CN104004698A - Escherichia coli and preparation method thereof - Google Patents
Escherichia coli and preparation method thereof Download PDFInfo
- Publication number
- CN104004698A CN104004698A CN201410260536.7A CN201410260536A CN104004698A CN 104004698 A CN104004698 A CN 104004698A CN 201410260536 A CN201410260536 A CN 201410260536A CN 104004698 A CN104004698 A CN 104004698A
- Authority
- CN
- China
- Prior art keywords
- escherichia coli
- iss
- pegx
- colon bacillus
- preparation
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention belongs to microbial strains and preparation methods of the microbial strains, and particularly relates to Escherichia coli and a preparation method of the Escherichia coli. A cloned iss gene segment in outer membrane protein of Escherichia coli pathogenic bacteria of a coded bird is regrouped in an expression plasmid pEGX-6p-1 after BamHI and SalI double enzyme digestion, and a pronucleus expression plasmid pEGX-6p-1/iss is built; the pronucleus expression plasmid pEGX-6p-1/iss is transformed into Escherichia coli BL21-DE3, and regrouped Escherichia coli BL21-DE3/pEGX-6p-1/iss is built. The technical problem that the vaccine broad-spectrum performance is poor in the prior art is solved. The Escherichia coli has the advantages of being good in broad spectrum performance, good in immune effect, wide in industrialized development prospect and the like.
Description
Technical field
The invention belongs to microbial strains and preparation thereof, refer to especially a kind of colon bacillus Escherich ia coli and preparation method thereof.
Background technology
Colibacillosis is the disease general name being caused by some pathogenic serological type strain of intestinal bacteria Erichsen bacterium.Avian colibacillosis refers to partly or entirely the disease by the caused part of fowl pathogenic colon bacillus (APEC) or systemic infection, comprise e. coli septicemia, escherichia coli granuloma (Hjarre disease), airsac disease (chronic respiratory tract disease is CRD), escherichia coli phlegmon (being inflammatory process), swollen head sydrome, escherichia coli peritonitis, escherichia coli salpingitis, escherichia coli osteomyelitis/synovitis (being turkey osteomyelitis syndrome), escherichia coli panophthalmitis and escherichia coli omphalitis/yolk sac infects.Intestinal bacteria mainly cause intestinal tract disease Mammals, and receive highly pathogenic coli-infection and make its defence capability be not enough to opposing or while completely losing, often can cause typical Secondary cases part or systemic infection when bird.Colibacillosis has caused serious loss to aviculture, is disease and the discarded major cause of ketoboidies of the most often reporting in poultry diease investigation.Have data show: in poultry meat processing 43% broiler chicken ketoboidies scrap relevant with e. coli septicemia.
Prior art is mainly by utilizing the antibacterial treatment of usually carrying out pathogenic colon bacillus, but due to antibiotic abuse, along with the enhancing of bacterial drug resistance, colibacillosis is also more and more difficult to control.Consider from food safety angle, cause the probability of the population infection colibacillosis that directly eats these fowl domestic animals products to increase.Antibiotic consumption is increasing, causes agricultural-food medicine residual to increase, and causes edible a large amount of cultivation medication of people's indirect, and this all causes a hidden trouble to human health.Traditional vaccine is all by changing culture condition in addition, or the way going down to posterity on different host animals makes the perform toxic attenuation of pathogenic microorganism; Or by physicochemical method by they deactivations.But such vaccine is all undesirable, become poisonously because the bacterial strain weakening may reverse mutation occur, or lose immunogenicity, the unsuitable vaccine of deactivation also can cause the popular of disease.Therefore, in the urgent need to developing a kind of more broad-spectrum vaccine of escherichia coli disease of performance that prevents.
There are some researches show, the outer membrane protein of avian escherichia coli all plays an important role at pathogenic and immunology.Zhao Xiangru (Zhao Xiangru; Yang Hanchun. the research of different serotypes avian escherichia coli outer membrane protein immunogenicity. the special journal .1999 of Zhangjiakou agriculture; the 15th volume the 4th phase: 4-6.) and the research of Yang Hanchun show the outer membrane protein immunity that different serotypes avian escherichia coli mixes; no matter the attack to homotype or special-shaped bacterial strain, has certain provide protection.Li Xiaoxia (Li Xiaoxia; Qiu Yuyu; Wang Hairong. enteropathogenic Escherichia coli outer membrane protein immunoprotection Journal of Sex Research. Chinese Journal of Immunology .2007, the 23rd volume the 4th phase: 394-397.), the research of Qiu Yuyu shows that enteropathogenic Escherichia coli outer membrane protein can induce rabbit to colibacillary specific humoral immunity and cellullar immunologic response.
Iss gene (increased serum survival gene) in fowl pathogenic colon bacillus is an important factor that affects avian Escherichia coli bacteria strain complement resistance, the albumen iss of iss genes encoding belongs to outer membrane protein, relevant with bacterium anticomplementary action.There are some researches show, after fowl source intestinal bacteria iss gene is positioned at protokaryon ribosome bind site, the outer membrane protein of its coding has 102 amino acid, be about 11kD, acid is had to resistance, wherein 17-22 amino acids has formed signal peptide (the Johnson T J of iss albumen, Giddings C W, Horne S M, et a.l Location of increased serum survivalgene and selected virulence traits on a conjugative R plasmid in an avian Escherichia coli isolate.Avian Dis, 2002, 46 (2): 342-352.Nolan LK, GiddingsC W, Horne SM, et a.l Complement resistance, as determined by viable count and flow cytometric methods, and its associationwith the presence of iss and the virulence ofavian Escherichia coli.Avian Dis, 2002, 46 (2): 386-392.Chuba P J, Leon M A, Banerjee A, et a.l Cloning and DNA sequence ofplasmid determinant iss, coding for increased serum survival and surface exclusion, which has homologywith lambda DNA.MolGen Genet, 1989, 216 (2-3): 287-292.).By inference, iss albumen is by regulating the site to complement MAC sensitivity on cell surface, cause exclusion, make bacterial strain there is ability (the Nolan LK of antiserum(antisera) complement bacteriolysis, GiddingsC W, Horne SM, et a.l Complement resistance, as determined by viable count and flow cytometric methods, and its associationwith the presence of iss and the virulence ofavian Escherichia coli[J] .Avian Dis, 2002, 46 (2): 386-392.Chuba P J, Leon M A, Banerjee A, et a.l Cloning and DNA sequence ofplasmid determinant iss, coding for increased serum survival and surface exclusion, which has homologywith lambda DNA.MolGen Genet, 1989, 216 (2-3): 287-292.Dho-Moulin M, Fairbrother.Avian pathogenic Escherichia coli (APEC) .JVetRes, 1999, 30 (2-3): 299-316.WooleyR E, SpearsK R, Brown J, et a.l Relationship of complement resistance and selected virulence factors in pathogenic avian Escherichia coli.Avian Dis, 1992, 36 (3): 679-684.).In bibliographical information, there is iss gene prokaryotic product GST-Iss fusion rotein antiserum(antisera) to weaken the seroresistance of bacterial strain; to the strong virulence strain of intestinal bacteria HO2 have suppress increment or killing action (immanoprotection action of chicken source pathogenic colon bacillus iss gene protokaryon product. herding and animal doctor; 2010; (42) 11:84-86. Fan Chen; Liu Guiqin; Wang Yu, Li Dandan, Li Yijing).
Summary of the invention
The object of the present invention is to provide colon bacillus Escherichia coli and preparation method thereof, this colon bacillus has better broad spectrum and immune effect.
Overall technology design of the present invention is:
A kind of colon bacillus Escherichia coli, its deposit number is CGMCC No.8574.
The colon bacillus (Escherichia coli) relating in the present invention, applicant has submitted the center preservation of microbial strains preservation management committee's common micro-organisms on December 13rd, 2013, the address of this depositary institution is positioned at No. 3, Yard 1, BeiChen xi Road, Chaoyang District, Beijing City Institute of Microorganism, Academia Sinica, this preservation mechanism referred to as CGMCC.
Applicant has carried out correlation test to the colon bacillus Escherichia coli CGMCC No.8574 relating in the present invention, finds that it has following physicochemical property:
1, on Yihong methylene blue substratum 37 DEG C, cultivate 16-18 hour, form pink, or the bacterium colony of dark pink gloss, neat in edge, colony diameter 1-3mm.
2, there is amicillin resistance.
3, cultivate and produce sour aerogenesis by glucose at 37 DEG C.
4, the pectinose that can ferment.
5, can fermentating maltose.
The preparation method of colon bacillus Escherichia coli, by the iss gene fragment through clone in coding avian colibacillosis pathogenic bacteria outer membrane protein, through being reconstituted in expression plasmid pEGX-6p-1 after BamH I and Sal I double digestion, build prokaryotic expression plasmid pEGX-6p-1/iss; Prokaryotic expression plasmid pEGX-6p-1/iss is transformed in e. coli bl21-DE3, builds recombination bacillus coli BL21-DE3/pEGX-6p-1/iss.
Concrete technology step of the present invention and processing condition also have:
The preparation method of colon bacillus Escherichia coli, comprises following processing step:
A, cultivation O2 serotype intestinal bacteria;
B, O2 serotype escherichia coli plasmid extract and purifying;
C, pcr amplification iss fragment;
D, construction expression plasmid vector pEGX-6p-1/iss;
E, screening positive strain.
Cultivation in described steps A can adopt LB liquid nutrient medium, and culture condition is 37 DEG C of temperature, 150 revs/min of rotating speeds, 18 hours cycles.
Cultivation in described steps A can also be selected and be adopted LB solid medium, and culture condition is 37 DEG C of temperature, 18 hours cycles.
In described step B, extract O2 serotype colibacillary plasmid with plasmid extraction kit, purify the colibacillary plasmid DNA of O2 serotype with quick glue recovery test kit.
Described step C step C is with 5 ＇-cgc
ggatccaggattctgccgttttta-3 ＇ is upstream primer P1, and BamH I restriction enzyme site is underscore part in P1; With 5 ＇-cgc
gtcgaccatatcgatgggcaacta-3 ＇ is downstream primer P2, and Sal I restriction enzyme site is underscore part in P2, taking the colibacillary plasmid DNA of O2 serotype after purifying in step B as template, adopts pcr amplification iss fragment.
In described step C, PCR reaction system is as follows:
PCR reaction conditions is: 94 DEG C of denaturations 5 minutes, 94 DEG C of sex change 1 minute; Anneal 30 seconds for 57 DEG C, 72 DEG C are extended 1 minute, 30 circulations; 72 DEG C were extended after 10 minutes, and PCR product is placed in 4 DEG C of Refrigerator stores.
Described step D comprises following processing step:
D1, utilize double digestion method, enzyme to cut goal gene PCR product fragment, and purified pcr product endonuclease bamhi;
D2, utilize double digestion method, enzyme is cut pEGX-6p-1, and purifying pEGX-6p-1 endonuclease bamhi;
D3, connection construction expression plasmid vector pEGX-6p-1/iss.
In step D3, linked system is as follows:
Ligation process is as follows:
D3-1:16 DEG C is reacted 30 minutes;
D3-2: full dose is added in 50 μ L competent cell BL21-DE3, is placed in ice 30 minutes;
D3-3:42 DEG C of heating, after 90 seconds, is placed in ice 2 minutes;
D3-4: add 500 μ LLB non-resistant substratum, shaking culture 60 minutes under 37 DEG C, 150 revs/min conditions;
D3-5: cultivate on the LB Agar Plating that contains kantlex, form single bacterium colony.
For the colibacillary immune effect that proves to obtain in the present invention, applicant has carried out following experiment:
(1) 110 the SPF chickens of feeding carry out immunity and attack poison experiment, are divided at random 11 groups, 10 every group, are respectively: 1-11 group according to numbering in passing;
(2) 1,2 groups is blank group, and 2 groups are attacked malicious serotype at the left back torso bag of 14 age in days is O1 type fowl pathogenic colon bacillus pathogenic bacteria, 1 × 10
7individual/plumage;
(3) 3 groups at 7 age in days subcutaneous injections immunity O2 deactivation vaccines, and it is O1 type fowl pathogenic colon bacillus pathogenic bacteria that the left back torso bag of 14 age in days is attacked malicious serotype, and 1 × 10
7individual/plumage;
(4) 4-11 group is in 7 age in days drinking-water BL21-DE3/pEGX-6p-1/iss wide spectrum vaccine (colon bacillus Escherichia coli) immunizing doses 1 × 10
7individual/plumage, the left back torso bag of 14 age in days is attacked poison, and the malicious serotype of attacking of 4-11 group is successively: O1, O2, O57, O65, O78, O85, O92, O141 serotype fowl pathogenic colon bacillus pathogenic bacteria, bacteria containing amount is respectively 1 × 10
7individual/plumage;
(5) 21 age in days statisticses, result is added up as table 1.
Table 1 BL21-DE3/pEGX-6p-1/iss and O2 deactivation vaccine broad spectrum and immune effect result
Following result as known from Table 1:
(1) in the present invention, BL21-DE3/pEGX-6p-1/iss wide spectrum vaccine (deposit number CGMCC No.8574 is colon bacillus Escherichia coli) is compared with O2 deactivation vaccine in contrast, can produce immunity to the intestinal bacteria of more serotypes (O1, O2, O57, O65, O78, O85, O92, O141 serotype).
(2) in the present invention, BL21-DE3/pEGX-6p-1/iss wide spectrum vaccine (deposit number CGMCC No.8574 is colon bacillus Escherichia coli) is compared with O2 deactivation vaccine in contrast, and the immune effect of the intestinal bacteria (O1, O2, O57, O65, O78, O85, O92 serotype) of the BL21-DE3/pEGX-6p-1/iss in the present invention to more serotypes is 100%.
The substantive distinguishing features that the present invention possesses and the remarkable technical progress obtaining are:
(1) BL21-DE3/pEGX-6p-1/iss wide spectrum vaccine (deposit number CGMCC No.8574 is colon bacillus Escherichia coli) all can produce immunity to 7 kinds of serotype intestinal bacteria (O1, O2, O57, O65, O78, O85, O92, O141 serotype), so there is higher broad spectrum, be obviously better than existing 02 deactivation vaccine.
(2) BL21-DE3/pEGX-6p-1/iss wide spectrum vaccine (deposit number CGMCC No.8574 is colon bacillus Escherichia coli) is 100% to the immune effect of 6 kinds of serotype intestinal bacteria (O1, O2, O57, O65, O78, O85, O92 serotype), be 70% to the immune effect of O141 serotype, therefore this BL21-DE3/pEGX-6p-1/iss wide spectrum vaccine has better immune effect to the animal of susceptible colibacillosis, compares O2 deactivation vaccine and has more wide commercial exploitation prospect.
The colon bacillus (Escherichia coli) relating in the present invention, applicant has submitted the center preservation of microbial strains preservation management committee's common micro-organisms on December 13rd, 2013, the address of this depositary institution is positioned at No. 3, Yard 1, BeiChen xi Road, Chaoyang District, Beijing City Institute of Microorganism, Academia Sinica, this preservation mechanism referred to as CGMCC.
Brief description of the drawings
Accompanying drawing of the present invention has:
Colibacillary plasmid 1% sepharose of Fig. 1 O2 serotype detects figure.
Marker:8000,5000,3000,1500,1000,500 in Fig. 1.
Fig. 2 PCR product 1.5% sepharose detects figure.
Fig. 2 Marker:2000,1000,750,500,250,100.The band of PCR product electrophoresis, between 250bp and 500bp, just in time matches with theoretical value, and the iss gene that obtains a large amount of amplifications is described.
Fig. 3 contains the bacterium of cultivating in sero-fast LB liquid nutrient medium in the present invention, its survival ratio curve over time.
Embodiment
Accompanying drawing has provided embodiments of the invention; below in conjunction with accompanying drawing, embodiments of the invention are further described; but not as a limitation of the invention; the content that protection scope of the present invention is recorded with claim is as the criterion; any equivalence techniques means of making according to specification sheets are replaced, and all do not depart from protection scope of the present invention.
A kind of colon bacillus Escherichia coli, its deposit number is CGMCC No.8574.
The colon bacillus (Escherichia coli) relating in the present embodiment, applicant has submitted the center preservation of microbial strains preservation management committee's common micro-organisms on December 13rd, 2013, the address of this depositary institution is positioned at No. 3, Yard 1, BeiChen xi Road, Chaoyang District, Beijing City Institute of Microorganism, Academia Sinica, this preservation mechanism referred to as CGMCC.
The preparation method of colon bacillus Escherichia coli, by the iss gene fragment through clone in coding avian colibacillosis pathogenic bacteria outer membrane protein, through being reconstituted in expression plasmid pEGX-6p-1 after BamH I and Sal I double digestion, build prokaryotic expression plasmid pEGX-6p-1/iss; Prokaryotic expression plasmid pEGX-6p-1/iss is transformed in e. coli bl21-DE3, builds recombination bacillus coli BL21-DE3/pEGX-6p-1/iss, deposit number is the colon bacillus Escherichia coli of CGMCC No.8574.
Concrete technology step in the present embodiment and processing condition also have:
The preparation method of colon bacillus Escherichia coli, comprises following processing step:
A, cultivation O2 serotype intestinal bacteria;
B, O2 serotype escherichia coli plasmid extract and purifying;
C, pcr amplification iss fragment;
D, construction expression plasmid vector pEGX-6p-1/iss;
E, screening positive strain.
Cultivation in described steps A adopts LB liquid nutrient medium, and culture condition is 37 DEG C of temperature, 150 revs/min of rotating speeds, 18 hours cycles;
LB liquid nutrient medium comprises the component of following quality:
Yeast extract5g; Tryptone10g; NaCl5g; All the other are distilled water, are settled to 1L.
In described LB liquid nutrient medium, also comprise the component of following quality:
Agar 10g.
In described step B, extract the colibacillary plasmid of O2 serotype with plasmid extraction kit, reclaim test kit with quick glue and purify the colibacillary plasmid DNA of O2 serotype, wherein said plasmid extraction kit and fast glue reclaim test kit and are produced by Beijing Quanshijin Biotechnology Co., Ltd.
Described step B carries out according to the specification sheets of test kit, comprises the steps:
B1, use plasmid extraction kit (Beijing Quanshijin Biotechnology Co., Ltd, catalog number (Cat.No.): EM111) extract the colibacillary plasmid of O2 serotype, and wherein step B1 comprises:
B1-1, get the bacterium liquid of 30ml incubated overnight, centrifugal 2 minutes of 12,000 × g, removes supernatant;
B1-2, add 10ml colourless solution RB (Resuspension Buffer containing RNase A), concussion suspension thalline, should not leave little bacterium piece;
B1-3, add 10ml blue solution LB (lysis Buffer), leniently spin upside down and mix 4-6 time, make the abundant cracking of thalline, form the bright solution of blueness, color brightly becomes bright blueness from half, indicates complete cracking;
B1-4, add 14ml yellow solution NB (Neutralization Buffer), mix 5-6 time gently, until form the yellow aggegation piece of consolidation, room temperature leaves standstill 2 minutes;
Centrifugal 15 minutes of B1-5,12,000 × g, carefully draw supernatant and add in centrifugal column;
Centrifugal 2 minutes of B1-6,8,000 × g, abandoned stream fluid;
B1-7, add 5ml solution TB (ToxinOut Buffer), room temperature leaves standstill 10 minutes, centrifugal 2 minutes of 8,000 × g, abandoned stream fluid;
B1-8, add 5ml solution W B (Wash Buffer), centrifugal 2 minutes of 8,000 × g, abandoned stream fluid;
B1-9, repeating step B1-8 are once;
Centrifugal 5 minutes of B1-10,8,000 × g, thoroughly remove residual WB (Wash Buffer);
B1-11, room temperature are placed 10 minutes, make ethanol in centrifugal column volatilize clean;
B1-12, centrifugal column is placed in to a clean 50ml centrifuge tube, adds 1-2mlEB (Elution Buffer) or deionized water (pH>7.0) room temperature to leave standstill 5 minutes in the central authorities of post;
Centrifugal 2 minutes of B1-13,8,000 × g, eluted dna;
B1-14, the DNA that elutes are in-20 DEG C of preservations.
B1-15,1% sepharose detect, and result is as Fig. 1.
B2, reclaim test kit (Beijing Quanshijin Biotechnology Co., Ltd, catalog number (Cat.No.): EG101) the colibacillary plasmid DNA of purifying O2 serotype with quick glue.Comprise following processing step:
B2-1, cut the plasmid DNA band in sepharose, put into clean centrifuge tube and weigh, if gel is heavily 100mg, can be considered 100 microlitres, by that analogy.
B2-2, add the GSB of 3 times of volumes, in 55 DEG C of water-bath colloidal sol 6-10 minute, be interrupted mixing in 2-3 minute, guarantee that blob of viscose melts completely, after glue melts completely, observe the color of solution, if color is purple, add appropriate 3M sodium-acetate (pH=5.2), adjust color identical with GSB color (yellow).
B2-3, be down to room temperature (when high temperature centrifugal column in conjunction with DNA ability a little less than) wait the gelating soln melting, add in centrifugal column and leave standstill 1 minute, 10000xg abandoned stream fluid.
B2-4, add 650 microlitre solution W B, centrifugal 1 minute of 10000xg, abandoned stream fluid.
The centrifugal 1-2 minute of B2-5,10000xg, removes residual WB.
B2-6, centrifugal column is placed in to a clean centrifuge tube, uncaps and leave standstill 1 minute, make residual ethanol volatilization clean.Add 30-50 microlitre EB or deionized water (pH>7.0) (EB or deionized water are 60-70 DEG C of water-bath preheating, and result of use is better) in the central authorities of post, room temperature leaves standstill 1 minute.
Centrifugal 1 minute of B2-7,10000xg, eluted dna.By the DNA eluting in-20 DEG C of preservations.
Described step C is by the iss gene fragment through clone in coding avian colibacillosis pathogenic bacteria outer membrane protein, carries out BamH I and Sal I double digestion.
In described step C, BamH I endonuclease reaction is with 5 ＇-cgc
ggatccaggattctgccgttttta-3 ＇ is upstream primer P1, and Sal I endonuclease reaction is with 5 ＇-cgc
gtcgaccatatcgatgggcaacta-3 ＇ is downstream primer P2, and wherein underscore part is restriction enzyme site; PCR reaction system is as follows:
PCR reaction conditions is: 94 DEG C of denaturations 5 minutes, 94 DEG C of sex change 1 minute; Anneal 30 seconds for 57 DEG C, 72 DEG C are extended 1 minute, 30 circulations; 72 DEG C were extended after 10 minutes, and PCR product is placed in 4 DEG C of Refrigerator stores.PCR product 1.5% sepharose detects, and result is as Fig. 2.
Described step D comprises following processing step:
D1, utilize double digestion method, enzyme to cut goal gene PCR product fragment, and purified pcr product endonuclease bamhi;
In step D1, reclaim the fragment of test kit (Beijing Quanshijin Biotechnology Co., Ltd, catalog number (Cat.No.): EG101) after purified pcr product enzyme is cut with quick glue, obtain purified product iss gene fragment.Concrete steps are carried out according to test kit specification sheets, comprise following processing step:
D1-1, cut the plasmid DNA band in sepharose, put into clean centrifuge tube and weigh, if gel is heavily 100mg, can be considered 100 microlitres, by that analogy.
D1-2, add the GSB of 3 times of volumes, in 55 DEG C of water-bath colloidal sol 6-10 minute, being interrupted (2-3 minute) mixes, guarantee that blob of viscose melts completely, after glue melts completely, observe the color of solution, if color is purple, add appropriate 3M sodium-acetate (pH=5.2), adjust color identical with GSB color (yellow).
D1-3, be down to room temperature (when high temperature centrifugal column in conjunction with DNA ability a little less than) wait the gelating soln melting, add in centrifugal column and leave standstill 1 minute, 10000xg abandoned stream fluid.
D1-4, add 650 microlitre solution W B, centrifugal 1 minute of 10000xg, abandoned stream fluid.
The centrifugal 1-2 minute of D1-5,10000xg, removes residual WB.
D1-6, centrifugal column is placed in to a clean centrifuge tube, uncaps and leave standstill 1 minute, make residual ethanol volatilization clean.Add 30-50 microlitre EB or deionized water (pH>7.0) (EB or deionized water are 60-70 DEG C of water-bath preheating, and result of use is better) in the central authorities of post, room temperature leaves standstill 1 minute.
Centrifugal 1 minute of D1-7,10000xg, eluted dna.By the DNA eluting in-20 DEG C of preservations.
D2, utilize double digestion method, enzyme is cut pEGX-6p-1, and purifying pEGX-6p-1 endonuclease bamhi;
Step D2 is the fragment after purifying pEGX-6p-1 enzyme is cut with DNA purification kit (Beijing Quanshijin Biotechnology Co., Ltd, catalog number (Cat.No.): EM101), obtains purified product iss gene fragment.
D3, connection construction expression plasmid vector pEGX-6p-1/iss.
In step D3, linked system is as follows:
Ligation process is as follows:
D3-1:16 DEG C is reacted 30 minutes;
D3-2: full dose is added in 50 μ L competent cell BL21-DE3, is placed in ice 30 minutes;
D3-3:42 DEG C of heating, after 90 seconds, is placed in ice 2 minutes;
D3-4: add 500 μ LLB non-resistant substratum, shaking culture 60 minutes under 37 DEG C, 150 revs/min conditions;
D3-5: cultivate on the LB-Agar Plating that contains kantlex, form single bacterium colony.
Positive strain after transforming is delivered to order-checking company to check order and determines the insertion sequence of BL21-DE3/pEGX-6p-1/iss.The DAN sequencing result being inserted in pEGX-6p-1 expression plasmid is:
ATGCAGGATAATAAGATGAAAAAAATGTTATTTTCTGCCGCTCTGGCAATGCTTATTACAGGATGTGCTCAACAAACGTTTACTGTTGGAAACAAACCGACAGCAGTAACACCAAAGGAAACCATCACTCATCATTTCTTCGTTTCGGGAATTGGACAAGAGAAAACTGTTGATGCAGCCAAAATTTGTGGCGGTGCAGAAAATGTTGTTAAAACAGAAACTCAGCAAACATTCGTAAATGGATTGCTCGGTTTTATCACTTTTGGCATCTATACTCCGCTGGAAGCCCGGGTATATTGCTCACAA。
The result of order-checking is consistent with the fragment of inserting in theory.
For further illustrating the impact of antibody on bacterial strain seroresistance, applicant has carried out following experiment:
1, purifying GST-iss albumen
With protein purification test kit (Beijing Quanshijin Biotechnology Co., Ltd, catalog number (Cat.No.): DP201) purifying GST-iss albumen.
1-1, balance: with the level pad balance chromatography column of 5-10 times of column volume, lead constant with pH (consistent with balance liquid) to effluent liquid electricity.
1-2, loading: sample buffer should be consistent with balance liquid and sample through micro-filtration, (0.45 μ m) processes.
1-3, washing: after loading, with the level pad washing chromatography column of 5-10 times of column volume, collect effluent liquid.
1-4, wash-out: with elution buffer (50mM Tris-Cl pH=8.0,10mM reduced glutathion.Glutathione concentrations need to suitably be adjusted according to the combination Lixing of target protein.Gsh is easily oxidized, needs matching while using) wash-out, collect effluent liquid, obtain the GST-iss albumen of purifying.
2, the preparation of resistance serum
Get SPF chicken and under sterile state, raise 5, with the protein content intramuscular injection 10 age in days SPF chickens of 100 micrograms/plumage, once exempted from again every 7 days, four exempt from rear the 5th day heart extracting blood.Get positive serum with immune group serum.Get blood to plastic test tube, room temperature place 1h, after in 3 DEG C place 2-3h, centrifugation serum, is stored in-70 DEG C.
3, O2 serological type strain seroresistance detects
Microbial culture is to logarithmic phase, OD
600=0.5, corresponding to 0.4x10
9cfu/mL; Bacterium is washed 3 times in the NaCl of 0.06mol/L solution, is resuspended in mass percent and is 0.9% NaCl solution to 10
6cfu/mL; 0.2mL bacterial suspension is mixed mutually with 0.2mL serum, be diluted to 1mL with salts solution, making serum final concentration is 20%; Mixture is in 37 DEG C of incubations; Respectively at 0min, 30min, 60min, 90min sampling, with after salts solution dilution, coated plate; Cultivate 18h for 37 DEG C, meter viable count.Parallel doing 5 times, averages.Using add viable count ratio before viable count and the incubation after serum incubation as bacterial strain the survival ratio in serum, represent the power of bacterial strain seroresistance.
4, the detected result of iss antibody on the impact of bacterial strain seroresistance, as Fig. 3 (containing the bacterium of cultivating in sero-fast LB liquid nutrient medium, its survival ratio % curve over time)
In Fig. 3 known data results of the present invention than open source information (immanoprotection action of chicken source pathogenic colon bacillus iss gene protokaryon product. herding and animal doctor; 2010; (42) 11:84-86. Fan Chen; Liu Guiqin; Wang Yu; Li Dandan; Li Yijing) the survival ratio of data is all low at the survival ratio of 30min, 60min, 90min; illustrate that deposit number in the present invention is that the expressed protein-active of the colon bacillus Escherichia coli of CGMCC No.8574 is better, with its immunity system sero-fast resistance also better.This deposit number is that the colon bacillus Escherichia coli of CGMCC No.8574 has good immune effect to the quantity that reduces pathogenic colon bacillus in Broiler Chicken, therefore has more wide commercial exploitation prospect.
Claims (9)
1. a colon bacillus, is characterized in that its deposit number is CGMCC No.8574.
2. the preparation method of colon bacillus Escherichia coli according to claim 1, it is characterized in that the iss gene fragment through clone in coding avian colibacillosis pathogenic bacteria, through being reconstituted in expression plasmid pEGX-6p-1 after BamH I and Sal I double digestion, build prokaryotic expression plasmid pEGX-6p-1/iss; Prokaryotic expression plasmid pEGX-6p-1/iss is transformed in e. coli bl21-DE3, builds recombination bacillus coli BL21-DE3/pEGX-6p-1/iss.
3. the preparation method of colon bacillus Escherichia coli according to claim 2, is characterized in that comprising following processing step:
A, cultivation O2 serotype fowl pathogenic colon bacillus;
B, O2 serotype escherichia coli plasmid extract and purifying;
C, pcr amplification iss fragment;
D, construction expression plasmid vector pEGX-6p-1/iss;
E, screening positive strain.
4. the preparation method of colon bacillus Escherichia coli according to claim 3, is characterized in that the cultivation in described steps A adopts LB liquid nutrient medium, and culture condition is 37 DEG C of temperature, 150 revs/min of rotating speeds, 18 hours cycles.
5. the preparation method of colon bacillus Escherichia coli according to claim 3, is characterized in that the cultivation in described steps A adopts LB solid medium, and culture condition is 37 DEG C of temperature, 18 hours cycles.
6. the preparation method of colon bacillus Escherichia coli according to claim 3, it is characterized in that extracting the colibacillary plasmid of O2 serotype with plasmid extraction kit in described step B, purify the colibacillary plasmid DNA of O2 serotype with quick glue recovery test kit.
7. according to the preparation method of the colon bacillus Escherichia coli described in any one in claim 3 or 4, it is characterized in that described step C is with 5 ＇-cgc
ggatccaggattctgccgttttta-3 ＇ is upstream primer P1, and BamH I restriction enzyme site is underscore part in P1; With 5 ＇-cgc
gtcga ccatatcgatgggcaacta-3 ＇ is downstream primer P2, and Sal I restriction enzyme site is underscore part in P2, taking the colibacillary plasmid DNA of O2 serotype after purifying in step B as template, adopts pcr amplification iss fragment.
8. according to the preparation method of the colon bacillus Escherichia coli described in claim 7, it is characterized in that in described step C, PCR reaction system is as follows:
PCR reaction conditions is: 94 DEG C of denaturations 5 minutes, 94 DEG C of sex change 1 minute; Anneal 30 seconds for 57 DEG C, 72 DEG C are extended 1 minute, 30 circulations; 72 DEG C were extended after 10 minutes, and PCR product is placed in 4 DEG C of Refrigerator stores.
9. the preparation method of colon bacillus Escherichia coli according to claim 3, is characterized in that described step D comprises following processing step:
D1, utilize double digestion method, enzyme to cut goal gene PCR product fragment, and purified pcr product endonuclease bamhi;
D2, utilize double digestion method, enzyme is cut pEGX-6p-1, and purifying pEGX-6p-1 endonuclease bamhi;
D3, connection construction expression plasmid vector pEGX-6p-1/iss
In step D3, linked system is as follows:
Ligation process is as follows:
D3-1:16 DEG C is reacted 30 minutes;
D3-2: full dose is added in 50 μ L competent cell BL21 (DE3), is placed in ice 30 minutes;
D3-3:42 DEG C of heating, after 90 seconds, is placed in ice 2 minutes;
D3-4: add 500 μ LLB non-resistant substratum, shaking culture 60 minutes under 37 DEG C, 150 revs/min conditions;
D3-5: cultivate on the LB-Agar Plating that contains kantlex, form single bacterium colony.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410260536.7A CN104004698A (en) | 2014-06-11 | 2014-06-11 | Escherichia coli and preparation method thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410260536.7A CN104004698A (en) | 2014-06-11 | 2014-06-11 | Escherichia coli and preparation method thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN104004698A true CN104004698A (en) | 2014-08-27 |
Family
ID=51365608
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410260536.7A Pending CN104004698A (en) | 2014-06-11 | 2014-06-11 | Escherichia coli and preparation method thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104004698A (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106011163A (en) * | 2016-05-19 | 2016-10-12 | 武汉华美生物工程有限公司 | Method for cell-free expression of signal protein and expression system |
| CN106987549A (en) * | 2017-04-26 | 2017-07-28 | 河北科星药业有限公司 | The production method of culture medium and the wide spectrum vaccine of corresponding prevention birds colibacillosis |
| CN108096582A (en) * | 2018-01-17 | 2018-06-01 | 河北科星药业有限公司 | Avian escherichia coli disease live-vaccine freeze drying protectant |
| CN110257276A (en) * | 2019-05-21 | 2019-09-20 | 扬州大学 | A kind of inert carrier Escherichia coli and its potential application |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP2004250346A (en) * | 2003-02-18 | 2004-09-09 | Biseibutsu Kagaku Kenkyusho:Kk | Vaccine against colibacillosis in poultry |
| CN1674935A (en) * | 2002-06-05 | 2005-09-28 | 多托尔公司 | Biofunctional CpG or oligo-/polynucleotide and toxin or enterotoxin containing composition |
| JP2008231123A (en) * | 2008-06-02 | 2008-10-02 | Biseibutsu Kagaku Kenkyusho:Kk | Vaccine against colibacillosis in poultry |
| CN101310018A (en) * | 2005-11-11 | 2008-11-19 | 美国辉瑞有限公司 | Combinations and methods of using an immunomodulatory oligodeoxynucleotide |
-
2014
- 2014-06-11 CN CN201410260536.7A patent/CN104004698A/en active Pending
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1674935A (en) * | 2002-06-05 | 2005-09-28 | 多托尔公司 | Biofunctional CpG or oligo-/polynucleotide and toxin or enterotoxin containing composition |
| JP2004250346A (en) * | 2003-02-18 | 2004-09-09 | Biseibutsu Kagaku Kenkyusho:Kk | Vaccine against colibacillosis in poultry |
| CN101310018A (en) * | 2005-11-11 | 2008-11-19 | 美国辉瑞有限公司 | Combinations and methods of using an immunomodulatory oligodeoxynucleotide |
| JP2008231123A (en) * | 2008-06-02 | 2008-10-02 | Biseibutsu Kagaku Kenkyusho:Kk | Vaccine against colibacillosis in poultry |
Non-Patent Citations (4)
| Title |
|---|
| HORNE S M等: "Cloning and sequencing of the iss gene from a virulent avian", 《AVIAN DIS》, 31 December 2000 (2000-12-31), pages 179 - 184 * |
| JOHNSON T J等: "Location of increased serum survival gene and selected virulence traits on a conjugative Rplasmid in an avian Escherichia coli isolate", 《A VIAN DIS》, 31 December 2002 (2002-12-31), pages 342 - 352 * |
| 樊琛等: "鸡大肠杆菌iss 基因的克隆测序及原核表达", 《中国兽医杂志》, vol. 40, 31 December 2004 (2004-12-31) * |
| 樊琛等: "鸡源致病性大肠杆菌iss基因原核表达产物的免疫保护作用", 《畜牧与兽医》, vol. 42, 31 December 2010 (2010-12-31), pages 84 - 86 * |
Cited By (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106011163A (en) * | 2016-05-19 | 2016-10-12 | 武汉华美生物工程有限公司 | Method for cell-free expression of signal protein and expression system |
| CN106011163B (en) * | 2016-05-19 | 2020-02-04 | 武汉华美生物工程有限公司 | Method for cell-free expression of signal protein and expression system |
| CN106987549A (en) * | 2017-04-26 | 2017-07-28 | 河北科星药业有限公司 | The production method of culture medium and the wide spectrum vaccine of corresponding prevention birds colibacillosis |
| CN106987549B (en) * | 2017-04-26 | 2020-08-21 | 河北科星药业有限公司 | Culture medium and corresponding production method of broad-spectrum bacterin for preventing poultry colibacillosis |
| CN108096582A (en) * | 2018-01-17 | 2018-06-01 | 河北科星药业有限公司 | Avian escherichia coli disease live-vaccine freeze drying protectant |
| CN108096582B (en) * | 2018-01-17 | 2021-04-30 | 河北科星药业有限公司 | Freeze-drying protective agent for live vaccine of avian colibacillosis |
| CN110257276A (en) * | 2019-05-21 | 2019-09-20 | 扬州大学 | A kind of inert carrier Escherichia coli and its potential application |
| CN110257276B (en) * | 2019-05-21 | 2020-03-24 | 扬州大学 | Inert carrier escherichia coli and potential application thereof |
| WO2020233147A1 (en) * | 2019-05-21 | 2020-11-26 | 扬州大学 | Inert carrier escherichia coli and potential use thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104004698A (en) | Escherichia coli and preparation method thereof | |
| CN107653260A (en) | A kind of preparation method and application of Recombinant Lactococcus lactis | |
| CN106139140B (en) | A kind of Muscovy duck parvovirus subunit vaccine | |
| CN104962572A (en) | Preparation method for aeromonas hydrophila outer membrane protein gene prokaryotic expression protein | |
| CN102584992B (en) | Colon bacillus outer membrane protein monoclonal and its preparation method and application | |
| CN103204912B (en) | Insecticidal gene cry2Ah-like with high toxicity on lepidoptera pest and application thereof | |
| CN104830825A (en) | Endolysin sourced from salmonella bacteriophage and application thereof | |
| CN102181457B (en) | Clostridium difficile exotoxin B amino-terminal gene sequence with optimized codon and nucleic vaccine of clostridium difficile exotoxin B | |
| CN105255935A (en) | Expression method of antimicrobial peptide CC34 in bacillus subtilis | |
| CN100484959C (en) | Modified recombinant porcine alpha interferon protein and coding gene and uses thereof | |
| CN112480227B (en) | Protein for improving pathogenic bacterium resistance of sturgeon and preparation method and application thereof | |
| CN102199611B (en) | Clostridium difficile exotoxin A carboxy-terminal gene sequence with optimized codon and nucleic acid vaccine thereof | |
| CN104250304B (en) | The vaccine combination of a kind of fusion protein and its coding and application | |
| CN102604993B (en) | Immunologic adjuvant-Helicobacter pylori antigen fused protein oral vaccine and preparation method thereof | |
| CN109568572A (en) | A kind of preparation method and applications of Aeromonas Multivalent DNA Vaccine | |
| CN105861521A (en) | Preparation method and application of tilapia source streptococcus agalactiae recombinant GroEL protein vaccine | |
| CN104093419B (en) | The preparation method of the wide spectrum vaccine of prevention birds colibacillosis | |
| CN101003789B (en) | Bacterium agent of engineering bacterium of gene recombination for spider poison peptide | |
| CN103014051B (en) | Multiple-potency live vaccine for fish and application thereof | |
| CN103830722A (en) | Clostridium perfringens beta toxin genetic engineering vaccine and application thereof | |
| CN103387992A (en) | Gene for coding recombinant porcine beta-defensin-1 and preparation method of porcine beta-defensin-1 | |
| CN103012578B (en) | Recombinant porcine interleukin 2, and encoding gene and expression method thereof | |
| CN104945489A (en) | Preparation and application of tilapia-sourced streptococcus agalactiae recombinant BP-2b protein vaccine | |
| CN110923289B (en) | Screening method of drug for treating citrus greening disease | |
| CN101531967B (en) | Method for producing alpha interferon and dedicated bacteria therefor |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20140827 |