CN111560341A

CN111560341A - Generic inert vector escherichia coli and potential application thereof

Info

Publication number: CN111560341A
Application number: CN202010428277.XA
Authority: CN
Inventors: 朱国强; 杨斌; 羊扬; 孟霞; 夏芃芃; 段强德; 王亨; 朱晓芳
Original assignee: Yangzhou University
Current assignee: Yangzhou University
Priority date: 2020-05-19
Filing date: 2020-05-19
Publication date: 2020-08-21
Anticipated expiration: 2040-05-19
Also published as: WO2021232800A1; KR20220038687A; CN111560341B

Abstract

The invention discloses a pan-type inert vector salmonella S9H and potential application thereof. The pan-type inert carrier salmonella S9H is obtained by continuously culturing and passaging an inert carrier bacterium S9 to the fortieth generation in vitro by using LB solid and liquid culture media, can not generate non-specific agglutination reaction with serum and whole blood of human, mouse, cattle, pig and poultry sources (including chicken, duck, goose, turkey, pigeon and quail) under the working concentration bacterial quantity, has the characteristics of carrying and surface expression of different antigen factors of the human, mouse, cattle, pig and poultry sources (including chicken, duck, goose, turkey, pigeon and quail), can be applied to the development of indirect agglutination test detection methods for simply and rapidly detecting human and various animal antigens or infected antibodies, improves and perfects the specificity and the technical bottleneck of poor sensitivity of the agglutination test of the existing agglutination test for detecting the agglutination antigens and antibodies, and has wide application value and market prospect.

Description

Generic inert vector escherichia coli and potential application thereof

Technical Field

The invention belongs to the technical field of biomedical detection, and particularly relates to a pan-type inert carrier escherichia coli and potential application thereof, wherein the pan-type inert carrier escherichia coli can not have nonspecific agglutination reaction with human, mouse, cattle, pig and poultry (including chicken, duck, goose, turkey, pigeon and quail) with different genetic backgrounds, and serum and whole blood of various animals under the working concentration bacterial quantity.

Background

In the diagnosis, monitoring and prevention and control work of livestock and poultry epidemic diseases, the commonly used diagnosis technology at present comprises a serological diagnosis technology and a etiology detection technology. In the diagnosis of bacterial diseases, although the separation and identification of bacteria is a gold standard method for diagnosing bacterial infection, the method has the defects of long culture period, limited sampling position, limited sampling time, low detectable rate, complex operation and the like, and if separation and identification work is carried out on pathogenic bacteria of zoonosis represented by brucella, the laboratory biological safety hidden danger and the biological safety platform requirement also exist. Serological detection techniques have the advantages of simple operation, low biological risk and the like, and are often used for diagnosing whether an animal is infected with or carries a certain pathogen, wherein agglutination tests are a classical serological quick diagnosis method widely used in medical and veterinary clinics. The principle of the agglutination test is that bacterial particle antigens are agglutinated and aggregated in a few minutes after being combined with corresponding serum antibodies in the presence of electrolytes and at a proper temperature to form agglutinated small blocks or particles, and the reaction result can be observed and judged only by naked eyes. We refer to the antigen involved in the reaction as the agglutinogen and the antibody as the lectin. For example, the plate agglutination test is a qualitative method widely used in agglutination reaction, and diagnostic serum (containing known antibodies) and suspension to be detected are respectively dropped on a clean transparent glass plate, and after the diagnostic serum and the suspension to be detected are mixed lightly in equal volume, the room temperature is waited for 2 minutes, if macroscopic particle agglutination occurs, the positive agglutination reaction is obtained, and the method is commonly used for bacterial identification, antigen typing and the like. Conversely, known diagnostic antigens can be used to detect the presence of the corresponding antibody in the serum or whole blood to be tested. Because of simple operation and low cost, the agglutination test has wide application, such as the widal agglutination test for diagnosing the widal disease/paratyphoid disease infection, the tiger red plate agglutination test for diagnosing the brucella infection and the whole blood plate agglutination test for detecting the pullorum disease/salmonella typhi infection. However, in practical application, the agglutination diagnostic antigen is found to have various nonspecific cross reactions, the detection result of each batch is unstable and the repeatability is poor, the weak positive result in the reaction is difficult to judge, the sensitivity is poor, and the detection result is influenced by various factors such as missing detection and the like. In order to fundamentally solve the problems of nonspecific cross reaction of complete bacteria antigen agglutination tests of typhoid/paratyphoid salmonella, pullorum salmonella and brucella and sensitivity limitation of detection of a thallus O antigen targeting antibody, the detection accuracy of the agglutination test is improved, and the research and development of a detection system capable of replacing the conventional classical agglutination test are urgent and necessary. However, it is a prerequisite that a pan-type inert carrier bacterium is obtained which does not cause non-specific agglutination reaction with serum/whole blood of various animal-derived backgrounds such as human, livestock and poultry.

In the previous research, the inert carrier Escherichia coli SE1 researched by the applicant only has the non-agglutination function on chicken serum with different backgrounds within a certain concentration range, and other animals may have agglutination conditions with different degrees, so that the inert carrier Escherichia coli SE1 can only be used for developing chicken agglutination experiments and application thereof, and the application thereof has certain limitation.

Many scientists have now systematically studied bacterial expression and surface self-display of heterologous polypeptides or proteins and their functional regions, and have conducted intensive research studies in gram-negative bacteria, particularly representative of Escherichia coli and Salmonella typhi, such as Klause et al, Neisseria gonorrhoeae IgA1 protease expressed the heterologous polypeptide-Vibrio cholerae toxin B subunit in the passenger domain in 1990, and secreted to the outer membrane via protein transport units and displayed on the surface of Escherichia coli and Salmonella typhi and displayed their functions. Similarly, if the pan-type inert carrier bacteria can carry and express on the surface to present a single antigen factor and specifically target different pathogenic bacteria infection (antibody), the specificity and sensitivity of the agglutination antigen reaction can be accurately improved on the premise of keeping the advantages of intuitive and quick agglutination reaction result, simple and convenient operation, on-site detection and the like, and the agglutination test taking the pan-type inert carrier bacteria as the carrier can perfect the monitoring, detection and diagnosis work of various diseases. The pan-inert carrier bacterium can be used as a carrier to develop specific target different pathogenic bacteria infection (antibody), and the novel monitoring and detecting method of the agglutination antigen test has great potential application prospect in diagnosis and detection of human and many animal diseases.

Disclosure of Invention

The purpose of the invention is as follows: aiming at the problems that the specificity, sensitivity, repeated stability and accuracy of detection results of agglutination tests widely used in the field of diagnosis and detection of human and animal diseases are needed to be improved and are very urgent, the inventor uses LB agar and liquid culture medium to alternately culture inert carrier Escherichia coli SE1 for 40 generations to obtain an Escherichia coli SE1H with the characteristics of a pan-type inert carrier, the pan-type inert carrier is characterized in that under the working concentration bacterial number, the pan-type inert carrier does not have nonspecific agglutination reaction with serum and whole blood of human sources and various animals including mouse sources, bovine sources, pig sources, poultry sources and the like, can express and display on the surface and carry specific antigen factors, targets specific infectious antibodies, and can be used as a pan-type inert carrier for development of indirect agglutination tests for rapidly monitoring and detecting antibodies of infected human and various animals on site, has wide potential application prospect. The generic inert vector Escherichia coli SE1H is different from SE1 strain in that it has non-agglutinating function to different animals, so it is called generic inert vector, and its application range will be wider.

The technical scheme is as follows: in order to solve the technical problems, the invention provides a ubiquitous inert carrier Escherichia coli, which is a strain obtained by continuously culturing an inert carrier bacterium SE1 in vitro to passage to the fortieth generation and above by using LB liquid and a solid culture medium and is named ubiquitous inert carrier Escherichia coli SE1H, the fortieth generation to the sixty generation, and has the same ubiquitous inert carrier characteristic.

The invention also comprises a method for obtaining the generic inert carrier escherichia coli, which comprises the following steps: continuously culturing the inert carrier bacterium SE1 in vitro to a fourth generation or above by using LB liquid and a solid culture medium to obtain the pan-type inert carrier Escherichia coli SE 1H.

Wherein, the pan-type inert carrier Escherichia coli SE1H can be cultured in LB and eosin methylene blue agar culture medium by the following method: selecting a small amount of the preserved strains, and streaking the strains in an LB or eosin methylene blue agar culture medium at the culture temperature of 37 ℃, wherein after the strains are cultured in the LB agar culture medium at the temperature of 37 ℃, grey-white round colonies can be formed; in eosin methylene blue agar plate, after being cultured at 37 ℃, a non-metallic luster and black colony can be formed.

According to the invention, the indigoid matrix (indole, I) test, the Methyl Red (MR) test, the VP test and the citrate (C) utilization test and the five sugar fermentation test are carried out on the pan-type inert carrier bacterium SE1H according to a national standard method (GB4789.38-2012), and the results meet the escherichia coli biochemical characteristics described in the national standard method.

Glass plate agglutination test tests that the bacterial suspension of the pan-type inert carrier bacteria SE1H has no self-agglutination phenomenon, and does not have non-specific agglutination reaction with various serums and whole blood of human sources, mouse sources, cattle sources, pig sources, poultry sources (including chicken, duck, goose, turkey, pigeon and quail) and the like with different source backgrounds.

The pan-type inert carrier Escherichia coli SE1H can be expressed and displayed on the surface of bacteria respectively by a molecular biology construction means and carries single antigen factors, wherein the single antigen factors comprise avian-derived Salmonella P factor, swine-derived Escherichia coli K88ac antigen factor, bovine-derived Escherichia coli K99 antigen factor and human-derived Salmonella I antigen factor.

The invention also comprises a pan-type inert carrier indirect agglutination test detection system, which comprises the pan-type inert carrier escherichia coli and a complex which is expressed on the surface of the pan-type inert carrier escherichia coli and carries a specific antigen factor.

Wherein the specific antigen factor is one or more of fowl-derived salmonella P factor, swine-derived escherichia coli K88ac antigen factor, bovine-derived escherichia coli K99 antigen factor or human-derived salmonella I antigen factor.

The invention also comprises a construction method of the universal inert carrier indirect agglutination test detection system, which comprises the following steps:

1) obtaining a coding gene of a specific antigen factor;

2) connecting the coding gene of the specific antigen factor with a plasmid to obtain a recombinant plasmid;

3) the recombinant plasmid is transformed into escherichia coli SE1H to be electrically transformed into competent cells, and the recombinant strain is identified to be the pan-generic inert carrier indirect agglutination test detection system.

Wherein the encoding gene of the specific antigen factor in the step 1) is an encoding gene of an avian salmonella P factor, an encoding gene of a porcine escherichia coli K88ac antigen factor, an encoding gene of a bovine escherichia coli K99 antigen factor or an encoding gene of a human salmonella I antigen factor.

The invention also comprises the application of the generic inert carrier escherichia coli or the detection system in preparing an inert carrier in an indirect agglutination test for detecting antigen or an inert carrier in an indirect agglutination test for detecting antibody.

The invention also comprises the application of the generic inert carrier escherichia coli or the detection system in preparing a reagent or a kit for indirect agglutination test for detecting antigen or antibody.

The invention also comprises the application of the generic inert carrier escherichia coli or the detection system in the preparation of a reagent or a kit for detecting human, bovine, porcine, murine or avian related pathogenic infection.

The invention also comprises a detection kit, wherein the detection kit comprises the generic inert carrier escherichia coli or the detection system.

Has the advantages that: the invention starts to passage an inert carrier SE1 for 40 generations alternately by LB agar and a liquid culture medium, and continues to passage for 41 generations to 60 generations, the obtained strains have the characteristics of a pan-type inert carrier, are named as pan-type inert carrier Escherichia coli SE1H, have the characteristics of pan-type inert carrier bacteria, show that the pan-type inert carrier Escherichia coli SE1H does not have non-specific agglutination reaction with various serums and whole blood of human sources, mouse sources, cattle sources, pig sources, poultry sources (including chicken, duck, goose, turkey, pigeon and quail) with different source backgrounds, can respectively express and display on the surface of bacteria and carry avian salmonella P factor, porcine Escherichia coli K88ac antigen factor, bovine Escherichia coli K99 antigen factor and human salmonella I antigen factor, can be applied to the development of indirect agglutination test detection methods for simply and quickly detecting antigens or infected antibodies, improves and perfects the technical bottlenecks that the existing agglutination test for detecting the agglutination antigen and antibody has poor specificity and sensitivity to be improved, and has huge potential application value and market prospect.

FIG. 1 shows the PCR identification of SE 1H. Lane M is Trans 2K Marker; lane 1 is the PCR amplification of the β -glucuronidase gene uidA of E.coli SE 1H; lane 2 is PCR amplification of β -glucuronidase gene uidA of EDL 933; lane 3 is PCR amplification of β -glucuronidase gene uidA of DH5 α; lane 4 shows the PCR amplification of the β -glucuronidase gene uidA from Salmonella enteritidis C50336.

FIG. 2 is a schematic representation of an agglutination reaction; the test result of agglutination reaction detection of the pan-type inert carrier bacterium SE1H bacterial suspension with 100 hundred million CFU/mL bacterial concentration and serums from different sources is shown in the figure: 1. human A type blood serum, 2 human B type blood serum, 3 human AB type blood serum, 4 human O type blood serum, 5 Holstein cow serum, 6, beef cattle serum, 7, BALB/C mouse serum, 8, Changbai pig serum, 9, chicken serum, 10, duck serum, 11, turkey serum, 12, pigeon source serum; the negative control is SE1H reacted with physiological saline; positive control: namely, SE1H-K88ac reacted with rabbit anti-K88 ac antigen pili polyclonal antiserum.

FIG. 3 is an agarose electrophoresis picture of the PCR amplification product of avian salmonella p gene; wherein, M: trans 2K PlusII; 1: p-PCR product.

FIG. 4 is an electrophoresis diagram of the p-gene-containing recombinant plasmid PMD19T-p enzyme digestion identification of the PMD19-T simple vector DNA vector; wherein, Ma: trans 2K Plus II; mb: trans 2K Plus; 1-3: 19T-pNheI single enzyme digestion. 4-6: 19T-pBamHI single enzyme digestion; 8-10: 19T-p double enzyme digestion.

FIG. 5 is an electrophoresis diagram of p-gene-containing recombinant plasmid p-pBR322 for enzyme digestion identification; wherein, M: trans 15K; 1: p-pBR322 recombinant plasmid control; 2: the p-pBR322 recombinant plasmid NheI is subjected to single enzyme digestion; 3: pBR322 plasmid without p gene insertion.

FIG. 6 is a transmission electron microscope image (26500X) of negative staining of vector strain SE1H and recombinant vector strain SE1H-P expressing avian Salmonella P factor on the surface. A is carrier bacterium SE1H, and B is SE 1H-P.

FIG. 7 is a diagram of an agglutination test of recombinant bacteria SE1H-pBR 322-K99. 1, agglutination reaction of recombinant bacteria SE1H-pBR322-K99 and mouse anti-K99 antigen pilus polyclonal antibody; 2 is a recombinant bacterium SE1H-pBR322-K99 and a mouse anti-Escherichia coli K88ac polyclonal antibody; 3 is a recombinant bacterium SE1H-pBR322-K99 and a mouse anti-Escherichia coli F18ab antigen pilus polyclonal antibody; 4 is a recombinant bacterium SE1H-pBR322-K99 and Escherichia coli F18ac antigen pilus polyclonal antibody; 5 is a polyclonal antibody of recombinant bacteria SE1H-pBR322-K99 and salmonella typhi U20; 6 is a polyclonal antibody of recombinant bacteria SE1H-pBR322-K99 and salmonella enteritidis C50336.

FIG. 8 is a transmission electron microscope observation picture (46000X) of negative staining of vector bacterium SE1H and recombinant vector bacterium SE1H-K99 with bovine Escherichia coli K99 antigen factor expressed on the surface. A is carrier bacterium SE1H-PBR322, B is recombinant bacterium SE1H-pBR 322-K99.

FIG. 9 is a diagram of the SE1H-K88ac agglutination assay. A is a monoclonal antibody agglutination test chart of SE1H-K88ac and mouse anti-K88 ac antigen pilus, and B is a monoclonal antibody agglutination test chart of SE1H-pBR322 mouse anti-K88 ac antigen pilus.

FIG. 10 is a transmission electron microscope observation picture (26500X) of negative staining of vector strain SE1H and recombinant vector strain SE1H-K88ac with surface expression swine Escherichia coli antigen factor K88ac antigen factor. A is carrier bacterium SE1H-PBR322, and B is SE1H-K88 ac.

FIG. 11 is a diagram of SE1H-I agglutination assay. A is a test chart of SE1H-I and mouse anti-I antigen factor (type I pilus) multiple antiserum agglutination, B is a test chart of Salmonella enteritidis reference strain C50336 and mouse anti-I antigen factor (type I pilus) multiple antiserum agglutination, and C is a test chart of SE1H-PBR322 and mouse anti-I antigen factor (type I pilus) multiple antiserum agglutination.

FIG. 12 is a transmission electron microscope image (46000X) of negative staining of vector bacterium SE1H and recombinant vector bacterium SE1H-I expressing antigenic factor I of Salmonella humanized on the surface. A is carrier bacterium SE1H-PBR322, B is recombinant carrier bacterium SE 1H-I.

Detailed Description

Before the present embodiments are further described, it is to be understood that: the scope of the invention is not limited to the specific embodiments described below; it should also be understood that: the terminology used in the examples herein is for the purpose of describing particular embodiments only and is not intended to limit the scope of the present invention. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. In addition to the specific methods, devices, and materials used in the examples, any methods, devices, and materials similar or equivalent to those described in the examples may be used in the practice of the invention in addition to the specific methods, devices, and materials used in the examples, in keeping with the knowledge of one skilled in the art and with the description of the invention.

The PBS buffer solution involved in the invention is phosphate buffered saline solution with pH value of 7.4 and 0.01M.

The inert carrier Escherichia coli SE1 adopted in the invention is preserved in China general microbiological culture Collection center (CGMCC), the preservation address is Beijing, China, the preservation number is CGMCC No.17339, the preservation date is 3/18 in 2019, and the inert carrier Escherichia coli SE1 is classified and named as Escherichia coli (Escherichia coli) and the strain code is SE 1. The deposited strain is described in patent application No. 2019104243819.

EXAMPLE 1 acquisition and validation of the generic inert vector E.coli SE1H

Inoculating inert carrier Escherichia coli SE1 (preservation number is CGMCC No.17339) into LB liquid culture medium, shaking at 37 ℃ for 12h, absorbing 30 mu L of bacterial liquid, streaking and culturing in LB solid culture medium, culturing at 37 ℃ for 16-18h to obtain second generation bacterial colony, selecting single bacterial colony of the second generation, inoculating the single bacterial colony into LB liquid culture medium, and circularly using LB liquid and solid culture medium to alternately culture from 40 generations, wherein the obtained single bacterial colony is a universal inert carrier bacterium SE1H, and in fact, any generation has the characteristic of universal inert carrier bacterium SE1H by continuously passaging the first generation to sixty generations.

1mL of the overnight-cultured SE1H bacterial suspension was boiled to prepare a DNA template. PCR amplification is applied to escherichia coli beta-glucuronidase gene uidA, 1.5% gel electrophoresis identification is carried out, and the size of a target fragment is 162 bp; reference synthesis primer sequences synthesized by jinviruz, suzhou were as follows:

uidA-F：5′TGGTAATTACCGACGAAAACGGC 3′；

uidA-R：5′ACGCGTGGTTACAGTCTTGCG 3′；

reaction system 20. mu.L, containing 10. mu.L of 2 XTAQA Master Mix (Dye Plus) (purchased from Nanjing Novowed Biotech Co., Ltd.), 1. mu.L each of uidA-F/R (10. mu.M), 2. mu.L of DNA template, 6. mu.L of sterilized ultrapure water to make up 20. mu.L; the optimized PCR reaction conditions are as follows: 5min at 94 ℃; 30 cycles of 94 ℃ for 30s, 60 ℃ for 30s and 72 ℃ for 30 s; 10min at 72 ℃. The results showed that SE1H amplified a 162bp band corresponding to the size of E.coli standard strain EDL933 (O157: H7 type E.coli attenuated strain, lacking eae and stx genes), E.coli DH5 alpha (FIG. 1).

The inert carrier bacteria SE1H are subjected to an indigo matrix (indole, I) test, a Methyl Red (MR) test, a VP test and a citrate (C) utilization test for biochemical identification, and the indigo matrix test, the MR-VP test and the citrate utilization test for biochemical identification, and the results are analyzed and judged according to the specification of the trace biochemical tube, and the results meet the biochemical characteristics of escherichia coli described in the national standard method (GB4789.38-2012) (Table 1).

Table 1: biochemical Properties of SE1H Strain

Note: "-" indicates negative; "+" indicates positive.

EXAMPLE 2 test of non-specific agglutination of the pan-type inert vector E.coli SE1H with different backgrounds of human and animal serum and whole blood

Escherichia coli SE1H obtained by overnight culture in example 1 was centrifuged at 4000rpm at4 ℃ for 10min, the supernatant was discarded, and the bacterial sludge was resuspended in sterile physiological saline, washed three times by centrifugation, and then resuspended in a concentration gradient of bacterial count of different concentrations. Before testing, the bacteria liquid is mixed evenly by a vortex instrument, and the agglutination test is carried out by sterile physiological saline and SPF chicken serum to ensure that the test bacteria liquid has no self-agglutination and non-specific agglutination. Taking a plurality of pieces of common glass plates with clean surfaces in a super clean bench (20-25 ℃), centrifugally resuspending and washing the carrier bacteria for 3 times by PBS (phosphate buffer solution) with sterile precooling to 4 ℃, and then resuspending and diluting to the specified bacteria concentration. A drop of carrier bacterial suspension SE1H with different concentration gradients (different volumes of 10-50 mu L) is absorbed by a micropipette and is vertically dripped on the surface of a horizontally placed glass plate, and then equivalent serum, red blood cells and whole blood to be detected are quickly dripped. The bacterial suspension, the serum, the red blood cells and the whole blood are fully and uniformly mixed by using a sterilization gun head, the mixture is coated into a sheet with the diameter of 1 cm-2 cm, then the glass plate is stably shaken, and the test is carried out within 2min and the test result is observed. And the standard judgment condition is that the reaction result or granular red blood coagulation granules with red blood cells and whole blood to be detected are judged to be positive within 2min at room temperature by using flocculent or granular macroscopic precipitates generated by the bacterial liquid and the serum to be detected, and otherwise, the reaction result is judged to be negative. SE1 suspension was prepared for control by the same procedure.

The agglutination test result shows that the carrier bacterium SE1 does not have a self-agglutination phenomenon under different concentration conditions (5-100 hundred million CFU/mL), the agglutination reaction result of detection of various serums, red blood cells and whole blood such as human sources, mouse sources, cattle sources, pig sources and poultry sources (including chicken, duck, goose, turkey, pigeon and quail) with different source backgrounds under the concentration of 20 hundred million CFU/mL is negative, but when the SE1 reaches the concentration of 50 hundred million CFU/mL, the carrier bacterium SE1 and partial human sources and partial different animal source serums and whole blood samples have agglutination expressions of different degrees. Under the condition of different concentrations (5-100 hundred million CFU/mL), the Escherichia coli SE1H has no self-agglutination phenomenon, and is negative with agglutination reaction results of various serums, erythrocytes and whole blood of human sources, mouse sources, bovine sources, pig sources, poultry sources (including chicken, duck, goose, turkey, pigeon and quail) and the like with different source backgrounds, so that the carrier bacterium Escherichia coli SE1H does not have non-specific agglutination reaction with various serums, erythrocytes and whole blood of human sources, mouse sources, bovine sources, pig sources, poultry sources and the like with different source backgrounds. Since the human serum, the serum derived from various animals, the red blood cells and the whole blood of different origins are randomly collected and the result of the agglutination reaction with the carrier bacterium Escherichia coli SElH is negative (FIG. 2), Escherichia coli SE1H can be considered as a pan-type inert carrier Escherichia coli.

TABLE 2 results of agglutination test of bacterial suspensions of different concentrations of Carriers SE1H and SE1 with whole blood/serum from different sources

Note: "-" indicates negative; "+" indicates positivity

EXAMPLE 3 testing and validation of the surface expression and ability to carry avian Salmonella antigen factor P of the pan-type inert vector bacterium Escherichia coli SE1H

(I) amplification of Gene P encoding avian Salmonella-derived antigen factor P

According to the full-length genome sequence published by the complete genome sequence of Salmonella pullorum ATCC 9120 strain (NCBI accession number: CP012347.1), Salmonella pullorum S44987_1 strain (NCBI accession number: LK931482.1), Salmonella pullorum S06004 strain (NCBI accession number: CP006575.1), Salmonella pullorum QJ-2D-Sal strain (NCBI accession number: CP022963.1), Salmonella gallinarum 287/91 strain (NCBI accession number: AM933173.1) and Salmonella gallinarum 9184 strain (NCBI accession number: CP019035.1), the full-length fragments of the P gene coding the antigen factor P are searched and aligned respectively, primers for amplifying the P gene by PCR are designed by Olige7 primer software, and the upstream primers and the downstream primers are respectively:

p-F：5′-ATG AAA CGT TCA CTT ATT CCT CCT T-3′

p-R：5′-TTA ATT ATA AGA TAC CACCAT TA-3′

respectively adding NheI and BamHI enzyme cutting sites and protective basic groups at the 5' ends of the upstream and downstream primers, preparing a salmonella typhi reference strain U20 template in a boiling method, and performing PCR amplification on a p gene (p-PCR) system: 5 Xpfu DNA polymerase buffer 10 u L, dNTP 5u L, upstream primer 2 u L, downstream primer 2 u L, template 2 u L, pfu high fidelity DNA polymerase (2.5units/uL)2 u L, deionized water 27 u L (5 Xpfu DNA polymerase buffer, dNTP and pfu high fidelity enzyme purchased from Beijing Quanjin biotechnology limited). PCR reaction parameters: 94 ℃ for 5 min. 1min at 94 ℃, 1min at 52 ℃, 1min at 72 ℃, 30 cycles, 10min at 72 ℃ and 4 ℃ storage.

After the p-PCR reaction was completed, 2.4. mu.L of rTaq DNA polymerase (5U/. mu.L, available from Takara Bio Inc.) was added to the system, and Poly A tail reaction was performed at 72 ℃ for 20 min.

Adding 10 μ L of 6X Loading buffer into the PCR amplification product, performing electrophoresis with 1% agarose gel 90V1h, observing that the target band meets the expectation by using an ultraviolet gel imager (figure 3), cutting the target band, recovering the PCR amplification product by using an agarose gel recovery kit according to the operation of the instruction, and storing the recovered product containing the PCR amplification DNA gene at-20 ℃ for later use.

(II) construction and identification of p-containing gene recombinant plasmid 19T-p

The A-tailed PCR amplification product obtained in the previous step was ligated to a PMD19-T simple vector DNA vector (hereinafter referred to as 19T vector, available from Promega, USA) in the following 10. mu.L ligation system: 1 mu L of 19T carrier, 4 mu L of recovery product containing PCR amplified DNA gene and 5 mu L of solution I, and placing the reaction system in a metal bath device at 16 ℃ for connecting reaction overnight.

The following day the ligation products were chemically transformed into DH 5. alpha. competent cells by the following procedure: thawing DH5 alpha competent cell in ultra-low temperature state on ice, adding 10 μ L ligation product into competent cell (adding ligation product when competent cell just thawed), mixing gently, and ice-cooling for 30 min; heat stress at 42 ℃ for 30s and immediately place on ice for 2 min. Adding 250 μ L LB solution balanced to room temperature, incubating at 37 deg.C for 2h at 200 rpm, centrifuging at 4000rpm, discarding the supernatant after 1min, leaving a little supernatant (about 100 μ L) to resuspend the thallus, uniformly spreading on ampicillin LB solid medium, and culturing at 37 deg.C overnight.

P-PCR identification: observing the growth of aseptic colonies and bacteria on an ampicillin (LB) solid culture medium, selecting a single colony to shake and culture in ampicillin liquid LB for 16h, taking 2 mu L as a template to perform PCR identification on bacteria liquid, and carrying out a reaction system: 2X taq DNA polymerase mix 10. mu.L (purchased from Nanjing Novozam Biotech Co., Ltd.), p gene upstream primer 1. mu.L, p gene downstream primer 1. mu.L, template (bacterial solution) 2. mu.L, deionized water 6. mu.L. Reaction parameters are as follows: 10min at 95 ℃; 1min at 94 ℃, 1min at 52 ℃, 1min at 72 ℃ and 25 cycles; storing at 72 deg.C for 10min and 4 deg.C. Electrophoresis on a 1% agarose gel for 90V1h and visual identification (see FIG. 4).

And (3) carrying out digestion and electrophoresis identification on plasmids: the plasmid was extracted using a commercial kit, and the purified plasmid NheI was digested singly, while NheI and BamHI were digested doubly (restriction enzymes NheI and BamHI purchased from TakaraBio Inc.), followed by agarose gel electrophoresis. NheI single enzyme system: m buffer 5. mu.L, NheI 1. mu.L, plasmid 30. mu.L, deionized water 14. mu.L. A double enzyme digestion system: BglI buffer 5. mu.L, NheI 1. mu.L, BamHI 1. mu.L plasmid 30. mu.L, deionized water 13. mu.L. Electrophoresis and visual identification were carried out on a 1% agarose gel 90V1h after 3h water bath at 37 deg.C (see FIG. 4).

(III) construction of p-containing Gene recombinant plasmid p-pBR322

In the above step, the p-PCR amplification product and the recombinant plasmid containing p gene 19T-p are positive, the size of the restriction enzyme plasmid is consistent with the expected value, DNA sequencing verification is carried out, NheI and BamHI double restriction enzyme is respectively adopted for pBR322 plasmid and 19T-p, the restriction enzyme system is the same as the above step (II), DNA gel blocks of target bands at 4361bp and 4845bp are respectively cut off after agarose gel electrophoresis and observation and identification, two target band DNAs are respectively recovered by a kit, and the reaction system of DNAT4 ligase: 1 μ L of 10 Xbuffer solution, 2 μ L of product recovered from digestion pBR322, 2 μ L of product recovered from digestion p, 1 μ L of T4 ligase (available from Promega, USA), and 4 μ L of deionized water. The reaction was carried out overnight at 16 ℃ in a metal bath apparatus.

(IV) construction and identification of P-gene-containing inert vector detection system SE1H-P

The p-pBR322 recombinant plasmid ligation product which is connected overnight in the previous step is transformed into competent cells of vector bacterium SE1H by electrotransformation, and the specific operation is as follows:

preparation of electrotransformation competent cells SE 1H: a single colony of SE1H on an overnight-grown LB plate was picked, inoculated into 4mL of LB liquid medium, shaken at 37 ℃ for 3 to 5 hours, and the growth of the bacteria was observed. Inoculating the bacterial liquid 1: 100 into 4mL liquid LB culture medium, shaking to OD at 37 ℃₆₀₀And (3) after the temperature reaches 0.4-0.6, placing the mixture in an ice bath for 30min, centrifuging the mixture at the temperature of 4 ℃ and 4000rpm for 10min, and removing the supernatant. Adding pre-cooled 10% glycerol, centrifuging at4 deg.C for three times, and finally resuspending with 40 μ L10% glycerol, and storing at-70 deg.C.

And (3) electric conversion operation: and mixing 2 mu L p-pBR322 recombinant plasmid with 40 mu L SE1H electric transformation competent cells, carrying out ice bath for 30min, adding the mixture into a 0.1cm Bio-Rad electrode cup for electric shock, quickly transferring a transformation product into 1mL SOC liquid culture medium after electric transformation, shaking for 4h at 37 ℃, centrifuging at 4000rpm for 10min, discarding supernatant, reserving a little bottom liquid for re-suspension, uniformly coating an ampicillin plate, and carrying out culture at 37 ℃ overnight.

Observing the growth condition of bacterial colonies on the next day, transferring the single colonies into an ampicillin liquid LB culture medium for amplification culture for 16h, extracting a recombinant plasmid P-pBR322, carrying out enzyme digestion on the plasmid by NheI, carrying out agarose gel electrophoresis and observation and identification to meet the expectation (see figure 5), obtaining SE1H-P bacteria after DNA sequencing verification, selecting the SE1H-P bacteria and storing the bacteria at-70 ℃ in the form of glycerol bacteria.

(V) inert carrier detection system SE1H-P identification of expression P factor

Respectively inoculating carrier bacteria SE1H and a P-gene-containing inert carrier detection system SE1H-P strain on LB and ampicillin-resistant LB agar culture media, placing the carrier bacteria SE1H and the P-gene-containing inert carrier detection system SE1H-P strain in 37 ℃ for culturing for 24h, then selecting grown single colonies and respectively inoculating the single colonies in LB and ampicillin-resistant LB liquid culture media, placing the single colonies in 37 ℃ for culturing, carrying out shaking culture for 12h and carrying out blind transfer for ten generations, then respectively inoculating a small amount of the bacterial liquid in the LB and ampicillin-resistant LB liquid culture media, after standing and culturing for 48h at 37 ℃, centrifuging the mixture at 10000rpm for 2min, carrying out heavy suspension precipitation by using sterilized PBS, sucking a small amount of supernatant, suspending the supernatant. Transmission electron microscopy, photography and results of Philips Tecnai12, the Netherlands showed that the P antigen factor component appeared invisible on the surface of SE1H, whereas the P antigen component (P factor component) appeared on the surface of SE1H-P and carried with it, as shown in FIG. 6.

Example 4 test validation of the surface expression of the vector bacterium Escherichia coli SE1H and the carrying of bovine Escherichia coli K99 antigen factor

PCR primer design and synthesis, fan operon gene amplification and cloning

According to the full-length genome sequences published by an Escherichia coli CFS3246 strain whole genome sequence (NCBI accession number: CP026929.1), an Escherichia coli H10407 strain whole genome sequence (NCBI accession number: NC _017633.1), an Escherichia coli 734/3 strain whole genome sequence (NCBI accession number: JPQX01000001.1) and an Escherichia coli UMNF18 strain whole genome sequence (NCBI accession number: NZ _ AGTD 00000000.1) in NCBI GenBank, the sequence information of each fragment of a bovine Escherichia coli K99 pilus fan operon is searched for alignment and splicing, and a pair of primers for PCR amplification coding the K99 pilus fan operon is designed. The upstream and downstream primers respectively contain BamH I and Sal I enzyme cutting sites, the primers are synthesized by Shanghai Kangkang bioengineering company, and the sequences of the upstream and downstream primers are respectively as follows:

FanBamUP(PBR)：5′-CAC GGA TCC TGG AGA ATC TAG ATG AAA AAA ACA CT-3′；

FanSalLO(PBR)：5′-CGC GTC GAC TCA TAT AAA TGT TAC AGT CAC AGG AAG T-3′。

preparing the template DNA of an escherichia coli K99 prototype strain C83907 by a whole-bacterium lysis method, designing PCR parameters according to a PCR method for amplifying fragment DNA by PCR, and amplifying the large fragment DNA. After the PCR amplification product is subjected to 0.8% agarose gel electrophoresis and observed identification, the target strip DNA recovered by the kit is connected with a pMD-18T vector (purchased from Promega corporation, USA), after the competent DH5 alpha is transformed, an ampicillin resistant LB plate is used for screening resistance hypothesis positive clones, and DNA sequencing identification and verification are carried out. BamHI and SalI are used for double enzyme digestion of pMD-18T containing fan operon gene and a vector pBR322 plasmid respectively, DNA of two digestion products is extracted by chloroform, is subjected to alcohol precipitation, centrifugation and purification, and is connected overnight at 16 ℃ under the action of T4 DNA ligase, the connection product is transformed into a competent cell of a vector bacterium escherichia coli vector bacterium SE1H, the obtained recombinant bacterium is subjected to small-amount extraction recombinant plasmid identification by an alkaline lysis method, and then single enzyme digestion and double enzyme digestion, agarose gel electrophoresis and observation identification are carried out to identify whether the construction of the recombinant plasmid is correct or not, and DNA sequencing identification and confirmation are carried out. The positive recombinant strain carrying the fan operon gene is named as SE1H-pBR 322-K99. Meanwhile, the empty plasmid pBR322 is transformed into a vector bacterium SE1H to construct a negative control bacterium SE1H-pBR 322.

(II) mouse anti-K99 pilus monoclonal antibody mediated agglutination reaction, vector bacterium escherichia coli SE1H thallus surface expression and test verification of bovine-derived escherichia coli K99 antigen-carrying factor

Selecting single colony of Escherichia coli K99 prototype strain C83907, inoculating in Minimal inorganic salt culture medium, selecting single colony of carrier recombinant bacteria SE1H-pBR322-K99 and single colony of SE1H-pBR322, culturing in ampicillin resistant LB liquid culture medium overnight, centrifuging at 12000rpm, discarding supernatant, washing twice with PBS buffer solution, and suspending in appropriate amount of PBS. Taking 5 mu L of sample, mixing with mouse anti-Escherichia coli K88ac pilus monoclonal antibody, polyclonal antibody, F18ab pilus polyclonal antibody, F18ac pilus polyclonal antibody, K99 pilus monoclonal antibody serum with different dilutions, the monoclonal antibody and polyclonal antibody serum are self-made in the laboratory, and can be specifically seen in articles (changeable horse, king-top, Zhao Jing, et al, Escherichia coli F4 pilus agglutination monoclonal antibody preparation and epitope difference [ J ] Yangzhou university Committee (agricultural and life science edition), 2017, 38 (01): 12-15+34 ], Yangyang, Caiyuan, Yulie, et al, Escherichia coli K99 pilus fan operon cloning, expression and activity [ J ] microbiology report, 2012, 52 (12): 1524 1530), and are mixed uniformly on the surface of a slide, incubated for 2min at room temperature, and agglutination reaction results are observed and judged under light.

The agglutination reaction result shows that the SE1H-pBR322-K99 recombinant bacteria and the murine anti-K99 pilus monoclonal antibody have obvious agglutination reaction but cannot generate agglutination reaction with Escherichia coli K88ac, F18ab and F18ac, Salmonella typhi U20 and Salmonella enteritidis C50336 polyclonal antibodies stored in the laboratory. The above results show that: the surface of the carrier bacterium Escherichia coli SE1H expresses and carries bovine Escherichia coli K99 antigen factors, while the surface of the SE1H-pBR322 negative control bacterium does not express K99 antigen factors, as shown in figure 7.

(III) transmission electron microscope observation, surface expression of vector bacterium escherichia coli SE1H and test verification of bovine escherichia coli K99-carrying antigen factor

SE1H-pBR322-K99 recombinant bacteria and SE1H-pBR322 negative control bacteria which do not express K99 pilus are respectively cultured for 16h, centrifuged, discarded supernatant and washed 3 times by PBS buffer solution, and then resuspended. Then, a proper amount of bacterial liquid is absorbed and suspended on a copper net, and phosphotungstic acid is negatively dyed for 5 min. The existence and distribution of pili on the surface of the bacteria are observed by a Philips Tecnai12-twin transmission electron microscope.

The electron microscope observation result shows that the surfaces of the recombinant bacteria SE1H-pBR322-K99 are full of pili, which indicates that the expression quantity of the pili on the surfaces of the recombinant bacteria is large, while the surfaces of the recombinant bacteria SE1H-pBR322 negative control bacteria only containing the pBR322 plasmid do not have any visible pili, and the figure is 8.

(IV) identification of pili, SDS-PAGE, Western blot analysis and test verification of surface expression of vector bacterium escherichia coli SE1H and carrying bovine escherichia coli K99 antigen factor

Recombinant Escherichia coli SE1H-pBR322-K99 was treated with heat extraction at 60 ℃ for 30 minutes to separate and purify pilin, and 12% SDS-PAGE was performed according to the relevant literature, and the size of the band of the major structural protein of expressed pilin was observed by staining with Coomassie brilliant blue R250. Coli K99 prototype strain C83907 was used as a positive control, and recombinant strain SE1H-pBR322 was used as a negative control. The SDS-PAGE result shows that a main structural protein band at 18.5KD is obtained from the separated and purified recombinant strain SE1H-pBR322-K99, the size of the main structural protein subunit of the K99 pilus expressed by fanC is consistent with that of the main structural protein subunit of the pilus separated and purified by heat extraction of a K99 prototype strain C83907 of escherichia coli, and a heat extraction product of a negative control strain SE1H-pBR322 is identified by SDS-PAGE to have no corresponding band at 18.5 KD.

Transferring the hot extraction separation and purification pilin strip to a nitrocellulose NC membrane through a BIO-RAD protein strip transfer system, and sealing with 10% skimmed milk powder at4 ℃ overnight. The NC membrane is washed by PBST washing liquid for 5 times, a murine k99 fimbrial monoclonal antibody diluted by 1: 500 is sequentially added as a primary antibody, goat anti-mouse IgG-HRP diluted by 1: 50 is used as a secondary antibody for incubation, and DAB substrate is developed. Meanwhile, the synchronous separation and purification of pili of an escherichia coli K99 prototype strain C83907 is used as a positive control, and the heat extraction product of a negative control strain SE1H-pBR322 is used as a negative control. Results of the Westernblot immunoblotting show that the murine anti-K99 pilus monoclonal antibody can specifically recognize main pilus structural protein bands expressed by recombinant strain SE1H-pBR322-K99 and Escherichia coli K99 prototype strains, but cannot recognize a hot extraction product of a negative control strain SE1H-pBR322, and the results also show that the recombinant Escherichia coli SE1H-pBR322-K99 carries bovine Escherichia coli K99 antigen factors and expresses on the surface of the strain.

Example 5 test validation of Escherichia coli vector SE1H on surface of cells and carrying porcine-derived Escherichia coli antigenic factor K88ac

PCR amplification primer design and synthesis

According to the entire genome sequence of Escherichia coli UMNK88 strain (NCBI accession No.: CP002729.1) and Escherichia coli C83549O 149 in NCBI GenBank: a pair of PCR primers for amplifying fae gene operon full length is designed by comparing and analyzing the full length of the genome sequence published in K88ac strain complete genome sequence (NCBI accession number: EU570252.1) and Escherichia coli NCYU-25-82 strain complete genome sequence (NCBI accession number: CP042627.1) and fae gene operon sequence information which is published at home and abroad and codes swine Escherichia coli K88ac pilus. The upstream and downstream primers are respectively:

F：5′-CAGGCTAGCATGAAAAAAGCATTCTTAT-3′

R：5′-CGGGATCCTCAGAAATACACCACCACCGGTGTC-3′

the upstream and downstream primers respectively contain Nhe1 and BamH1 enzyme cutting sites, and are synthesized by Shanghai Kangkang bioengineering company.

(II) preparation of PCR amplification template bacterial chromosome DNA

Preparing the bacterial chromosome DNA according to a whole bacterial lysis method. Escherichia coli K88ac reference strain C83902 oscillation 16-18 hours LB liquid culture, centrifugation and sterilization ultrapure water suspension washing, 100 ℃ water bath 10min, placed in ice bath to cool, 4 ℃ 7000rpm centrifugation 10min, the supernatant as PCR amplification template. The primer concentration was 25pmol/L, and the 50. mu.L reaction system included Buffer 25. mu.L, dNTP 4. mu.L, upstream primer 1. mu.L, downstream primer 1. mu.L, template DNA 5. mu.L, Long PCR high fidelity DNA polymerase 0.8. mu.L (5U/. mu.L, purchased from Nanjing Nozan Biotech Co., Ltd.); PCR cycle parameters were that after denaturation of the template DNA at 94 ℃ for 2min, 25 cycles of 94 ℃ (15s) -56 ℃ (30s) -68 ℃ (8min) were performed, followed by 68 ℃ extension for 20min and 4 ℃ storage.

(III) agarose gel electrophoresis and observation and identification of PCR amplification product

And (3) uniformly mixing 10 mu L of PCR amplification product and 2 mu L of 6 × loading buffer, carrying out electrophoresis on 0.8% agarose gel (containing 0.5 mu g/ml of ethidium bromide) by using an electrophoresis buffer solution of 1 × TAE, and observing and identifying the size of the PCR amplification product by using a BIO-RAD gel imager after constant voltage of 70V for 1 h.

(IV) cloning construction of Positive recombinant plasmid pBR322-K88ac containing fae Gene operon

Respectively digesting the PCR amplification product and pBR322 expression plasmid by Nhe1 and BamH1 enzyme, extracting with phenol/chloroform, precipitating with ethanol, purifying, mixing the PCR amplification product with pBR322 plasmid at 3: 1, connecting with T4 DNA ligase overnight at 16 deg.C, transferring into carrier bacterium SE1H, screening putative positive clone with ampicillin resistant plate, simultaneously extracting putative positive clone plasmid DNA with alkaline lysis method, and carrying out single enzyme digestion, double enzyme digestion and agarose gel electrophoresis to identify the size of positive clone plasmid, the result shows that the positive recombinant plasmid pBR322-K88ac containing fae gene operon is constructed correctly, and plasmid DNA sequencing verifies.

The PCR amplification product was subjected to 0.8% agarose gel electrophoresis to reveal that a specific target band was amplified by PCR, which was about 7.9kb in size, and was identical to the expected gene size of fae operon. Screening a putative positive recombinant plasmid pBR322-K88ac by an ampicillin resistance LB plate, carrying out agarose gel electrophoresis on a purified recombinant plasmid DNA restriction enzyme digestion product to show that the product is a recombinant plasmid containing a target gene fae operon, carrying out sequencing verification by Shanghai Kangkang gene company, and finally constructing to obtain a recombinant vector bacterium SE1H-K88ac containing the positive recombinant plasmid pBR322-K88 ac.

Agglutination reaction mediated by (five) mouse anti-K88 ac pilus monoclonal antibody

A single colony of the recombinant vector strain SE1H-K88ac containing pBR322-K88ac was inoculated into LB medium containing 100. mu.g/mL ampicillin, and cultured overnight at 37 ℃ with shaking. 10 mu L of the bacterial liquid is respectively mixed with equal amounts of rabbit anti-K88 ac pilus polyclonal serum and mouse anti-K88 ac monoclonal antibody, and observed under light according to agglutination test reaction, the result shows that the recombinant bacteria can generate obvious agglutination reaction with rabbit anti-K88 ac pilus polyclonal serum and mouse anti-K88 ac pilus monoclonal antibody as Escherichia coli K88ac reference strain C83902 after being cultured overnight for a period of time at 37 ℃ (see figure 9). The mouse antiserum prepared by hot extraction, separation and purification of pili of the recombinant bacterium SE1H-K88ac can also generate obvious agglutination reaction with the recombinant vector bacterium SE1H-K88ac, and the agglutination antibody valence of the glass plate reaches 1: 200. While the negative control strain SE1H-pBR322 gave a negative agglutination test. The results show that the carrier bacterium Escherichia coli SE1H expresses and carries the swine Escherichia coli K88ac antigen factor on the surface of the carrier bacterium Escherichia coli SE 1H.

(VI) Transmission Electron microscopy

The recombinant vector bacterium SE1H-K88ac is statically cultured in LB culture solution for 24 hours, then is centrifuged and washed twice by PBS solution, a small amount of bacterium liquid is absorbed to float on a copper net, phosphotungstic acid is negatively stained for 5min, and Philips Tecnai12-twin transmission electron microscope is used for observation and photographing. Meanwhile, a pBR322 carrying empty vector strain SE1H-pBR322 is used as a negative control.

The surface of the recombinant vector strain SE1H-K88ac is shown to be provided with a plurality of pili by transmission electron microscope observation after negative staining, and the pili of the recombinant vector strain are compact and slender, which indicates that the pili expression in the recombinant strain is better (figure 10).

Identification of pili

Extracting pili of recombinant vector bacteria SE1H-K88ac and Escherichia coli K88ac reference strains: centrifuging the culture solution and washing with PBS twice by a thermal extraction method, suspending with 0.05M Tris-HCl (pH7.4) -1M NaCl (pH7.4-7.6) low-salt solution, treating with water bath at 60 ℃ for 30 minutes, centrifuging at 8000rpm for 20min to separate pilin, adding saturated ammonium sulfate to obtain precipitate with the final concentration of 25%, purifying the pilin, and storing at4 ℃.

Recombinant vector bacteria SE1H-K88ac and Escherichia coli K88ac reference strains purify pilus SDS-PAGE and Westernblot by 12% SDS-PAGE according to relevant literature to prepare 12% separation gel and 5% concentration gel, mixing the purified pilus supernatant with 5 × SDS sample buffer solution, boiling the mixture in boiling water for 8min to denature protein, loading the sample in each well to 20. mu.L, polyacrylamide gel electrophoresis, constant pressure of 100V, 4H, Coomassie brilliant blue R250 staining to observe the size of the main structural protein band of the expressed pilus, transferring the protein band in the gel to nitrocellulose membrane by BIO-RAD protein band transfer system, defatting at constant current of 300mA for 2H, sealing the NC membrane with 10% PBS after finishing the transfer, washing at4 ℃ overnight for 3 times by PBST, putting the NC membrane washed by PBST into 1: 400 diluted monoclonal antibody of mouse anti-K88 pilus, acting at 37 ℃ for 2H, washing 3 times by PBST, transferring DAB into 1min, washing mouse anti-K88 pilus monoclonal antibody at 37 ℃ for 2H, preparing fresh HRP at 10 mg, and washing at 35 mg (PBST) for 2H, transferring the mouse anti-IgG) after washing at 1H, preparing the mouse anti-IgG, and preparing the anti-K antibody (PBST for 2H) after each time of 2 mg)₂O₂) The reaction was stopped with distilled water until the band became clear.

The SDS-PAGE result shows that a main structural protein band at 26KD is derived from the separated and purified recombinant strain SE1H-K88ac, the size of the subunit of the main structural protein of the pilus is consistent with that of the K88ac pilus expressed by fae, and the size of the main structural protein band of the pilus is consistent with that of the pilus separated and purified by heat extraction of a prototype strain C83902 of Escherichia coli K88ac, while the heat extraction product of a negative control strain SE1H-pBR322 is identified by SDS-PAGE to have no corresponding band at 18.5 KD. Western blot immunoblotting results show that the murine anti-K88 ac pilus monoclonal antibody can specifically recognize pilus main structural protein bands expressed by recombinant strain SE1H-K88ac and Escherichia coli K88ac prototype strains, but cannot recognize a hot extraction product of a negative control strain SE1H-pBR322, and the results also show that the recombinant strain SE1H-K88ac is expressed on the surface of the bacterial body and carries bovine Escherichia coli K88ac antigen factors.

Example 6: test verification of surface expression of carrier bacterium escherichia coli carrier SE1H and carrying of humanized salmonella antigen factor I

According to the genome sequence full length disclosed in NCBI GenBank, Salmonella enteritidis NCTR380 strain whole genome sequence (NCBI accession number: NZ _ NQWN00000000.1), Salmonella enteritidis 219/11 strain whole genome sequence (NCBI accession number: NZ _ QRCP00000000.1), Salmonella enteritidis BCW _4356 strain whole genome sequence (NCBI accession number: NZ _ MYTC00000000.1), Salmonella enteritidis 92-0392 strain whole genome sequence (NCBI accession number: NZ _ CP018657.1) and Salmonella enteritidis N152 strain whole genome sequence (NCBI accession number: NZ _ PHGY00000000.1), searching the human salmonella operon Fim gene full length fragment of antigenic factor I (I type pilus), designing PCR amplification primer, and adding restriction enzyme BamHI, NheI enzyme cutting site and protective base at the 5' end of the upper and the lower primers, respectively: FimA-H UP 1: 5'-AT GAA AAT TAA AAC TCT GG-3' FimA-H LO 1: 5'-TTA TTG ATA AAC AAAAGT CAC-3', using a human salmonella enteritidis reference strain C50336 chromosome DNA template, and using longPCR high-fidelity DNA polymerase of Roch company of Germany, PCR amplification products are recovered and purified by an agarose gel recovery kit. Extracting pBR322 expression plasmid with plasmid extracting kit, agarose gel electrophoresis and observation and identification of pBR322 plasmid and operon fim gene amplification product, double digestion of BamHI and NheI recovered agarose gel, phenol/chloroform extraction, ethanol precipitation and purification, mixing the PCR amplification product with pBR322 plasmid in the ratio of 3 to 1, connecting with T4 DNA ligase at 16 deg.c overnight, and converting electrically into competent cell of carrier bacterium Escherichia coli SE 1H. The specific operation is as follows: mixing a 2 mu L I-pBR322 plasmid mixture with 40 mu L SE1H electric transformation competent cells, carrying out ice bath at4 ℃ for 30min, adding the mixture into a Bio-Rad electrode cup, quickly absorbing a product into 1mL SOC culture medium after electric transformation, shaking at 37 ℃ for 4h, discarding supernatant at 4000rpm for 10min, reserving a little bottom liquid for resuspending an ampicillin plate, culturing at 37 ℃ and screening a colony of a putative positive recombinant carrier bacterium Escherichia coli 1H-I, extracting a recombinant plasmid, carrying out single enzyme digestion and double enzyme digestion through BamHI and NheI, carrying out agarose gel electrophoresis and observation and identification, and carrying out DNA sequencing verification on the recombinant plasmid pBR 322-I.

A single colony of recombinant vector bacteria SE1H-I containing pBR322-I is selected and inoculated in an LB culture medium containing 100 mu g/mL ampicillin, shaking culture is carried out at 37 ℃ overnight, 10 mu L of bacterial liquid is taken and respectively mixed with multiple antiserum (self-made in a laboratory) of equivalent mouse anti-I antigen factor (I type pilus), and the multiple antiserum is observed under light according to agglutination test reaction, and the result shows that the recombinant bacteria and the salmonella enteritidis reference strain C50336 can generate obvious agglutination reaction with the multiple antiserum of the mouse anti-I antigen factor (I type pilus). While the negative control strain SE1H-pBR322 agglutination test reaction was negative (FIG. 11). The agglutination test reaction result shows that the recombinant vector bacterium escherichia coli SE1H-I is expressed on the surface of the thallus and carries the human salmonella antigen factor I.

Selecting a single bacterial colony of pBR322-I recombinant vector bacteria SE1H-I to inoculate in an LB culture medium containing 100 mu g/mL ampicillin, after shaking culture at 37 ℃ overnight, selecting a single bacterial colony to inoculate in LB and ampicillin resistant LB liquid culture mediums respectively, placing in 37 ℃ to culture and shake culture for 12h and carrying out blind transfer for two generations, sucking a small amount of bacterial liquid to inoculate in LB and ampicillin resistant LB liquid culture mediums for standing culture for 48h respectively, centrifuging at 10000rpm for 2min, resuspending and precipitating with sterilized PBS, sucking a small amount of supernatant bacterial liquid to carry out negative staining, and observing by a transmission electron microscope. Transmission electron microscope observation and shooting of Philips Tecnai12 in the Netherlands show that the surface expression of the recombinant vector strain SE1H-I carries an I antigen component (I type pilus), while the surface expression of the negative control strain SE1H-PBR322 does not seem to see the I antigen factor component (I type pilus), which is shown in figure 12.

Sequence listing

<110> Yangzhou university

<120> generic inert vector escherichia coli and potential application thereof

<160>8

<170>SIPOSequenceListing 1.0

<210>1

<211>25

<212>DNA

<213>p-F(Artificial Sequence)

<400>1

atgaaacgtt cacttattcc tcctt 25

<210>2

<211>23

<212>DNA

<213>p-R(Artificial Sequence)

<400>2

ttaattataa gataccacca tta 23

<210>3

<211>35

<212>DNA

<213>FanBamUP (PBR)(Artificial Sequence)

<400>3

cacggatcct ggagaatcta gatgaaaaaa acact 35

<210>4

<211>37

<212>DNA

<213>FanSalLO (PBR)(Artificial Sequence)

<400>4

cgcgtcgact catataaatg ttacagtcac aggaagt 37

<210>6

<211>28

<212>DNA

<213>F(Artificial Sequence)

<400>6

caggctagca tgaaaaaagc attcttat 28

<210>6

<211>33

<212>DNA

<213>R(Artificial Sequence)

<400>6

cgggatcctc agaaatacac caccaccggt gtc 33

<210>7

<211>19

<212>DNA

<213>FimA-H UP1(Artificial Sequence)

<400>7

atgaaaatta aaactctgg 19

<210>8

<211>21

<212>DNA

<213>FimA-H LO1(Artificial Sequence)

<400>8

ttattgataa acaaaagtca c 21

Claims

1. A pan-type inert carrier Escherichia coli is characterized in that inert carrier bacteria SE1 are continuously cultured in vitro to passage to the fortieth generation or above by using LB liquid and a solid culture medium, and a strain obtained from the fortieth generation or above is named as pan-type inert carrier Escherichia coli SE 1H.

2. The method for obtaining inert vector Escherichia coli of the generic type according to claim 1, wherein the steps of the method are as follows: continuously culturing the inert carrier bacterium SE1 in vitro to a fourth generation or above by using LB liquid and a solid culture medium to obtain the pan-type inert carrier Escherichia coli SE 1H.

3. A detection system of pan-type inert carrier indirect agglutination test, characterized in that, the detection system comprises pan-type inert carrier Escherichia coli of claim 1 and a complex which can be expressed on the surface of its thallus and carries a specific antigen factor.

4. The detection system as claimed in claim 3, wherein the specific antigenic factors are one or more of avian-derived Salmonella P-factor, porcine-derived Escherichia coli K88ac antigenic factor, bovine-derived Escherichia coli K99 antigenic factor or human-derived Salmonella I antigenic factor.

5. The method for constructing a detection system for the pan-type inert carrier indirect agglutination test according to claim 3 or 4, comprising the steps of:

1) obtaining a coding gene of a specific antigen factor;

3) the recombinant plasmid is transformed into SE1H electric transformation competent cells to be identified to obtain a recombinant strain, namely a pan-type inert carrier indirect agglutination test detection system.

6. The method for constructing a pan-type inert carrier indirect agglutination test detection system according to claim 5, wherein the encoding gene of the specific antigen factor in step 1) is an encoding gene of a P-factor of Salmonella typhimurium, an encoding gene of a K88ac antigen factor of Escherichia coli of swine origin, an encoding gene of a K99 antigen factor of Escherichia coli of bovine origin or an encoding gene of an I antigen factor of Salmonella typhimurium of human origin.

7. Use of a pan-type inert carrier E.coli according to claim 1 or a detection system according to claim 3 for the preparation of an inert carrier for the detection of antigens in an indirect agglutination test or for the preparation of an inert carrier for the detection of antibodies in an indirect agglutination test.

8. Use of a pan-type inert carrier E.coli according to claim 1 or a detection system according to claim 3 for the preparation of a reagent or kit for indirect agglutination assays for the detection of antigens or antibodies.

9. Use of a pan-type inert carrier E.coli as claimed in claim 1 or a detection system as claimed in claim 3 in the preparation of a reagent or kit for detecting infection with pathogenic bacteria of human, bovine, porcine, murine or avian origin.

10. A test kit comprising a pan-type inert carrier E.coli according to claim 1 or a test system according to claim 3.