB (lysogeny broth) plate to screen positive clones, inoculating a positive clone strain into a chloramphenicol TSB (bacterial suspension Broth-binding) solution, respectively adding 0-100 ng/mL of anhydrous tetracycline with different concentrations to induce for 24 hours, adding 0.3% formalin solution to inactivate for 24 hours, taking 500 mu L of inactivated bacteria solution, washing twice with PBS (phosphate buffer solution), suspending with sterile water, taking 5-10 mu L of turbid liquid to coat a glass slide, drying with an alcohol lamp, and observing bacterial fluorescence with a fluorescence microscope.
6. The use of claims 3, 4 and 5, wherein the pBT-iEGFP is used for fluorescent tracing of Escherichia coli, Salmonella typhimurium and Brucella melitensis, and other pBT-iEGFP plasmid species.