CN110257276A - A kind of inert carrier Escherichia coli and its potential application - Google Patents
A kind of inert carrier Escherichia coli and its potential application Download PDFInfo
- Publication number
- CN110257276A CN110257276A CN201910424381.9A CN201910424381A CN110257276A CN 110257276 A CN110257276 A CN 110257276A CN 201910424381 A CN201910424381 A CN 201910424381A CN 110257276 A CN110257276 A CN 110257276A
- Authority
- CN
- China
- Prior art keywords
- escherichia coli
- inert carrier
- chicken
- serum
- positive
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
- C12N1/20—Bacteria; Culture media therefor
- C12N1/205—Bacterial isolates
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/569—Immunoassay; Biospecific binding assay; Materials therefor for microorganisms, e.g. protozoa, bacteria, viruses
- G01N33/56911—Bacteria
- G01N33/56916—Enterobacteria, e.g. shigella, salmonella, klebsiella, serratia
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
- C12R2001/00—Microorganisms ; Processes using microorganisms
- C12R2001/01—Bacteria or Actinomycetales ; using bacteria or Actinomycetales
- C12R2001/185—Escherichia
- C12R2001/19—Escherichia coli
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
- G01N2333/195—Assays involving biological materials from specific organisms or of a specific nature from bacteria
- G01N2333/24—Assays involving biological materials from specific organisms or of a specific nature from bacteria from Enterobacteriaceae (F), e.g. Citrobacter, Serratia, Proteus, Providencia, Morganella, Yersinia
- G01N2333/245—Escherichia (G)
Abstract
The present invention relates to a kind of inert carrier Escherichia coli and its potential applications, have inert carrier characteristic based on the Escherichia coli separation strains, are expected to develop into a kind of carrier bacterium for indirect agglutination test.The inert carrier Escherichia coli have been preserved in China General Microbiological culture presevation administrative center (CGMCC), preservation address is BeiJing, China, deposit number is CGMCC No.17339, the deposit date is on March 18th, 2019, classification naming be escherichia coli (Escherichia coli), bacterial strain code name SE1.The Escherichia coli separation strains come from healthy chicken flock, from a variety of chicken sources serum of different genetic backgrounds any macroscopic agglutinating reaction does not occur for the bacterial number under higher working concentration, nonspecific agglutination is not generated with chicken source serum, our Escherichia coli are referred to as inert carrier Escherichia coli.The present invention provides a kind of inert carrier bacterium and its potential application for the easy quickly indirect agglutination detection method of exploitation.
Description
Invention field
The present invention is subordinate to field of biological technology detection, is related to a kind of inert carrier Escherichia coli, separation identification and its application,
Nonspecific agglutination does not occur in view of bacterial number of this carrier Escherichia coli under working concentration and chicken source serum
Characteristic and its provide one kind in the easy quickly exploitation of detection antigen or the indirect agglutination test detection method for infecting antibody
Inert carrier and have potential application foreground.
Background technique
Immunologic development provides many technical methods for clinically easy quickly detection pathogen, wherein agglutination test
It is current medicine, veterinary clinic using a kind of relatively broad tradition, classical epidemic disease fast diagnosis method, principle is thin
After the particulate antigens such as bacterium, red blood cell are in conjunction with corresponding antibody, in the presence of having electrolyte, there is mutually agglutination in antigen particles
Coacervation forms macroscopic agglutination fritter or particle.The antigen for participating in reaction is known as agglutinogen, and antibody is known as being aggregated
Element.Plate agglutination test is more common a kind of qualitative method in agglutinating reaction, and the diagnostic serum containing known antibodies is (suitable
When dilution) it respectively drips with bacteria suspension to be checked on clean transparent glass plate, after being gently mixed in equal volume, room temperature waits 2
In minute, such as there is macroscopic graininess agglutination, as positive reaction is usually used in the identification of bacterium and the parting of serotype
Deng.On the contrary, it is also possible to which known diagnostic antigen, which detects in serum or whole blood to be checked, whether there is corresponding antibodies, be usually used in Bu Shi bar
The glass plate agglutinating reaction of bacterium and white diarrhea/avian typhoid salmonella blood plate agglutination test etc..It is worth noting that, with latex
The inert carriers such as particle, the indirect agglutination to grow up on the basis of direct agglutination reaction expand detection application range
With the sensibility for increasing reaction.
Agglutination test be suitable for pathogen infection quick diagnosis, have it is simple and efficient, do not need additional expensive instrument, cost
It is cheap and can many merits such as on-the-spot test, but also occur some drawbacks and technical bottleneck in practical applications, such as with inspection
It surveys for white diarrhea/avian typhoid salmonella infection whole blood slide agglutination antigen, which detects in practical application
There is certain limitation, is reported there are a variety of cross reactions are obvious, each batch testing result is inconsistent, and weakly positive missing inspection etc. is more
Kind influences the factor of testing result, and the method, only to Adult Chicken group's detection effect rdativery sensitive, to chick, then there may be larger
Detection error.In early-stage study, chicken is most widely commercialized using current clinical application in laboratory where patent application inventor
Dysentery characterized by white mucous stool/avian typhoid salmonella dyeing agglutination antigen, detects in different time come from 200 parts of serum of certain chicken house with a batch in two times
Shi Faxian, the total coincidence rate of testing result is only 81%.It is compared with D groups of ELISA kits of salmonella of Dutch Biochek company
It is found when testing result, the total coincidence rate of testing result is only 79.5%, and positive coincidence rate (recall rate or sensibility) is 75.2-
79.4%, negative match-rate 79.5-85.5%.Above-mentioned testing result and comparative analysis show commercialization agglutination antigen detection
When white diarrhea/avian typhoid salmonella serum antibody, sensibility, specificity and result accuracy are not up to ideal water
It is flat, and every batch of testing result and it is unstable with it is consistent.In the S. pullonum system that application is separated from same chicken house
Discovery when standby oneself is aggregated antigen contrasting detection identical 200 parts of serum, testing result and salmonella D groups of ELISA reagents
The coincidence rate of box rises to 88% from 79.5%, and wherein positive coincidence rate (recall rate or sensibility) has been also raised to 97.5%,
The testing result that this result also demonstrates the antigen of commercialization agglutination at present exists to a certain degree or more apparent false positive is wrong
Inspection and false negative missing inspection.
It for agglutination antigen testing result accuracy Pinch technology to be improved and perfect, traces sth. to its source, is because of mesh
The preceding agglutination antigen applied to agglutination test is all full bacterium antigen, and ingredient is not single antigen, non-single-factor ingredient, but multiple
The bacteria particles antigen of Multiple components is closed, in theory, there is the non-spy with equal category, other kind section bacteriums and other ingredients
Anisotropic cross reaction, in view of agglutination antigen working concentration and bacterial number, which necessarily will affect or even more interferes significantly with
Detection and diagnosis is as a result, include screening white diarrhea animals showing positive as epidemic disease purification techniques based on the agglutination test on animal clinical
And eliminate and slaughter kind of a fowl, to influence the propulsion of epidemic disease clean-up effect and epidemic disease purification work.Therefore, if there is a kind of inertia carries
Body bacterium exists, and can select to substitute multicomponent full bacterium antigen work using the inert carrier bacterium for expressing single antigenic factor simultaneously
To be aggregated antigen, under the premise of reservation agglutinating reaction visual result, the advantages such as easy to operate, can accurately and perfectly improve solidifying
Collect antigen reactive specificity, improvement for the live fast diagnosis method of pathogen infection and before improving there is huge application
Scape.
Summary of the invention
Present invention aims at: it is specifically sensitive for there is an urgent need to improve and perfects on current medicine, veterinary clinic, and examine
The quick diagnosis that result is accurately and reliably aggregated antigen for pathogen infection and epidemic disease is surveyed, present invention separation identifies one plant of inertia
With chicken source serum nonspecific agglutination does not occur for carrier Escherichia coli, is based on the inert carrier bacterium, is expected to easy in exploitation
A kind of inert carrier bacterium and its potential application are provided in quick indirect agglutination detection method.
To achieve the above object, the invention provides the following technical scheme:
A kind of inert carrier Escherichia coli SE1 is preserved in China General Microbiological culture presevation administrative center (CGMCC),
Preservation address is BeiJing, China, and deposit number is CGMCC No.17339, and the deposit date is on March 18th, 2019, classification namings
For escherichia coli (Escherichia coli), bacterial strain code name SE1.
The carrier bacterium (i.e. inert carrier Escherichia coli) can cultivate in LB and EMB agar medium, culture
Method is as follows: it is lined in LB or EMB agar medium on a small quantity from picking in the strain of preservation, cultivation temperature is 37 DEG C,
Wherein in LB agar medium, canescence circular colonies can be formed after 37 DEG C of cultures；In eosin methylene blue agar plate, 37 DEG C
No metallic luster, black colonies can be formed after culture.
SE1 carrier bacterium SE1, PCR amplification knot are identified using the PCR primer of targeting E. coli species specificity uidA gene
(O157:H7 type Escherichia coli cause weak bacterial strain, missing by fruit and K12 colibacillus engineering type strain DH5 α, Escherichia coli EDL933
Eae with stx gene) stripe size is consistent.
Method (GB4789.38-2012) carries out indole to above-mentioned SE1 escherichia coli vector bacterium according to national standards
(indoles, I) test, methyl red (MR) test, VP test, citrate (C) are given birth to using test and five kinds of sugar fermentating tests
Change testing inspection and identification, as a result meets Escherichia coli biochemical character described in national standard method.
The inert carrier Escherichia coli are isolated from healthy chicken flock.
It is not present by the glass plate agglutination test verifying carrier bacterium bacteria suspension from coagulation phenomena, from different genetic backgrounds
Nonspecific agglutination do not occur for a variety of chicken sources serum, chicken source serum include but is not limited to SPF chicken serum, healthy chicken serum,
Chicken bacterium infection positive serum (such as: avian escherichia coli positive serum, salmonella positive serum, staphylococcus positive serum and
Pasteurella positive serum etc.), chicken parasitic infection positive serum (such as chicken coccidiasis positive serum, taeniasis positive serum
Deng), (such as: newcastle disease positive serum, bird flu positive serum, chicken Marek's disease are positive for chicken viral infection positive serum
Serum, Bursal Disease positive serum, chicken subtract egg drop syndrome positive serum, the avian encephalomyclitis virus infection positive
Serum etc.) and various kind chicken seras, the agglutinating reaction result of detection is all negative.
Bacterial number of the inert carrier Escherichia coli under working concentration not with O1 type coli-infection SPF chicken
It is anti-that nonspecific agglutination occurs for serum, O2 type coli-infection SPF chicken serum and O78 type coli-infection SPF chicken serum
It answers；And K12 colibacillus engineering type strain DH5 α, Escherichia coli EDL933 (O157:H7 type Escherichia coli) etc. can with it is upper
It states coli-infection SPF chicken serum and agglutinating reaction occurs.
Compared with prior art, characteristic advantages of the invention are:
One plant of inert carrier coli strain SE1 provided by the invention, bacterial number of the bacterial strain under working concentration
Agglutinating reaction does not occur with chicken source serum, is based on the inert carrier bacterium, is provided for the easy quickly indirect agglutination detection method of exploitation
A kind of inert carrier bacterium and its potential application, the agglutination test of existing agglutination antigen and antibody of innovative improve and perfect
Specific bottleneck, be expected to the development and application as novel detection reagent, and there are huge application value and market prospects.
Detailed description of the invention
The bacterium colony shape of Fig. 1 inert carrier Escherichia coli SE1 and Escherichia coli type strain EDL933 on LB agar medium
State；
Fig. 2 inert carrier Escherichia coli SE1 and Escherichia coli type strain EDL933 are on EMB agar medium
Colonial morphology；
Fig. 3 is the application inert carrier Escherichia coli SE1 species specificity PCR qualification figure, and swimming lane 1-5 is respectively as follows:
Marker, Escherichia coli SE1, Escherichia coli EDL933, bacillus coli DH 5 alpha and salmonella negative control；
A kind of inert carrier Escherichia coli are deposited in China General Microbiological culture presevation administrative center (CGMCC), preservation
Address is BeiJing, China, and deposit number is CGMCC No.17339, and the deposit date is on March 18th, 2019, and classification naming is big
Intestines Escherichia (Escherichia coli), bacterial strain code name SE1.
Specific embodiment
Below with reference to embodiment, the invention will be further described.Embodiment is intended to carry out citing description to the present invention, and
It is non-to limit the invention in any form.
Embodiment 1: the separation identification of Escherichia coli SE1
It is strong that a jiangsu wuxi Mashan Yang Qin group laying hen poultry-farm 2 and 4 is originated from from acquisition on October 18th, 2016
The 360 age in days health laying hens of health chicken group, are put in super-clean bench, with alcohol to chicken body surface sterilization, sterile liver, the spleen for taking out chicken
The organ-tissues such as dirty, enteron aisle, are placed in sterile petri dish, shred tissue simultaneous grinding, suck homogenate after weighing sterile
It is stand-by in test tube.It weighs and 37 DEG C of mistakes in BPW is added in the tissue sample of acquisition after buffered peptone water (BPW) high pressure sterilization dispenses
Night culture.It draws 1mL and examines 37 DEG C of Zengjing Granules in meat soup (EC meat soup) in Escherichia coli, 20 μ L are drawn after being incubated overnight and increase bacterium
In 37 DEG C of scribing line cultures on maconkey agar culture medium, the bacterium colony of picking suspicious characteristic is crossed in eosin methylene blue agar to be cultivated liquid,
Black purple single colony is in pure in 37 DEG C of purifying cultures of LB agar medium, picking LB agar medium on picking eosin methylene blue agar
Change culture single colonie and be inoculated in LB liquid medium, suspicious E. coli clones pass through further biochemical identification and species specificity
PCR identification.
Take the above-mentioned SE1 bacterium solution being incubated overnight of 1mL with boiling legal system DNA profiling.Using PCR amplification Escherichia coli β-grape
Uronic acid saccharides glycoside enzyme gene uidA, 1.5% gel electrophoresis identification, target fragment size are 162bp；Bibliography synthetic primer sequence
It arranges as follows: F:5 ' TGGTAATTACCGACGAAAACGGC 3 ' (SEQ ID NO.1)；R:5′ ACGCGTGGTTACAGTCTTGCG
3′(SEQ ID NO.2)；20 μ L of reaction system includes 2 × Taq Master Mix (Dye Plus) 10 μ L, uidA-F/R (10 μ
M) each 1 μ L, 2 μ L of DNA profiling, sterilizing 6 μ L of ultrapure water supply 20 μ L；PCR reaction condition after optimization: 94 DEG C of 5min；94℃
30s, 60 DEG C of 30s, 72 DEG C of 30s carry out 30 circulations；72℃10min.SE1 can be amplified and Escherichia coli mark as the result is shown
Quasi- strain EDL933 (O157:H7 type Escherichia coli cause weak bacterial strain, lack eae and stx gene), bacillus coli DH 5 alpha are of the same size
Band (Fig. 3).
Commodity in use micro biochemical pipe carries out indole (indoles, I) test, methyl red (MR) to inert carrier bacterium SE1
Test, VP test and citrate (C) carry out biochemical identify using test and carry out indole test, MR-VP test and citric acid
Salt carries out biochemical identification using test, carries out interpretation of result judgement according to micro biochemical pipe specification, as a result meets national standard
Escherichia coli biochemical characteristic (table 1) described in method (GB4789.38-2012).The above results show that we separate and identify
One plant of Escherichia coli, is named as SE1.
Table 1:SE1 biochemical characteristic
Note: "-" indicates negative；"+" indicates positive.
Embodiment 2: inertia Escherichia coli SE1 does not generate the verifying of nonspecific agglutination phenomenon with chicken source serum
4 DEG C of centrifuge 4000rpm of the inert carrier bacterium SE1 being incubated overnight are centrifuged l0min respectively, supernatant are abandoned, with nothing
Bacterium PBS is resuspended centrifuge washing and is resuspended afterwards three times to different working concentration bacterial number gradients.By bacterium solution vortex instrument before detection
It mixes, first carrying out agglutination test with sterile PBS and SPF chicken serum ensures that bacterium solution nonspecific agglutination occurs without self-solidifying and not and shows
As.(20-25 DEG C) takes several pieces of the common glass plate of clean surface in super-clean bench, with the sterile pre- PBS for being cooled to 4 DEG C by carrier bacterium from
The heart is resuspended after being resuspended washing 3 times and is diluted to prescribed bacteria concentration.The load of an about 10 μ L working concentrations of drop is drawn with micropipettor
Body bacterium is vertically dripped on horizontal positioned glass plate surface.The serum to be checked of equivalent is then added dropwise rapidly.With sterilizing pipette tips by bacterium solution
It is sufficiently mixed after the sheet for being uniformly coated into diameter 1-2cm with serum and steadily shakes glass plate immediately, it is i.e. considerable generally in 2min
Examine test result.Standard determination situation is in 2min at room temperature, generating cotton-shaped or graininess naked eyes with bacterium solution and serum to be checked can
See that reaction result is determined as the positive by precipitating, is otherwise determined as feminine gender.
The results show that under the conditions of various concentration (hundred million CFU/mL of 5-100), inertia escherichia coli vector bacterium SE1 does not go out
Now from coagulation phenomena, and a variety of chicken source serum of different background: SPF chicken serum, healthy chicken serum, chicken bacterial infection positive serum,
Chicken parasitic infection positive serum, chicken virus infection positive serum and multi items chicken sera, the agglutinating reaction knot of detection
Fruit is all negative (table 2), illustrates that nonspecific agglutination does not occur for inertia Escherichia coli SE1 and chicken source serum, regards as lazy
Property carrier bacterium.
The SE1 bacteria suspension and chicken source agglutination reaction of serum result of 2 various concentration of table
Note: "-" indicates negative；"+" indicates positive
Describe the basic principle of the present application, the main diagnostic characteristics of inert carrier bacterium SE1 and to sum up with the inertia
A kind of inert carrier that carrier bacterium provides in the exploitation of indirect agglutination test detection method and the potential application foreground having.This
The technical staff of industry is described in the above embodiment and specification it should be appreciated that the present invention is not limited to the above embodiments
The principle for only illustrating the present application, under the premise of not departing from function of the present invention, principle and range, the present invention can also be continuous
Improve and perfect, these, which are improved, requires in the protection scope of the invention.The claimed scope of the invention is wanted by appended right
Ask book and its equivalent thereof.
Sequence table
<110>Yangzhou University
<120>a kind of inert carrier Escherichia coli and its application
<130> xhx2019052101
<141> 2019-05-21
<160> 2
<170> SIPOSequenceListing 1.0
<210> 1
<211> 23
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 1
tggtaattac cgacgaaaac ggc 23
<210> 2
<211> 21
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 2
acgcgtggtt acagtcttgc g 21
Claims (8)
1. a kind of inert carrier Escherichia coli, it is characterised in that: be deposited in China General Microbiological culture presevation administrative center
(CGMCC), preservation address is BeiJing, China, and deposit number is CGMCC No.17339, the deposit date is on March 18th, 2019,
Classification naming is escherichia coliEscherichia coli, bacterial strain code name SE1.
2. inert carrier Escherichia coli according to claim 1, it is characterised in that: the inert carrier Escherichia coli energy
It is cultivated in LB agar medium and/or EMB agar medium；It, can after 37 DEG C of cultures wherein in LB agar medium
Form canescence circular colonies；In eosin methylene blue agar plate, no metallic luster, black colonies can be formed after 37 DEG C of cultures.
3. inert carrier Escherichia coli according to claim 1, it is characterised in that: with inert carrier Escherichia coli or its base
Because group DNA is template, purpose band can be gone out with E. coli species primer amplified；The inert carrier Escherichia coli
Biochemical character it is consistent with typical Escherichia coli, indole test is positive, and methyl red test is positive, VP negative, citric acid
Salt utilizes negative, and glucose fermentation produces acid and produces gas, and lactose, maltose, mannose, sucrose are positive.
4. inert carrier Escherichia coli according to claim 1, it is characterised in that: the inert carrier Escherichia coli are not
In the presence of from coagulation phenomena, nonspecific agglutination does not occur from a variety of chicken sources serum of different genetic backgrounds, chicken source serum includes
But it is not limited to SPF chicken serum, healthy chicken serum, chicken bacterium infection positive serum, chicken parasitic infection positive serum, chicken viral
Positive serum and various kind chicken seras are infected, agglutinating reaction result is all negative.
5. inert carrier Escherichia coli according to claim 1, it is characterised in that: the inert carrier Escherichia coli from
Healthy chicken flock is isolated.
6. inert carrier Escherichia coli described in claim 1 are used as inertia in the indirect agglutination test of detection antigen or antibody
The application of carrier.
7. inert carrier Escherichia coli described in claim 1 are as the indirect agglutination test reagent of detection antigen or antibody
Using.
8. the purposes that inert carrier Escherichia coli described in claim 1 use reagent as the detection of chicken correlation pathogen infection.
Priority Applications (3)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910424381.9A CN110257276B (en) | 2019-05-21 | 2019-05-21 | Inert carrier escherichia coli and potential application thereof |
| PCT/CN2020/071625 WO2020233147A1 (en) | 2019-05-21 | 2020-01-13 | Inert carrier escherichia coli and potential use thereof |
| AU2020210232A AU2020210232A1 (en) | 2019-05-21 | 2020-01-13 | Inert vector Escherichia coli and potential use thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910424381.9A CN110257276B (en) | 2019-05-21 | 2019-05-21 | Inert carrier escherichia coli and potential application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN110257276A true CN110257276A (en) | 2019-09-20 |
| CN110257276B CN110257276B (en) | 2020-03-24 |
Family
ID=67914956
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910424381.9A Active CN110257276B (en) | 2019-05-21 | 2019-05-21 | Inert carrier escherichia coli and potential application thereof |
Country Status (3)
| Country | Link |
|---|---|
| CN (1) | CN110257276B (en) |
| AU (1) | AU2020210232A1 (en) |
| WO (1) | WO2020233147A1 (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111537712A (en) * | 2020-05-12 | 2020-08-14 | 扬州大学 | Inert carrier indirect agglutination test detection system and application thereof |
| CN111560341A (en) * | 2020-05-19 | 2020-08-21 | 扬州大学 | Generic inert vector escherichia coli and potential application thereof |
| WO2020233147A1 (en) * | 2019-05-21 | 2020-11-26 | 扬州大学 | Inert carrier escherichia coli and potential use thereof |
| WO2021232799A1 (en) * | 2020-05-19 | 2021-11-25 | 扬州大学 | Generic inert carrier salmonella and potential use thereof |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20040052802A1 (en) * | 2000-11-16 | 2004-03-18 | Nuijten Petrus Johannes Maria | Salmonella vaccine |
| CN104004698A (en) * | 2014-06-11 | 2014-08-27 | 河北科星药业有限公司 | Escherichia coli and preparation method thereof |
| CN109486714A (en) * | 2018-12-07 | 2019-03-19 | 扬州大学 | A kind of weak malicious separation strains of avian infectious bronchitis nephritis virus and its application |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110257276B (en) * | 2019-05-21 | 2020-03-24 | 扬州大学 | Inert carrier escherichia coli and potential application thereof |
-
2019
- 2019-05-21 CN CN201910424381.9A patent/CN110257276B/en active Active
-
2020
- 2020-01-13 WO PCT/CN2020/071625 patent/WO2020233147A1/en active Application Filing
- 2020-01-13 AU AU2020210232A patent/AU2020210232A1/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20040052802A1 (en) * | 2000-11-16 | 2004-03-18 | Nuijten Petrus Johannes Maria | Salmonella vaccine |
| CN104004698A (en) * | 2014-06-11 | 2014-08-27 | 河北科星药业有限公司 | Escherichia coli and preparation method thereof |
| CN109486714A (en) * | 2018-12-07 | 2019-03-19 | 扬州大学 | A kind of weak malicious separation strains of avian infectious bronchitis nephritis virus and its application |
Non-Patent Citations (3)
| Title |
|---|
| A. FROMMER等: "Experimental vaccination of young chickens with a live non pathogenic strain of Escherichia coli", 《AVIAN PATHOLOGY》 * |
| TA ABDUL-AZIZ AND SN EI-SUKHON: "Serum sensitivity and apathogenicity for chickens and chick embryos of Escherichia coli J5 strain", 《VETERINARY RESEARCH》 * |
| 杨宏禹: "鸡大肠埃希氏菌病原学及其疫苗的研究进展", 《专论与综述》 * |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2020233147A1 (en) * | 2019-05-21 | 2020-11-26 | 扬州大学 | Inert carrier escherichia coli and potential use thereof |
| CN111537712A (en) * | 2020-05-12 | 2020-08-14 | 扬州大学 | Inert carrier indirect agglutination test detection system and application thereof |
| CN111560341A (en) * | 2020-05-19 | 2020-08-21 | 扬州大学 | Generic inert vector escherichia coli and potential application thereof |
| WO2021232800A1 (en) * | 2020-05-19 | 2021-11-25 | 扬州大学 | Generic inert carrier escherichia coli and potential use thereof |
| WO2021232799A1 (en) * | 2020-05-19 | 2021-11-25 | 扬州大学 | Generic inert carrier salmonella and potential use thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| WO2020233147A1 (en) | 2020-11-26 |
| CN110257276B (en) | 2020-03-24 |
| AU2020210232A1 (en) | 2020-12-10 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110257276A (en) | A kind of inert carrier Escherichia coli and its potential application | |
| CN110218668B (en) | Inert carrier salmonella and potential application thereof | |
| CN104628833B (en) | A kind of tuberculosis infection cellular immunization detectable antigens composition and application thereof | |
| Hopwood et al. | Use of the Pastorex aspergillus antigen latex agglutination test for the diagnosis of invasive aspergillosis. | |
| CN111537712B (en) | Inert carrier indirect agglutination test detection system and application thereof | |
| CN105527442B (en) | A kind of hog cholera antibody detecting system and preparation method thereof | |
| CN106771260A (en) | Detect the indirect ELISA reagent kit and its detection method of the type aviadenovirus antibody of serum 4 | |
| CN104450940B (en) | A kind of nucleotide sequence and detection method and detection kit for detecting Listeria Monocytogenes | |
| US20230193194A1 (en) | Generic inert bio-vector salmonella sp. and potential uses thereof | |
| CN104789500A (en) | Pullorum staining agglutination antigen as well as preparation method and application thereof | |
| CN113265358B (en) | Salmonella pullorum and mycoplasma synoviae double plate agglutination antigen and preparation method and application thereof | |
| CN105936935B (en) | PCR detection kit for rapidly identifying specific serotype salmonella | |
| Cory et al. | Plaque assay of rickettsiae in a mammalian cell line | |
| CN107759674A (en) | A kind of Mycoplasma bovis immune-related albumen, the detection kit containing the albumen and its purposes in Mycoplasma bovis antibody test | |
| CN111560341B (en) | Generic inert vector escherichia coli and potential application thereof | |
| CN103243077A (en) | Avian leukosis P27 monoclonal antibody hybridoma cell strain and application thereof | |
| CN109187970B (en) | It is a kind of quickly to detect aquatic products disease gold mark nucleic acid test strip and preparation method thereof | |
| Pearson et al. | Diagnostic procedures for avian influenza | |
| CN104628834B (en) | A kind of tuberculosis infection T cell immunodetection antigen and application thereof | |
| Smith et al. | Bacteriological and serological diagnosis of salmonellosis of fowls | |
| Rhoades | A hemagglutination-inhibition test for Mycoplasma meleagridis antibodies | |
| CN116790451B (en) | Antigen and kit for detecting duck-origin salmonella enteritidis antibody and preparation method thereof | |
| CN103388031A (en) | Food-microorganism detecting method with combination of nonspecific amplification and multi-point RTQ-PCR (Real-Time Quantitative Polymerase Chain Reaction) | |
| Woode et al. | Metabolic and growth inhibition of Mycoplasma gallisepticum by antiserum | |
| RU2063769C1 (en) | Method of preparing specific salmonellosis polyvalent h-serum for accelerated salmonella detection in foodstuffs, fodder, environment object and clinical material |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |