CN103830722A - Clostridium perfringens beta toxin genetic engineering vaccine and application thereof - Google Patents

Abstract

The invention relates to a clostridium perfringens beta toxin genetic engineering vaccine and application thereof. The vaccine is prepared by the following steps: reviving a C type clostridium perfringens strain by using a beta toxin specific primer, performing a PCR (Polymerase Chain Reaction) to obtain a beta toxin gene fragment (930bp), connecting the beta toxin gene fragment to a PET-28a(+) plasmid, and introducing a recombinant plasmid into a receptor strain to successfully construct a recombinant strain BL21(DE3)-beta; effectively expressing a beta toxin by using the recombinant strain BL21(DE3)-beta in the form of inclusion body; emulsifying beta toxin proteins and a white oil adjuvant in the volume ratio of 1:1, and adding 0.01 percent of thiomersalate to obtain the vaccine. The vaccine is applied to female livestock at the later stage of immunological pregnancy, and newborn animals are passively immunized through colostrum, so that hemorrhage necrotizing enteritis (lamb dysentery, calf enterotoxaemia, piglet red diarrhea and the like) of young stocks can be prevented effectively; proved by immune protective efficacy experiments, the protective efficacy of the vaccine to rabbits is up to 100 percent.

Description

A kind of Sequencing of Beta Toxin Gene of Clostridium perfringens engineered vaccine and application thereof

(1) technical field

The present invention relates to a kind of Sequencing of Beta Toxin Gene of Clostridium perfringens engineered vaccine and application thereof.

(2) background of invention

Bacillus perfringens (Clostridium perfringens) is a kind of Gram-positive, generation brood cell, strictly anaerobic and the bacillus fusiformis that forms special pod membrane.The ability that produces four kinds of lethal toxin (α, β, ε, ι toxin) according to it, is divided into five types, i.e. five types of A, B, C, D, E.Bacillus perfringens β toxin is necrosis, the lethal toxin being produced by bacillus perfringens Type B and C type bacterial strain, the necrosis that can produce hemolytic, and its toxic action shows on intestinal villi, can cause the necrotic enteritis of humans and animals.

China is animal husbandry big country, and pig, cattle, sheep are Main Economic domestic animals, and young stock diarrhoea is the important epidemic disease that affects animal husbandry development.The young stock hemorrhagic necrosis enteritis (lamb dysentery, calf enterotoxemia, piglet red dysentery etc.) being caused by bacillus perfringens β toxin, popular very serious in the vast pastoral area of China, there is higher M & M, caused huge economic loss to animal husbandry.The Drug therapy of young stock diarrhoea not only expensive, take a lot of work, and effect is bad, more, because pathogenic bacterium drug resistance strain increases increasingly, medication is often invalid, thereby immunoprophylaxis is the optimum selection of this class epidemic disease of control.There is pathogenic hidden danger in bacillus perfringens toxoid vaccine clinically, and recombinant vaccine is safe and output is high, purity is high.

(3) summary of the invention

In order to address the above problem, the invention provides a kind of Sequencing of Beta Toxin Gene of Clostridium perfringens engineered vaccine and application thereof, possess the advantages such as immunity is strong, specific aim good, have no side effect, safety is good.

A kind of Sequencing of Beta Toxin Gene of Clostridium perfringens engineered vaccine, is that the ratio taking volume ratio as 1:1 is carried out emulsifying by β toxin protein and white-oil adjuvant, adds 0.01 gram of thimerosal to make in every 100ml emulsion; The preparation method of described β toxin protein comprises the following steps:

1) strain brings back to life and template preparation

Be inoculated in a blood plate culture medium 40 DEG C of anaerobism (88%N with inoculating loop picking C type bacillus perfringens strain ₂, 7%H ₂, 5%CO ₂) cultivation 36h.Containing 7-8 milliliter THIOGLYCOLLIC ACID salt broth (FT) in vitro 37 DEG C of anaerobism are cultivated 12h in one to get single colony inoculation, and the culture fluid of getting 1～5ml extracts DNA according to the explanation of DNA extraction test kit, as the template of amplifying target genes.

2) clone of β toxin gene

Carry out pcr amplification genes of interest according to the gene order design primer of β toxin in GenBank, amplified production, after agarose gel electrophoresis, reclaims amplified production;

Primer1:GGAATTCAATGATATAGGTAAAACTAC; (shown in SEQ.ID.N03)

Shown in Primer2:CCTCGAGTTAAATAGCTGTTACTTTGTGAGT(SEQ.ID.N04)

3) build prokaryotic expression carrier pET28a-β

Genes of interest PCR product and expression vector pET28a are all used to Eco RI and Xho I enzyme action; The genes of interest PCR product and the expression vector pET28a that after enzyme action, reclaim are respectively carried out to purification.The genes of interest PCR product of purification is connected with carrier pET28a, obtains recombiant plasmid pET28a-β.After pET28a-β is mixed with BL21 (DE3) competent cell, transform, obtain recombinant bacterial strain BL21 (DE3)-β.

4) prokaryotic expression of β toxin gene, protein purification

With the IPTG of 0.6mM, 37 DEG C, to recombinant bacterium abduction delivering 12h, the purified β toxin protein that obtains.

The preparation method that the invention still further relates to a kind of Sequencing of Beta Toxin Gene of Clostridium perfringens engineered vaccine, comprises the following steps:

1) strain brings back to life and template preparation

Be inoculated in a blood plate culture medium 40 DEG C of anaerobism (88%N with inoculating loop picking C type bacillus perfringens strain ₂, 7%H ₂, 5%CO ₂) cultivation 36h.Containing 7-8 milliliter THIOGLYCOLLIC ACID salt broth (FT) in vitro 37 DEG C of anaerobism are cultivated 12h in one to get single colony inoculation, and the culture fluid of getting 1～5ml extracts DNA according to the explanation of DNA extraction test kit, as the template of amplifying target genes.

2) clone of β toxin gene

Carry out pcr amplification genes of interest according to the gene order design primer of β toxin in GenBank, amplified production, after agarose gel electrophoresis, reclaims amplified production;

Primer1:GGAATTCAATGATATAGGTAAAACTAC; (shown in SEQ.ID.N03)

Shown in Primer2:CCTCGAGTTAAATAGCTGTTACTTTGTGAGT(SEQ.ID.N04)

3) build prokaryotic expression carrier pET28a-β

Genes of interest PCR product and expression vector pET28a are all used to Eco RI and Xho I enzyme action; The genes of interest PCR product and the expression vector pET28a that after enzyme action, reclaim are respectively carried out to purification.The genes of interest PCR product of purification is connected with carrier pET28a, obtains recombiant plasmid pET28a-β.After pET28a-β is mixed with BL21 (DE3) competent cell, transform, obtain recombinant bacterial strain BL21 (DE3)-β.

4) prokaryotic expression of β toxin gene, protein purification

With the IPTG of 0.6mM, 37 DEG C, to recombinant bacterium abduction delivering 12h, the purified β toxin protein that obtains.

5) β toxin gene engineering Seedling preparation

By the β toxin protein preparing in above-mentioned steps and white-oil adjuvant, the ratio taking volume ratio as 1:1 is carried out emulsifying, adds 0.01 gram of thimerosal to obtain in every 100ml emulsion.

The invention still further relates to the application of a kind of Sequencing of Beta Toxin Gene of Clostridium perfringens engineered vaccine in the piglet red dysentery that causes because of bacillus perfringens β toxin of prevention:

The Sequencing of Beta Toxin Gene of Clostridium perfringens engineering Seedling of preparing in antenatal 30 days of farrowing sow and the present invention of each intramuscular injection on the 15th, each 6ml/ only, for immune sow heavy in pig, newborn piglet obtains passive immunity, prevention piglet red dysentery by sucking food colostrum.

Beneficial effect

Prepared by these research and development safe, immunity is strong, therapeutic effect good, the Sequencing of Beta Toxin Gene of Clostridium perfringens engineered vaccine having no side effect, for the female animal of immune latter half of gestation, newborn animal obtains passive immunity by colostrum, can effectively prevent young stock hemorrhagic necrosis enteritis (lamb dysentery, calf enterotoxemia, piglet red dysentery etc.).

(4) brief description of the drawings

Fig. 1 is the destination protein β toxin SDS-PAGE electrophoretogram giving expression to.

From scheming, can find out that the destination protein size giving expression to is that 38KD and β toxin are in the same size, illustrates and has successfully given expression to destination protein.

Fig. 2 is preparation technology's flow process of this gene engineering vaccine

(5) detailed description of the invention

1, strain brings back to life and template preparation

With (the National Collection of Type Cult μ res Britain microorganism fungus kind preservation center preservation of inoculating loop picking C type bacillus perfringens strain, NCTC3180) be inoculated in a blood plate culture medium (after 100 ml distilled waters, 1 gram of glucose and the sterilizing of 3.8 grams of bean agar powders, adding 5 milliliters of Sheep Bloods to divide installs on six blood plates) upper, 40 DEG C of anaerobism (88%N ₂, 7%H ₂, 5%CO ₂) cultivation 36h.Get single colony inoculation in one containing 7-8 milliliter THIOGLYCOLLIC ACID salt broth (FT) (medium component is general) in vitro, 37 DEG C of anaerobism are cultivated 12h, the culture fluid of getting 1～5ml illustrates and extracts DNA according to DNA extraction test kit (the precious biotech firm in Dalian), as the template of amplifying target genes.

2, the structure of the Cloning and Expression carrier of β toxin gene

(1) design of primer

As follows according to the primer of the gene order of β toxin in GenBank (accession number L13198, its nucleotide sequence is as shown in SEQ.ID.N01) design:

Primer1:GGAATTCAATGATATAGGTAAAACTAC;

Primer2:CCTCGAGTTAAATAGCTGTTACTTTGTGAGT

(2) clone of β toxin gene and recovery

The DNA extracting taking the first step is as template, and (reaction system is as follows: forward primer 2 μ l, downstream primer 2 μ l for the genes of interest that amplified production is 930bp, cDNA2 μ l, dNTP1 μ l, 10X pf μ B μ ffer5 μ l, Pf μ pyro polymerase 0.4 μ l, ddH2O polishing to 50 μ l).Pcr amplification product, after agarose gel electrophoresis, reclaims test kit (the precious biotech firm in Dalian) with DNA gel and reclaims object band.

(3) enzyme action genes of interest PCR product and expression vector pET28a

Genes of interest PCR product is used to EcoR I and Xho I enzyme action, and (reaction system is: PCR product 20 μ l, EcoR I1 μ l, Xho I1 μ l, 10X Buffer Tango5 μ l, ddH ₂o23 μ l) reacts 4h in 37 DEG C of thermostat water baths; By expression vector pET28a, with EcoR I and Xho I enzyme action, (system is: pET28a1 μ g, EcoR I1 μ l, Xho I1 μ l, 10X Buffer Tango5 μ l, ddH ₂o complements to 50 μ and l) in 37 DEG C of thermostat water baths, reacts 4h.

(4) reclaim genes of interest PCR product and carrier and carry out purification

After enzyme action finishes, reclaim respectively genes of interest PCR product and carrier and carry out purification by 1% agarose gel electrophoresis.The process of glue recovery and purification genes of interest PCR product and carrier is as follows:

A. from agarose gel, cut off respectively the blob of viscose that contains genes of interest PCR product and carrier and weigh.

B. add the B μ fferB2 of 3 times of blob of viscose weight, 50 DEG C of water-bath 5min.

C. sol solutions is moved in adsorption column, the centrifugal 30s of 8000g, outwells the liquid in collecting pipe.

D. add 500 μ lWash Solution, the centrifugal 30s of 9000g, outwells the liquid in collecting pipe, repeats this process once.

E. by another suction attached column in the centrifugal 1min of 9000g, then put into a clean 1.5ml centrifuge tube, add 40 μ l Elution Buffur in adsorbed film central authorities, room temperature leaves standstill 1min, then preserves that glue in pipe reclaims and the genes of interest PCR product of purification.

(5) preparation of recombiant plasmid

The genes of interest PCR product that reclaims purification is connected with carrier pET28a, and reaction system is: PCR product 5 μ l, expression vector pET28a5 μ l, 10X T4DNA ligase Buffer2 μ l, T4DNA ligase1 μ l, ddH ₂o7 μ l reacts 2h and carries out coupled reaction and obtain recombiant plasmid in 16 DEG C of thermostat water baths.

(6) preparation of recombinant bacterial strain and the qualification of positive recombiant plasmid

Recombiant plasmid is proceeded to BL21(DE3) competent cell (purchased from Divine Land, Beijing red autumnal leaves Science and Technology Ltd.) in: recombiant plasmid and BL21(DE3) competent cell adds in centrifuge tube by 1:5 volume ratio, leaves standstill 20min under condition of ice bath.Be placed in 42 DEG C of thermostat water bath heat shock 90s again, then under condition of ice bath, leave standstill 5min, add 800 μ l LB culture medium, 37 DEG C of constant-temperature tables again in centrifuge tube, 200r/m cultivates 30min; So far recombiant plasmid has been proceeded to recombinant bacterial strain BL21(DE3).Draw competent cell that 200 μ l have transformed and be added to and contain on the LB agar culture medium of kanamycin sulfate that concentration is 34 μ g/mL, cell is evenly coated with and is opened.Flat board is placed in to 37 DEG C and is cultured to liquid and is absorbed, be inverted dull and stereotyped, 37 DEG C of incubated overnight.Sterile working's picking list colony inoculation is in containing the LB fluid medium increasing bacterium that concentration is the kanamycin sulfate of 34 μ g/mL, and 37 DEG C of shaken cultivation 12-14h, illustrate and extract plasmid according to plasmid extraction kit (Tai'an Bo Ao biotech company).

Nci I/BamH I and 37 DEG C of enzyme action 3h of BamH I/Not I restricted enzyme for the plasmid DNA that extraction obtains, enzyme action system 10ul: the each 0.5ul of restricted enzyme, recombiant plasmid 6ul, 10 × buffer1ul, ddH ₂o2ul.

Enzyme action product is observed enzyme action segment in 1% agarose gel, determines positive recombiant plasmid, send Jin Site Engineering Co., Ltd to carry out nucleotide sequencing.The homology that Blast compares surveyed β toxin complete genome sequence online and GenBank has delivered corresponding sequence is more than 98%.

3, the prokaryotic expression of β toxin gene, protein purification and specific detection

Picking recombinant bacterial strain BL21(DE3) single bacterium colony (lysogeny broth nutrient media components: Tryptone2g in the test tube of 5mL lysogeny broth culture medium, Yeast extract1g, Nacl2g is dissolved in the kanamycin sulfate that adds 34 μ g in the every 1mLlysogeny broth of 200mL deionized water culture medium) 37 DEG C, 220rpm/min incubated overnight.The bacterium liquid of cultivation is inoculated in 200ml lysogeny broth culture medium (adding the kanamycin sulfate of 34 μ g in every 1mL lysogeny broth culture medium) by the volume ratio of 1:100,37 DEG C, 180rpm/min amplification culture.In the time that OD value reaches 0.6 left and right, the IPTG that interpolation final concentration is 0.6mM, 37 DEG C, 120rpm/min induces 12h.The albumen of expressing is present in thalline with the form of inclusion body, collects thalline and uses PBS buffer (component: NaCl8g, KCl0.2g, Na ₂hPO ₄12H ₂o3.58g, KH ₂pO ₄0.27g is dissolved in 1000mL deionized water) suspend.The albumen of ultrasonication thalline to obtain expressing: ultrasonication thalline in ice bath, power 200W, 99 circulations (ultrasonic 3S, suspending 5S is a circulation).Ultrasonic complete, 8000rpm/min, 4 DEG C, centrifugal 15min, cleer and peaceful precipitation in collection.Destination protein β toxin is present in supernatant, gets supernatant and prepares purification.By Ni-Agarose His label protein purification column (Nanjing Genscript Biotechnology Co., Ltd.) purification, obtain purer β toxin.After purification, sample carries out SDS-PAGE electrophoresis, and detects the specificity of expressing protein by Western blot.

4, β toxin gene engineering Seedling preparation

By the β toxin protein of producing and white-oil adjuvant, the ratio taking volume ratio as 1:1 is carried out emulsifying, adds 0.01 gram of thimerosal in every 100ml emulsion, obtains Sequencing of Beta Toxin Gene of Clostridium perfringens engineering Seedling.

5, β toxin gene engineering Seedling safety verification

With 4 of the rabbit of body weight 1.5-2 kilogram, 5 milliliters of each intramuscular injection vaccines, observe 10, all strong living, injection site does not necrose.

6, β toxin gene engineering Seedling steriling test

Carry out asepsis growth with reference to 301 pages of " People's Republic of China's veterinary biologics quality standard " (calendar year 2001 version) annex.

7, β toxin gene engineering Seedling thimerosal assay

Carry out with reference to 313 pages of " People's Republic of China's veterinary biologics quality standard " (calendar year 2001 version) annex, meet " pertinent regulations of goods inspection " (thimerosal content is no more than 0.01%).

8, β toxin gene engineering Seedling immune protection effectiveness test

Get 10 of 1.5-2kg Healthy Rabbits; be divided into matched group and experimental group; every group each 5, the β toxin gene engineering Seedling of every intramuscular injection 2ml of experimental group, the physiological saline solution of every each intramuscular injection equivalent of matched group; after 21 days; 10 rabbits are injected respectively 2ml bacillus perfringens β toxin, observe 3-5 day, and 5 rabbits of matched group are all dead; 5 rabbits of immune group are all not dead, illustrate that this vaccine has reached 100% to the protection of rabbit.

9, application

There is more serious pig factory certain piglet red dysentery is sick, farrowing sow is divided into two groups and is respectively immune group and nonimmune group, every group each 20; The farrowing sow of immune group was in antenatal 30 days and Sequencing of Beta Toxin Gene of Clostridium perfringens engineering Seedling of each intramuscular injection on the 15th, and each 6ml is as immune group; Nonimmune group of vaccinate not, separates raising the sow of immune group and the sow of nonimmune group simultaneously.Result shows, the piglet that the sow of immune group produces occurs without piglet red dysentery phenomenon, but not in the piglet that every sow of immune group produces, has piglet red dysentery phenomenon to occur.

Claims (3)

1. a Sequencing of Beta Toxin Gene of Clostridium perfringens engineered vaccine, it is characterized in that the ratio taking volume ratio as 1:1 is carried out emulsifying by β toxin protein and white-oil adjuvant, adds 0.01 gram of thimerosal to make in every 100ml emulsion; The preparation method of described β toxin protein comprises the following steps:

1) strain brings back to life and template preparation

Be inoculated in a blood plate culture medium 40 DEG C of anaerobism (88%N with inoculating loop picking C type bacillus perfringens strain ₂, 7%H ₂, 5%CO ₂) cultivation 36h; Containing 7-8 milliliter THIOGLYCOLLIC ACID salt broth (FT) in vitro 37 DEG C of anaerobism are cultivated 12h in one to get single colony inoculation, and the culture fluid of getting 1～5ml extracts DNA according to the explanation of DNA extraction test kit, as the template of amplifying target genes;

2) clone of β toxin gene

Carry out pcr amplification genes of interest according to the gene order design primer of β toxin in GenBank, amplified production, after agarose gel electrophoresis, reclaims amplified production;

Primer1:GGAATTCAATGATATAGGTAAAACTAC;

Primer2:CCTCGAGTTAAATAGCTGTTACTTTGTGAGT

3) build prokaryotic expression carrier pET28a-β

Genes of interest PCR product and expression vector pET28a are all used to Eco RI and Xho I enzyme action; The genes of interest PCR product and the expression vector pET28a that after enzyme action, reclaim are respectively carried out to purification; The genes of interest PCR product of purification is connected with carrier pET28a, obtains recombiant plasmid pET28a-β; After pET28a-β is mixed with BL21 (DE3) competent cell, transform, obtain recombinant bacterial strain BL21 (DE3)-β;

4) prokaryotic expression of β toxin gene, protein purification

With the IPTG of 0.6mM, 37 DEG C, to recombinant bacterium abduction delivering 12h, the purified β toxin protein that obtains.

2. a preparation method for Sequencing of Beta Toxin Gene of Clostridium perfringens engineered vaccine, is characterized in that comprising the following steps:

1) strain brings back to life and template preparation

Be inoculated in a blood plate culture medium 40 DEG C of anaerobism (88%N with inoculating loop picking Type B bacillus perfringens strain ₂, 7%H ₂, 5%CO ₂) cultivation 36h; Containing 7-8 milliliter THIOGLYCOLLIC ACID salt broth (FT) in vitro 37 DEG C of anaerobism are cultivated 12h in one to get single colony inoculation, and the culture fluid of getting 1～5ml extracts DNA according to the explanation of DNA extraction test kit, as the template of amplifying target genes;

2) clone of β toxin gene

Carry out pcr amplification genes of interest according to the gene order design primer of β toxin in GenBank, amplified production, after agarose gel electrophoresis, reclaims amplified production;

Primer1:GGAATTCAATGATATAGGTAAAACTAC; (shown in SEQ.ID.N02)

Shown in Primer2:CCTCGAGTTAAATAGCTGTTACTTTGTGAGT(SEQ.ID.N03)

3) build prokaryotic expression carrier pET28a-β

Genes of interest PCR product and expression vector pET28a are all used to Eco RI and Xho I enzyme action; The genes of interest PCR product and the expression vector pET28a that after enzyme action, reclaim are respectively carried out to purification; The genes of interest PCR product of purification is connected with carrier pET28a, obtains recombiant plasmid pET28a-β; After pET28a-β is mixed with BL21 (DE3) competent cell, transform, obtain recombinant bacterial strain BL21 (DE3)-β;

4) prokaryotic expression of β toxin gene, protein purification

With the IPTG of 0.6mM, 37 DEG C, to recombinant bacterium abduction delivering 12h, the purified β toxin protein that obtains;

5) β toxin gene engineering Seedling preparation

By the β toxin protein preparing in above-mentioned steps and white-oil adjuvant, the ratio taking volume ratio as 1:1 is carried out emulsifying, adds 0.01 gram of thimerosal to obtain in every 100ml emulsion.

3. the application in the piglet red dysentery that a kind of Sequencing of Beta Toxin Gene of Clostridium perfringens engineered vaccine as claimed in claim 1 causes because of bacillus perfringens β toxin in prevention.

Images