CN105524177A

CN105524177A - Mycobacterium tuberculosis specific fusion protein, and encoding gene and application thereof

Info

Publication number: CN105524177A
Application number: CN201610011926.XA
Authority: CN
Inventors: 吴雪琼; 蔡小波; 张俊仙; 李征; 阳幼荣; 徐学鹏; 梁艳; 王海彬; 白骅
Original assignee: 309th Hospital of PLA; Zhejiang Hisun Pharmaceutical Co Ltd
Current assignee: 309th Hospital of PLA; Zhejiang Hisun Pharmaceutical Co Ltd
Priority date: 2015-10-14
Filing date: 2016-01-08
Publication date: 2016-04-27

Abstract

The invention discloses a mycobacterium tuberculosis specific fusion protein, and an encoding gene and an application thereof. The protein is the following (a) or (b): (a) a protein represented by SEQ ID No.2; and (b) a protein obtained through substitution and/or deletion and/or addition of one or more amino acid residues of the amino acid sequence represented by SEQ ID No.2, and with a same function as that of the SEQ ID No.2. As a skin allergen, the recombinant fusion protein CE provided by the invention can specifically induce high delayed-type hypersensitivity after mycobacterium tuberculosis sensitization. The specificity is higher than an existing commercialized skin diagnostic reagent PPD. The recombinant fusion protein CE provided by the invention can be used for preparing medicine used in the diagnosis of tuberculosis infection.

Description

Mycobacterium tuberculosis specific fusion protein and encoding gene thereof and application

Technical field

The invention belongs to tuberculosis Medical Immunology diagnostic techniques field, relate to a kind of mycobacterium tuberculosis specific fusion protein and encoding gene thereof and application, be specifically related to mycobacterium tuberculosis specificity recombination fusion protein CE prepared by a kind of using gene engineering technique and encoding gene thereof and application.

Background technology

Tuberculosis is one of Infectious Diseases of harm humans health, is one of publilc health difficult problem of current urgent need solution.Since 1985, the immigrant of popular, the tuberculosis infection of acquired immune deficiency syndrome (AIDS) and the part population reason such as to be poorly off makes European and American developed countries' incidence of tuberculosis such as the U.S. be rise trend, and especially tubercule bacillus resistance and Nontuberculous mycobacterial infections sickness rate rise and strengthen and hinder diagnosis of tuberculosis, the difficulty for the treatment of and progress.There is tuberculosis patient about 2,000 ten thousand in the current whole world, and annual new infections number 800-1000 ten thousand dies from number lungy about 1,400,000 every year.

China is one of 22 tuberculosis high burden countries in the whole world, and tuberculosis epidemic situation and resistance situation are all quite serious, and tuberculosis patient numerical digit occupies the second in the world, is only second to India.2010 the 5th time national tuberculosis epidemiological random sampling survey PRELIMINARY RESULTS shows, existing pulmonary tuberculosis patient 500-600 ten thousand, wherein infectivity pulmonary tuberculosis patient about 860,000, national pulmonary tuberculosis number of the infected and death toll are positioned at the first place of various Notifiable disease.Tuberculosis is by the very strong disease of the infectivity of respiratory infectious, and China about has 1/3rd populations to infect tubercule bacillus, and wherein 5% may fall ill in early days, and 5% may in its whenever morbidity in life.Therefore, the active discovery of tuberculosis high risk population, dynamic monitoring and prophylactic treatment can effectively reduce phthisical sickness rate, early diagnosis lungy, find that contagium, effectively chemotherapy are propagated for control tuberculosis and tubercule bacillus and had extremely important meaning.

In the diagnostic method of conventional application clinically at present, sensitivity for the clinical samples smear detecting Pulmonary Tuberculosis with Discharge of Bacterium patient is low, positive rate only has 20-30%, the positive rate that traditional Roche is cultivated also only has about 30%, and need 4-8 time-of-week, the mycobacterium rapid culture system of international endorsement generally also needs more than 2 weeks, and expensive reagents, and testing cost is high and be difficult to popularize.For detecting tuberculosis infected students, assisting the poor specificity of the tuberculin skin test of the cloudy consumptive's diagnosis of bacterium, bacille Calmette-Guerin vaccine inoculator and component environment mycobacterial infections person can not be differentiated; Sensitivity and the specificity of Of serum anti-mycobacterium tuberculosis detection are undesirable; The IFN-γ release test expensive reagents of exploitation in nearly 2 years, technical sophistication, is not suitable for basic unit or rig-site utilization.Obviously at present the diagnostic method of conventional application clinically can not meet the demand of clinical treatment, especially different medical unit can detection method few.

Tuberculin is mycobacterium tuberculosis culturing filtrate albumen, it acts on people's cognition and excites sensitization body to produce cell immune response, activated T lymphocytes, monocyte and scavenger cell, discharge a large amount of cytokine, and make these cell proliferations, gathering, coating antigen forms tubercle, and delayed allergy that Here it is, its response intensity and cellular immunization are parallel relation.Tuberculin skin test has become a kind of tubercle bacillus affection diagnostic method the most frequently used and the easiest clinically at present, react stronger, represent that tuberculosis infection possibility is larger, China uses scleroma >=5mm for the positive always, >=20mm or have bubble, necrosis, poradenolymphitis etc. for strong positive, less than 3 years old children >=15mm is the standard of strong positive.Main agents for tuberculosis tuerculoderma has following several: (1) ot: not easily stdn and easily nonspecific reaction occurs, seldom uses at present.(2) human-like PPD: the purified protein derivative (PPD) (PPD) of mycobacterium tuberculosis virulent strain culturing filtrate, owing to producing bacterial strain, there is very strong infectivity, the preparation of this PPD of national requirements need be carried out in negative pressure workshop, though manufacturer production is had, the mycobacterium tuberculosis PPD still do not sold domestic at present.(3) whether bacill calmette-guerin PPD: the culturing filtrate purified protein derivative (PPD) being strain of BCG vaccine is successful mainly for detection of BCG (Bacille Calmette-Guerin) vaccination.When not having human-like PPD, substituting human-like PPD clinically make a skin test with bacill calmette-guerin PPD, but both PPD compositions are not just the same, therefore, bacill calmette-guerin PPD tuerculoderma is assisted the value of diagnosis of tuberculosis to still need and is studied further.(4) mycobacterium tuberculosis restructuring 38KD albumen: there is no commercially available prod at present.The skin reaction that this antigenic stimulation produces is comparatively light, generally can not produce the side effect such as bubble and lymphangitis; And this albumen is present in mycobacterium tuberculosis complex, tuberculosis infected students reaction is strong, and BCG (Bacille Calmette-Guerin) vaccination person reacts weak, and therefore, it can not differentiate tuberculosis infected students and BCG (Bacille Calmette-Guerin) vaccination person completely.

6 kDa early secretory antigenic target is a kind of lower molecular weight (6kDa) Early insulin secretion albumen, encoded by mycobacterium tuberculosis, mycobacterium tuberculosis var bovis and the genomic diff area of minority pathogenic mycobacterium (RD) 1, but all strain of BCG vaccine and most environment Mycobacterium tuberculosis genes group all lose this region, do not express 6 kDa early secretory antigenic target.6 kDa early secretory antigenic target contains multiple T lymphocyte antigen epi-position, and this albumen or its polypeptide can be used as T cell stimulator antigen, can be used as skin test antigen for the infection of diagnosis of tuberculosis bacterium, auxiliary diagnosis tuberculosis.

CFP10 is 100 amino acid whose albumen by Rv3874 genes encoding, its gene is positioned at the upstream of ESAT6 gene, all RD1 is positioned at ESAT6 encoding gene, belong to same lhp-exe operon, regulated by same promotor and transcribe, both are distributed in identical mycobacterium, and its gene is present in mycobacterium tuberculosis complex and other mycobacteriums of minority (as stomach, bearing mycobacterium), but does not all find its gene in all bacterial strains of BCG.CFP10 sequence and ESAT6 gene have an appointment 40% homology, its albumen also belongs to one of member of ESAT6 family, and both have identical immunological characteristic.CFP10 albumen is also containing multiple T lymphocyte antigen epi-position, and this albumen or its polypeptide all can be used as T cell stimulator antigen.

6 kDa early secretory antigenic target is different with the T lymphocyte antigen epi-position that CFP10 albumen has, the tuberculosis infected students of different genetic background is also incomplete same to the reaction of these two kinds of antigens, the stimulation of part tuberculosis infected students to these two kinds of antigens all produces reaction, and part tuberculosis infected students only reacts to 6 kDa early secretory antigenic target or CFP10 albumen.Independent application 6 kDa early secretory antigenic target is as stimulator antigen, and part tuberculosis infected students causes owing to not reacting 6 kDa early secretory antigenic target and fails to pinpoint a disease in diagnosis.Therefore, provide that a kind of highly sensitive, high specific, preparation are easy, the skin allergic reaction infected for diagnosis of tuberculosis of high yield is former just becomes the art urgent problem.

Summary of the invention

Technical problem to be solved by this invention overcomes the deficiencies in the prior art part, there is provided that a kind of highly sensitive, high specific, preparation are easy, mycobacterium tuberculosis specificity recombination fusion protein, the infection caused for the mankind or animal mycobacterium tuberculosis and the detection of disease of high yield.

For solving above technical problem, the invention provides a kind of albumen, title is recombination fusion protein CE, is following protein a) or b):

A) protein shown in SEQIDNo.2;

B) by the aminoacid sequence shown in SEQIDNo.2 through the replacement of one or several amino-acid residue and/or disappearance and/or interpolation and the identical protein of function.

Described recombination fusion protein CE can synthetic, also can first synthesize its encoding gene, then carries out biological expression and obtain.Described b) in the encoding gene of protein by by the DNA sequence dna disappearance in SEQIDNo.1 shown in 4-612 position or add the codon of one or several amino-acid residue, and/or the missense mutation carrying out one or several base pair obtains.

For solving above technical problem, the present invention also provides the biomaterial relevant to described albumen, is following B1) or B2):

B1) nucleic acid molecule of encoding said proteins;

B2) containing B1) expression cassette of described nucleic acid molecule, recombinant vectors, recombinant microorganism or transgenic cell line;

Described nucleic acid molecule can be DNA, as cDNA, genomic dna or recombinant DNA; Described nucleic acid molecule can be also RNA, as mRNA or hnRNA etc.

In above-mentioned biomaterial, B1) described in nucleic acid molecule be following 1) or 2) or 3) shown in gene:

1) DNA molecular shown in 4-612 position in SEQIDNo.1;

2) under strict conditions with 1) DNA molecule hybridize that limits and the DNA molecular of code for said proteins;

3) with 1) or 2) DNA molecular that limits have more than 90% identity and described protein DNA molecule.

Those of ordinary skill in the art can adopt known method easily, the method for such as orthogenesis and point mutation, suddenly change to the nucleotide sequence of coding recombination fusion protein CE of the present invention.Those are through manually modified, there is the Nucleotide showing certain identity with the nucleotides sequence of coding recombination fusion protein CE of the present invention, as long as coding recombination fusion protein CE and there is the function of recombination fusion protein CE, be all be derived from nucleotide sequence of the present invention and be equal to sequence of the present invention.

Term used herein " identity " refers to the sequence similarity with nucleotide sequence." identity " can with the naked eye or computer software evaluate.Use computer software, the identity between two or more sequence can represent with per-cent (%), and it can be used for evaluating the identity between correlated series.

In above-mentioned biomaterial, the expression cassette of the nucleic acid molecule containing coding recombination fusion protein CE B2), refer to the DNA that can express recombination fusion protein CE in host cell, this DNA not only can comprise the promotor of the genetic transcription starting coding recombination fusion protein CE, also can comprise the terminator of the genetic transcription stopping coding recombination fusion protein CE.Further, described expression cassette also can comprise enhancer sequence;

Available existing expression vector establishment contains the recombinant vectors of the nucleic acid molecule of coding recombination fusion protein CE, and existing expression vector is as pET system, pGEX;

Described carrier can be plasmid, glutinous grain, phage or virus vector;

Described recombinant microorganism specifically can be bacterium, algae and fungi, and wherein, bacterium can be intestinal bacteria;

Described transgenic cell is non-reproductive material.

For solving above technical problem, the present invention also provides the preparation method of described albumen, comprises the steps: the nucleic acid molecule of encoding said proteins to import in Host Strains to obtain recombinant bacterium, and induction recombinant bacterium expresses described albumen.

In aforesaid method, described nucleic acid molecule imports described Host Strains by recombinant expression vector;

Sequence between NdeI and the XhoI restriction enzyme site that the DNA molecular shown in SEQIDNo.3 is specifically replaced pET-30a (+) by described recombinant expression vector, all the other sequences of pET-30a (+) are constant to be obtained;

Described Host Strains is specially intestinal bacteria;

Described expression comprises carries out fermentation culture in the fermentation medium by described recombinant bacterium, and makes described recombinant bacterium express described albumen with IPTG induction;

Described fermention medium specifically comprises peptone 8-12g/L, sodium-chlor 1.5-2.5g/L, potassium primary phosphate 6.0-7.5g/L, three hypophosphite monohydrate hydrogen dipotassium 11.0-12.0g/L, ammonium sulfate 1.8-2.2g/L, defoamer 0.4-0.6ml/L; Specifically comprise peptone 10g/L, sodium-chlor 2.0g/L again, potassium primary phosphate 6.8g/L, three hypophosphite monohydrate hydrogen dipotassium 11.4g/L, ammonium sulfate 2.0g/L, defoamer 0.5ml/L;

The condition of described fermentation culture is specially: temperature 36.5-37.5 DEG C, pH6.7-6.9, dissolved oxygen 30-80%;

Described temperature is specially 37 DEG C, and pH is specially 6.8;

Described IPTG induction is specifically at the OD of the nutrient solution of fermentation culture ₆₀₀start induction when reaching 20-40, IPTG final concentration is 0.4-0.6mM; Again specifically at the OD of the nutrient solution of fermentation culture ₆₀₀start induction when reaching 25-35, IPTG final concentration is 0.5mM;

Described fermentation culture can also adopt exponential fed-batch feeding strategy, is less than 1g/L adds speed for standard adjustment supplemented medium with the sugared content of the nutrient solution of fermentation culture;

Described supplemented medium specifically comprises glucose 350-370g/L, bitter salt 12-18g/L, yeast extract 470-490g/L; Specifically comprise glucose 360g/L, bitter salt 15g/L, yeast extract 480g/L again;

Also comprise the step of purifying after described expression, described purifying comprise the recombinant bacterium of described fermentation culture carried out fragmentation, collect supernatant, the step of ultrafiltration and/or ion exchange chromatography;

Described ion exchange chromatography is specially anion-exchange chromatography, then is specially DEAEsepharoseFastFlow column chromatography, AminobutylSepharose6FastFlow column chromatography and/or QSepharoseHighPerformance column chromatography.

For solving above technical problem, the present invention also provides above-mentioned albumen and/or the application of above-mentioned arbitrary described biomaterial in the product preparing detection or auxiliary detection m tuberculosis infection.

In above-mentioned application, described product is allergen;

It is former that described allergen is specially skin allergic reaction.

For solving above technical problem, the present invention also provides above-mentioned albumen and/or the application of above-mentioned arbitrary described biomaterial in the product of the disease that preparation detects or auxiliary detection mycobacterium tuberculosis causes.

In above-mentioned application, described disease is tuberculosis;

In above-mentioned application, described tuberculosis is the outer tuberculosis of pulmonary tuberculosis or lung;

Described pulmonary tuberculosis is specially the cloudy pulmonary tuberculosis of bacterium.

In above-mentioned arbitrary described application, described mycobacterium tuberculosis is Mycobacterium tuberculosis H37Rv (M.tuberculosis) or mycobacterium tuberculosis var bovis (M.bovis).

In above-mentioned arbitrary described application, described product can cause delayed type hypersensitivity in the tuerculoderma of m tuberculosis infection person or tuberculosis patient.

The present invention is by analyzing gene order and the protein structure of mycobacterium tuberculosis CFP10 and ESAT6, determine the region of two Protein Epitopes fusions, combination and order, according to colibacillary codon usage frequency, select wherein high-frequency codon and best codon or preference codon, remove some rare or that utilization ratio is low codons, replace original codon by synonym to be optimized, design the encoding gene of recombination fusion protein CE; Utilize carrier pET-30a (+) to build the recombinant expression vector CE/pET-30a of the encoding gene containing fusion rotein CE further, and prepare CE/pET-30a colibacillus engineering; IPTG induces CE/pET-30a colibacillus engineering express recombination fusion protein CE and be further purified it.The epitope of mycobacterium tuberculosis two kinds of Rv3874s and ESAT6 key connects and composes by recombination fusion protein CE provided by the invention successively, wherein the epitope of CFP10 albumen is positioned at the aminoterminal of recombination fusion protein CE, and the epitope of 6 kDa early secretory antigenic target is positioned at the carboxyl terminal of recombination fusion protein CE.The expression amount of recombination fusion protein CE is apparently higher than recombination fusion protein EC (that is, by albumen that the epitope of the CFP10 albumen of recombination fusion protein CE and the epitope location swap of 6 kDa early secretory antigenic target obtain).

In addition, the present invention is studied the purposes that recombination fusion protein CE detects on m tuberculosis infection specifically, proves that recombination fusion protein CE can be used as the skin diagnosis allergen of specific detection m tuberculosis infection.Therefore, the present invention will have broad application prospects in the detection and auxiliary detection lungy of m tuberculosis infection.

Beneficial effect of the present invention is:

1, the present invention proves, PPD can induce mycobacterium tuberculosis complex (comprising mycobacterium tuberculosis, bacill calmette-guerin and mycobacterium tuberculosis var bovis etc.) and the cavy of most of non-tuberculous mycobacteria sensitization to produce strong skin reaction, only has the cavy of minority non-tuberculous mycobacteria (comprising mycobacterium kansasii, micro-yellow mycobacterium and Mycobacterium phlei) sensitization to produce weak skin reaction.And recombination fusion protein CE provided by the invention is former as skin allergic reaction, for the cavy of mycobacterium tuberculosis, mycobacterium tuberculosis var bovis sensitization, can induce specifically and produce strong delayed allergy, and for the cavy of non-tuberculous mycobacteria sensitization in bacill calmette-guerin, most of environment, not produce or only induction produces weak delayed allergy.Therefore, recombination fusion protein CE provided by the invention in existing commercial skin diagnosis reagent PPD, can replace PPD for differentiating bacille Calmette-Guerin vaccine inoculator and being used as to detect specifically the skin diagnosis allergen of tubercle bacillus affection to the high specificity of mycobacterium tuberculosis.Recombination fusion protein CE provided by the invention is at preparation tuberculosis specific skin diagnostic reagent and prepare the medicine that diagnosis of tuberculosis infects, and will have broad application prospects for the detection of m tuberculosis infection and auxiliary detection aspect lungy.

2, recombination fusion protein CE provided by the invention and mycobacterium tuberculosis are cultivated and are extracted compared with albumen, can be mass-produced, and without the need to the production plant of Biosafety III level; And the gene structure optimized makes it be more suitable at expression in escherichia coli, obtains higher expression level; Have identical biologic activity with native protein, thus improve output, reduce production cost, product price is cheaper.With prepare mycobacterium tuberculosis CFP10 and ESAT6 two kinds of antigens after be mixed in proportion immunity again, recombination fusion protein CE advantage of lower cost provided by the invention, wherein the ratio of CFP10 and ESAT6 two kinds of antigens is accurate.

3, human-like PPD, bacill calmette-guerin PPD and non-tuberculous mycobacteria albumen have many homologys, restructuring 38KD albumen all has expression in mycobacterium tuberculosis, bacill calmette-guerin and non-tuberculous mycobacteria, and CFP10 and ESAT6 lacks in bacill calmette-guerin and most of non-tuberculous mycobacteria genome.The allergen that recombination fusion protein CE of the present invention is used as tuerculoderma has higher specificity than human-like PPD, bacill calmette-guerin PPD and restructuring 38KD albumen, can differentiate tuberculosis infected students and BCG (Bacille Calmette-Guerin) vaccination person.This is highly profitable for the country of newborn infant first pin in China's planned immunization with regard to bcg vaccination, and recombination fusion protein CE provided by the invention is formed by two kinds of tuberculosis specific T-cells antigens c FP10 and ESAT6 fusion, containing more T cell antigen determinant, different tuberculosis infection crowd can be induced specifically to produce stronger delayed allergy, and make the highly sensitive product (as Recombinant ESAT6 albumen and restructuring 38KD albumen) formed in single antigen of detection, thus there is high specific and highly sensitive.Therefore, recombination fusion protein CE of the present invention, as the special skin diagnosis reagent of new tuberculosis, applies easy, without the need to specific apparatus, be applicable to different medical unit to the examination of tuberculosis high risk population, and the auxiliary diagnosis of the cloudy pulmonary tuberculosis of bacterium and the outer tuberculosis of lung and EPDML investigation.

Below in conjunction with the drawings and specific embodiments, the present invention will be further described, but and do not mean that limiting the scope of the invention.

Accompanying drawing explanation

Fig. 1 is that C gene second takes turns pcr amplification product agarose gel electrophoresis figure.

Fig. 2 is that E gene second takes turns pcr amplification product agarose gel electrophoresis figure.

Fig. 3 is CE gene PCR amplified production agarose gel electrophoresis figure.

Fig. 4 is the digestion products of pET-30a (+) vector plasmid and the fragment containing CE gene and reclaims product agarose gel electrophoresis figure.

Fig. 5 is the agarose gel electrophoresis figure of pET-30a (+) vector plasmid and recombinant plasmid.

Fig. 6 is restructuring plasmid enzyme restriction qualification agarose gel electrophoresis figure.

Fig. 7 is recombinant plasmid CE/pET-30a sequencing result.

Fig. 8 is the SDS-PAGE result before and after CE/pET-30a colibacillus engineering IPTG induces.

Fig. 9 is the SDS-PAGE result of CE/pET-30a colibacillus engineering expression-form qualification.

Figure 10 is the SDS-PAGE result of CE/pET-30a colibacillus engineering fermentation inducement time and expression amount relation.

Figure 11 is the RP-HPLC analytical results of DEAEsepharoseFastFlow column purification elutriant main peak in recombination fusion protein CE purge process.

Figure 12 is the RP-HPLC analytical results of AminobutylSepharose6FastFlow column purification elutriant main peak in recombination fusion protein CE purge process.

Figure 13 is the RP-HPLC analytical results of QSepharoseHighPerformance column purification elutriant main peak in recombination fusion protein CE purge process.

Embodiment

The experimental technique used in following embodiment if no special instructions, is ordinary method.

Material used in following embodiment, reagent etc., if no special instructions, all can obtain from commercial channels.

Bacill calmette-guerin (M.bovisBCG is called for short BCG) is Chengdu Inst. of Biological Products's lyophilized bacillus calmette-guerin vaccine, Mycobacterium tuberculosis H37Rv (M.tuberculosis), mycobacterium tuberculosis var bovis (M.bovis), mycobacterium habana (M.simiae, ATCC25275), Soviet Union adds mycobacterium (M.szulgai, ATCC35799), mycobacterium gordonae (M.gordonae, ATCC14470), Mycobacterium intracellulare (M.intracellulare, ATCC13950), pale yellow mycobacterium (M.gilvum, ATCC43909), achromatic mycobacterium (M.nonchromogenicum, TMC1481), golden mycobacterium (M.aurum, ATCC23366), mycobacterium kansasii (M.kansasii, ATCC12478), micro-yellow mycobacterium (M.flavescens, ATCC14474) and Mycobacterium phlei (M.phlei, ATCC11758) are Nat'l Pharmaceutical & Biological Products Control Institute's product, and catalog number is respectively 95054, 95055, 95017, 95019, 95018, 95002, 95032, 95007, 95027, 95013, 95030 and 95024.

Cavy (regular grade) is Haidian District, Beijing City prosperous laboratory animal cultivation factory product.

Purified protein derivative of tuberculin (PPD) (50IU/ml) is Chengdu Inst. of Biological Products's product.

Freund's incomplete adjuvant is Sigma product.

Polysorbate 80 is Amresco product.

Modified Russell medium and Su Tong substratum are No.309 Hospital of PLA's product.

Recombinant C FP10 albumen and Recombinant ESAT6 albumen are No.309 Hospital of PLA's product.

The coding gene sequence of CFP10 albumen and 6 kDa early secretory antigenic target is shown in MycobacteriumtuberculosisH37Rvcompletegenome, and GenBank accession number is AL123456.3.

Substratum in following embodiment is all prepared with water.

The clone of the encoding gene of embodiment 1, recombination fusion protein CE and the expression and purification of recombination fusion protein CE

One, the design of two Protein Epitopes fusions

Analyze gene order and the protein structure of mycobacterium tuberculosis CFP10 and ESAT6, determine the region of two Protein Epitopes fusions, combination and order, according to colibacillary codon usage frequency, select wherein high-frequency codon and best codon or preference codon, remove some rare or that utilization ratio is low codons, replace original codon by synonym to be optimized, so that designed gene is expressed at a high level in intestinal bacteria, improve protein yield, make protein production more effective and economical.

Design obtains the sequence shown in SEQIDNo.1.In SEQIDNo.1,1-6 position is that restriction endonuclease NdeI enzyme cuts recognition site 5 '-CATATG-3 ' (comprising initiator codon 5 '-ATG-3 '), 4-303 position is encoding gene (hereinafter referred to as the C gene) sequence of CFP10 Protein Epitopes, 304-327 position is the coding gene sequence 5 '-GGTGGTGGCGGATCTGGTGGCGGT-3 ' of connecting arm, 328-612 position is encoding gene (hereinafter referred to as the E gene) sequence of the 6 kDa early secretory antigenic target epitope after optimizing, 613-615 position is terminator codon 5 '-TAA-3 ', 617-622 position is that restriction endonuclease XhoI enzyme cuts recognition site 5 '-CTCGAG-3 '.

The recombination fusion protein CE that CFP10 and 6 kDa early secretory antigenic target epitope be in turn connected to form is obtained according to SEQIDNo.1, the epitope of CFP10 albumen is positioned at the aminoterminal of recombination fusion protein CE, and the epitope of 6 kDa early secretory antigenic target is positioned at the carboxyl terminal of recombination fusion protein CE.The aminoacid sequence of recombination fusion protein CE is as shown in SEQIDNo.2.In SEQIDNo.2,1-100 position is CFP10 Protein Epitopes sequence, and 101-108 position is connecting arm, and 109-203 position is 6 kDa early secretory antigenic target epitope sequence.

Encoding gene (hereinafter referred to as the CE gene) sequence of recombination fusion protein CE is as shown in 4-612 position in SEQIDNo.1.

5’- CATATGGCAGAGATGAAGACTGATGCAGCTACTCTGGCACAAGAAGCAGGTAACTTCGAACGTATCTCTGGTGACCTGAAAACCCAGATCGATCAGGTTGAATCTACTGCAGGTTCTCTGCAGGGTCAATGGCGTGGTGCTGCAGGTACTGCTGCACAAGCTGCAGTTGTACGTTTCCAAGAAGCAGCCAATAAGCAGAAGCAGGAACTGGATGAAATCTCTACTAACATTCGTCAGGCAGGTGTTCAATACTCTCGTGCTGATGAAGAGCAACAGCAAGCACTGAGCTCTCAAATGGGTTTC GGTGGTGGCGGATCTGGTGGCGGTATGACCGAACAGCAGTGGAACTTCGCAGGTATCGAAGCTGCAGCTTCTGCTATTCAGGGTAACGTTACCTCTATCCACTCTCTGCTGGATGAAGGTAAACAGTCTCTGACCAAACTGGCAGCTGCATGGGGTGGTTCTGGTTCTGAAGCTTACCAGGGTGTTCAGCAGAAATGGGATGCTACCGCAACCGAACTGAACAACGCACTGCAGAACCTGGCTCGTACCATCTCTGAAGCTGGTCAGGCTATGGCTTCTACCGAAGGTAACGTTACTGGTATGTTCGCT TAAA CTCGAG-3’(SEQIDNo.1)

MAEMKTDAATLAQEAGNFERISGDLKTQIDQVESTAGSLQGQWRGAAGTAAQAAVVRFQEAANKQKQELDEISTNIRQAGVQYSRADEEQQQALSSQMGF GGGGSGGGMTEQQWNFAGIEAAASAIQGNVTSIHSLLDEGKQSLTKLAAAWGGSGSEAYQGVQQKWDATATELNNALQNLARTISEAGQAMASTEGNVTGMFA(SEQIDNo.2)

Two, by the encoding gene of genetic engineering technique clone recombination fusion protein CE

1, according to the coding gene sequence of recombination fusion protein CE, the primer shown in table 1 is designed and synthesized, for the CE gene that increases.

Table 1 is for the primer of the CE gene that increases

The full genome synthesis PCR of the fragment KC 2, containing C gene

(1) these 10 primers of C101F, C101R, C102F, C102R, C103F, C103R, C104F, C104R, C105F, C10BAMH in table 1, mutually as primer and template, carry out first round pcr amplification, obtain first round pcr amplification product.

Concrete principle is as follows:

Primer C101F and C101R goes out fragment 1:5 '-CAATTCCATATGGCAGAGATGAAGACTGATGCAGCTACTCTGGCACAAGAAGCAGG TAACTTCGAACGTATCTCTGGTGACCTGAAAACCCAGATC-3 ' as primer and template amplification mutually;

Primer C102F and C102R goes out fragment 2:5 '-GTGACCTGAAAACCCAGATCGATCAGGTTGAATCTACTGCAGGTTCTCTGCAGGGT CAATGGCGTGGTGCTGCAGGTAC-3 ' as primer and template amplification mutually;

Primer C103F and C103R goes out fragment 3:5 '-GCGTGGTGCTGCAGGTACTGCTGCACAAGCTGCAGTTGTACGTTTCCAAGAAGCAG CCAATAAGCAGAAGCAGGAACTGGATGAAATCTCTACTAACA-3 ' as primer and template amplification mutually;

Primer C104F and C104R goes out fragment 4:5 '-CTGGATGAAATCTCTACTAACATTCGTCAGGCAGGTGTTCAATACTCTCGTGCTGA TGAAGAGCAACAGCAAGCACTGAGC-3 ' as primer and template amplification mutually;

Primer C105F and C10BAMH goes out fragment 5:5 '-GCAACAGCAAGCACTGAGCTCTCAAATGGGTTTC as primer and template amplification mutually gGTGGTGGCGGATCCTAATAAACTCGAGCGG-3 ';

With fragment 1 and fragment 2 for template, with C101F and C102R for primer, amplify fragment 1+2:5 '-CAATTC cATATGgCAGAGATGAAGACTGATGCAGCTACTCTGGCACAAGAAGCAGGTAACTTCGAACG TATCTCTGGTGACCTGAAAACCCAGATCGATCAGGTTGAATCTACTGCAGGTTCTC TGCAGGGTCAATGGCGTGGTGCTGCAGGTAC-3 ';

With fragment 1+2 and amplified fragments 3 for template, with C101F and C103R for primer, amplify fragment 1+2+3:

5’-CAATTC CATATGGCAGAGATGAAGACTGATGCAGCTACTCTGGCACAAGAAGCAGGTAACTTCGAACGTATCTCTGGTGACCTGAAAACCCAGATCGATCAGGTTGAATCTACTGCAGGTTCTCTGCAGGGTCAATGGCGTGGTGCTGCAGGTACTGCTGCACAAGCTGCAGTTGTACGTTTCCAAGAAGCAGCCAATAAGCAGAAGCAGGAACTGGATGAAATCTCTACTAACA-3’；

With amplified fragments 1+2+3 and amplified fragments 4 for template, with C101F and C104R for primer, amplify fragment 1+2+3+4:

5’-CAATTC CATATGGCAGAGATGAAGACTGATGCAGCTACTCTGGCACAAGAAGCAGGTAACTTCGAACGTATCTCTGGTGACCTGAAAACCCAGATCGATCAGGTTGAATCTACTGCAGGTTCTCTGCAGGGTCAATGGCGTGGTGCTGCAGGTACTGCTGCACAAGCTGCAGTTGTACGTTTCCAAGAAGCAGCCAATAAGCAGAAGCAGGAACTGGATGAAATCTCTACTAACATTCGTCAGGCAGGTGTTCAATACTCTCGTGCTGATGAAGAGCAACAGCAAGCACTGAGC-3’；

With amplified fragments 1+2+3+4 and amplified fragments 5 for template, with C101F and C10BAMH for primer, amplify fragment 1+2+3+4+5 (this fragment contains C gene and part connecting arm):

5’-CAATTC CATATGGCAGAGATGAAGACTGATGCAGCTACTCTGGCACAAGAAGCAGGTAACTTCGAACGTATCTCTGGTGACCTGAAAACCCAGATCGATCAGGTTGAATCTACTGCAGGTTCTCTGCAGGGTCAATGGCGTGGTGCTGCAGGTACTGCTGCACAAGCTGCAGTTGTACGTTTCCAAGAAGCAGCCAATAAGCAGAAGCAGGAACTGGATGAAATCTCTACTAACATTCGTCAGGCAGGTGTTCAATACTCTCGTGCTGATGAAGAGCAACAGCAAGCACTGAGCTCTCAAATGGGTTTC GGTGGTGGCGGATC-3’。

The reaction system of first round PCR: 10 × PCR damping fluid 5 μ l, dNTPs4 μ l, primer C101F5 μ l, primer C101R0.5 μ l, primer C102F0.5 μ l, primer C102R0.5 μ l, primer C103F0.5 μ l, primer C103R0.5 μ l, primer C104F0.5 μ l, primer C104R0.5 μ l, primer C105F0.5 μ l, primer C10BAMH5 μ l, PyrobestTMDNA polysaccharase 1 μ l, sterilized water 26 μ l, amount to 50 μ l.

The reaction conditions of first round PCR: 95 DEG C of denaturation 5min; 94 DEG C of sex change 30s, 50 DEG C of annealing 30s, 72 DEG C extend 2min, 30 circulations; 72 DEG C extend 10min; 16 DEG C of cooling 2min.

(2) using 1 μ l first round pcr amplification product as template, be primer with C10FF and C10BAMRR in table 1, carry out second and take turns pcr amplification, obtain second and take turns pcr amplification product (that is, the fragment KC containing C gene), sequence is as follows:

5’-CCAATTC CATATGGCAGAGATGAAGACTGATGCAGCTACTCTGGCACAAGAAGCAGGTAACTTCGAACGTATCTCTGGTGACCTGAAAACCCAGATCGATCAGGTTGAATCTACTGCAGGTTCTCTGCAGGGTCAATGGCGTGGTGCTGCAGGTACTGCTGCACAAGCTGCAGTTGTACGTTTCCAAGAAGCAGCCAATAAGCAGAAGCAGGAACTGGATGAAATCTCTACTAACATTCGTCAGGCAGGTGTTCAATACTCTCGTGCTGATGAAGAGCAACAGCAAGCACTGAGCTCTCAAATGGGTTTC GGTGGTGGCGGATCCTAATAAACTCGAGCGG-3’。

Second reaction system of taking turns PCR: first round pcr amplification product 1 μ l, 10 × PCR damping fluid 5 μ l, dNTPs4 μ l, primer C10FF5 μ l, primer C10BAMRR5 μ l, archaeal dna polymerase 1 μ l, sterilized water 29 μ l, amount to 50 μ l.

(3) electrophoresis reclaims object fragment

Step (2) obtained second takes turns pcr amplification product carries out 1% agarose gel electrophoresis, and result as shown in Figure 1.

In Fig. 1,1:DNA molecular weight standard (from top to bottom stripe size is followed successively by 500bp, 400bp, 300bp, 200bp, 150bp, 100bp, 50bp); 2: what step (2) obtained second takes turns pcr amplification product; Arrow indication is the fragment KC containing C gene.

Under UVA Radiation, on glue, cut the agar block of the fragment KC containing C gene that will reclaim with clean knife blade, put into aseptic centrifuge tube.The specification sheets reclaimed in test kit with reference to agarose DNA reclaims this fragment and checks order, and sequencing result is correct, quantitatively, be stored in-20 DEG C for subsequent use.

The full genome synthesis PCR of the fragment KE 3, containing E gene

(1) these 11 primers of E6BGLF, E61F, E61R, E62F, E62R, E63F, E63R, E64F, E64R, E65F, E65R in table 1, mutually as primer and template, carry out first round pcr amplification, obtain first round pcr amplification product.

Concrete principle is as follows:

Primer E61F and E61R goes out fragment 6 as primer and template amplification mutually:

5’-AATTCCAT

ATGACCGAACAGCAGTGGAACTTCGCAGGTATCGAAGCTGCAGCTTCTGCTATTCAGGGTAACGTTACCTC-3’；

Primer E62F and E62R goes out fragment 7 as primer and template amplification mutually:

5’-TATTCAGGGTAACGTTACCTCTATCCACTCTCTGCTGGATGAAGGTAAACAGTCTCTGACCAAACTGGCAGCTGCATGGGGTGGTTCTGG-3’；

Primer E63F and E63R goes out fragment 8 as primer and template amplification mutually:

5’-CTGCATGGGGTGGTTCTGGTTCTGAAGCTTACCAGGGTGTTCAGCAGAAATGGGATGCTACCGCAACCGAACTGAACAACGCAC-3’；

Primer E64F and E64R goes out fragment 9 as primer and template amplification mutually:

5’-AACCGAACTGAACAACGCACTGCAGAACCTGGCTCGTACCATCTCTGAAGCTGGTCAGGCTATGGCTTCTACCGAAGGTAACGTTACT-3’；

Primer E65F and E65R goes out fragment 10 as primer and template amplification mutually:

5’-TCTACCGAAGGTAACGTTACTGGTATGTTCGCT TAAA CTCGAGCGG-3’；

With amplified fragments 6 for template, with E6BGLF and E61R for primer, amplify fragment 11:

5’-GCAATTCCATATGA GATCTGGTGGCGGTATGACCGAACAGCAGTGGAACTTCGCAGGTATCGAAGCTGCAGCTTCTGCTATTCAGGGTAACGTTACCTC-3’；

With amplified fragments 11 and amplified fragments 7 for template, with E6BGLF and E62R for primer, amplify fragment 11+7:

5’-GCAATTCCATATGA GATCTGGTGGCGGTATGACCGAACAGCAGTGGAACTTCGCAGGTATCGAAGCTGCAGCTTCTGCTATTCAGGGTAACGTTACCTCTATCCACTCTCTGCTGGATGAAGGTAAACAGTCTCTGACCAAACTGGCAGCTGCATGGGGTGGTTCTGG-3’；

With amplified fragments 11+7 and amplified fragments 8 for template, with E6BGLF and E63R for primer, amplify fragment 11+7+8:

5’-GCAATTCCATATGA GATCTGGTGGCGGTATGACCGAACAGCAGTGGAACTTCGCAGGTATCGAAGCTGCAGCTTCTGCTATTCAGGGTAACGTTACCTCTATCCACTCTCTGCTGGATGAAGGTAAACAGTCTCTGACCAAACTGGCAGCTGCATGGGGTGGTTCTGGTTCTGAAGCTTACCAGGGTGTTCAGCAGAAATGGGATGCTACCGCAACCGAACTGAACAACGCAC-3’；

With amplified fragments 11+7+8 and amplified fragments 9 for template, with E6BGLF and E64R for primer, amplify fragment 11+7+8+9:

5’-GCAATTCCATATGA GATCTGGTGGCGGTATGACCGAACAGCAGTGGAACTTCGCAGGTATCGAAGCTGCAGCTTCTGCTATTCAGGGTAACGTTACCTCTATCCACTCTCTGCTGGATGAAGGTAAACAGTCTCTGACCAAACTGGCAGCTGCATGGGGTGGTTCTGGTTCTGAAGCTTACCAGGGTGTTCAGCAGAAATGGGATGCTACCGCAACCGAACTGAACAACGCACTGCAGAACCTGGCTCGTACCATCTCTGAAGCTGGTCAGGCTATGGCTTCTACCGAAGGTAACGTTACT-3’；

With amplified fragments 11+7+8+9 and amplified fragments 10 for template, with E6BGLF and E65R for primer, amplify fragment 11+7+8+9+10 (this fragment contains E gene):

5’-GCAATTCCATATGA GATCTGGTGGCGGTATGACCGAACAGCAGTGGAACTTCGCAGGTATCGAAGCTGCAGCTTCTGCTATTCAGGGTAACGTTACCTCTATCCACTCTCTGCTGGATGAAGGTAAACAGTCTCTGACCAAACTGGCAGCTGCATGGGGTGGTTCTGGTTCTGAAGCTTACCAGGGTGTTCAGCAGAAATGGGATGCTACCGCAACCGAACTGAACAACGCACTGCAGAACCTGGCTCGTACCATCTCTGAAGCTGGTCAGGCTATGGCTTCTACCGAAGGTAACGTTACTGGTATGTTCGCT TAAA CTCGAGCGG-3’。

The reaction system of first round PCR: 10 × PCR damping fluid 5 μ l, dNTPs4 μ l, primer E6BGLF5 μ l, primer E61F0.5 μ l, primer E61R0.5 μ l, primer E62F0.5 μ l, primer E62R0.5 μ l, primer E63F0.5 μ l, primer E63R0.5 μ l, primer E64F0.5 μ l, primer E64R0.5 μ l, primer E65F0.5 μ l, primer E65R5 μ l, archaeal dna polymerase 1 μ l, sterilized water 26 μ l, amount to 50 μ l.

(2) using 1 μ l first round pcr amplification product as template, be primer with E6BGLFF and E65R in table 1, carry out second and take turns pcr amplification, obtain second and take turns pcr amplification product (that is, the fragment KE containing E gene), sequence is as follows:

Second reaction system of taking turns PCR: first round pcr amplification product 1 μ l, 10 × PCR damping fluid 5 μ l, dNTPs4 μ l, primer E6BGLFF5 μ l, primer E65R5 μ l, archaeal dna polymerase 1 μ l, sterilized water 29 μ l, amount to 50 μ l.

(3) electrophoresis reclaims object fragment:

Step (2) obtained second takes turns pcr amplification product carries out 1% agarose gel electrophoresis, and result as shown in Figure 2.

In Fig. 2,1:DNA molecular weight standard (from top to bottom stripe size is followed successively by 500bp, 400bp, 300bp, 200bp, 150bp, 100bp, 50bp); 2: what step (2) obtained second takes turns pcr amplification product; Arrow indication is the fragment KE containing E gene.

Under UVA Radiation, on glue, cut the agar block of the fragment KE containing E gene that will reclaim with clean knife blade, put into aseptic centrifuge tube.The specification sheets reclaimed in test kit with reference to agarose DNA reclaims this fragment and checks order, and sequencing result is correct, quantitatively, be stored in-20 DEG C for subsequent use.

The connection of the fragment KC 4, containing C gene and the fragment KE containing E gene

(1) cut with BamHI enzyme the fragment KC containing C gene that step 2 obtains, obtain digestion products 1.It is as follows that enzyme cuts system: the fragment KC15 μ l containing C gene, 10 × K damping fluid 3 μ l, BamHI1 μ l, sterilized water 11 μ l, amount to 30 μ l.

(2) cut with BglII enzyme the fragment KE containing E gene that step 3 obtains, obtain digestion products 2.It is as follows that enzyme cuts system: the fragment KE15 μ l containing E gene, 10 × H damping fluid 3 μ l, BglII1 μ l, sterilized water 11 μ l, amount to 30 μ l.

(3) digestion products 1 is connected with digestion products 2 T4DNA ligase enzyme, obtains and connect product.Linked system is as follows: digestion products 110 μ l, digestion products 210 μ l, 10 × connection damping fluid 3 μ l, T4DNA ligase enzyme 1 μ l, sterilized water

6 μ l, amount to 30 μ l.

(4) what obtain by step (3) connects product as template, is primer with C101F and E65R in table 1, carries out pcr amplification, obtains pcr amplification product (the fragment KCE containing CE gene).The reaction system of PCR: connect product 1 μ l, 10 × PCR damping fluid 5 μ l, dNTPs4 μ l, primer C101F1 μ l, primer E65R1 μ l, archaeal dna polymerase 1 μ l, sterilized water 37 μ l, amount to 50 μ l.

Fragment KCE sequence containing CE gene is as follows:

5’-CAATTC CATATGGCAGAGATGAAGACTGATGCAGCTACTCTGGCACAAGAAGCAGGTAACTTCGAACGTATCTCTGGTGACCTGAAAACCCAGATCGATCAGGTTGAATCTACTGCAGGTTCTCTGCAGGGTCAATGGCGTGGTGCTGCAGGTACTGCTGCACAAGCTGCAGTTGTACGTTTCCAAGAAGCAGCCAATAAGCAGAAGCAGGAACTGGATGAAATCTCTACTAACATTCGTCAGGCAGGTGTTCAATACTCTCGTGCTGATGAAGAGCAACAGCAAGCACTGAGCTCTCAAATGGGTTTC GGTGGTGGCGGATCTGGTGGCGGTATGACCGAACAGCAGTGGAACTTCGCAGGTATCGAAGCTGCAGCTTCTGCTATTCAGGGTAACGTTACCTCTATCCACTCTCTGCTGGATGAAGGTAAACAGTCTCTGACCAAACTGGCAGCTGCATGGGGTGGTTCTGGTTCTGAAGCTTACCAGGGTGTTCAGCAGAAATGGGATGCTACCGCAACCGAACTGAACAACGCACTGCAGAACCTGGCTCGTACCATCTCTGAAGCTGGTCAGGCTATGGCTTCTACCGAAGGTAACGTTACTGGTATGTTCGCT TAAA CTCGAGCGG-3’(SEQIDNo.3)

This fragment also can direct labor's synthesis.

(5) electrophoresis reclaims object fragment

The pcr amplification product (the fragment KCE containing CE gene) step (4) obtained carries out 1% agarose gel electrophoresis, and result as shown in Figure 3.

In Fig. 3,1: the pcr amplification product (the fragment KCE containing CE gene) that step (4) obtains; 2:DNA molecular weight standard (from top to bottom stripe size is followed successively by 10000bp, 7000bp, 4000bp, 2000bp, 1000bp, 500bp, 250bp).

Under UVA Radiation, on glue, cut the agar block of the fragment KCE containing CE gene that will reclaim with clean knife blade, put into aseptic centrifuge tube.The specification sheets reclaimed in test kit with reference to agarose DNA reclaims this fragment and checks order, and sequencing result is correct, quantitatively, be stored in-20 DEG C for subsequent use.

5, the structure of expression vector

The fragment KCE containing CE gene step 4 obtained is cloned in pET-30a (+) (invitrogen Products) carrier, again by its transformation of E. coli BL21 (DE3) Host Strains (Dalian TaKaRa Products), obtain the CE/pET-30a colibacillus engineering of expressing recombination fusion protein CE through screening.

Concrete steps are as follows:

(1) enzyme is cut

The fragment KCE containing CE gene step 4 obtained and pET-30a (+) expression vector carry out double digestion with NdeI and XhoI respectively.

Two enzyme systems of cutting are distinguished as follows:

Enzyme cuts system 1: the fragment KCE3 μ l containing CE gene, 10 × H damping fluid 8 μ l, NdeI2 μ l, XhoI2 μ l, sterilized water 65 μ l, amount to 80 μ l.

Enzyme cuts system 2:pET-30a (+) 3 μ l, 10 × H damping fluid 8 μ l, NdeI2 μ l, XhoI2 μ l, sterilized water

65 μ l, amount to 80 μ l.

Two enzyme systems of cutting are placed in 37 DEG C and hatch 3h, obtain the digestion products of the fragment KCE containing CE gene and the digestion products of pET-30a (+) plasmid respectively.

(2) electrophoresis reclaims object fragment

The digestion products of the digestion products of pET-30a (+) plasmid step (1) obtained and the fragment KCE containing CE gene carries out 1% agarose gel electrophoresis, under UVA Radiation, on glue, cut the agar block that will reclaim DNA with clean knife blade, put into aseptic centrifuge tube.The enzyme that the enzyme reclaiming the fragment KCE containing CE gene obtaining 615bp with reference to the agarose DNA specification sheets reclaimed in test kit respectively cuts back to close pET-30a (+) plasmid of fragment and 5234bp cuts back to close fragment.

The digestion products of pET-30a (+) plasmid, pET-30a (+) plasmid, the enzyme of pET-30a (+) plasmid are cut back to close fragment, the fragment KCE containing CE gene, the digestion products of the fragment KCE containing CE gene, the fragment KCE containing CE gene enzyme cut back to close fragment and carry out 1% agarose gel electrophoresis, result is as shown in Figure 4.

In Fig. 4,1:DNA molecular weight standard; 2:pET-30a (+) plasmid; The digestion products of 3:pET-30a (+) plasmid; The enzyme of 4:pET-30a (+) plasmid cuts back to close fragment; 5: the fragment KCE containing CE gene; 6: the digestion products of the fragment KCE containing CE gene; 7: the enzyme of the fragment KCE containing CE gene cuts back to close fragment.

Fig. 4 shows, the digestion products of pET-30a (+) and the fragment KCE containing CE gene is all recycled, and purity is better.

(3) gene fragment connects

The enzyme that the enzyme of fragment KCE containing CE gene step (2) being reclaimed purifying cuts back to close fragment and pET-30a (+) plasmid cut back to close fragment quantitatively after, by the mixed in molar ratio of 1:1, carry out following ligation, obtain connection product.

Ligation system (10 μ l): the 2 × enzyme that connects damping fluid 5 μ l, A/pET-30a (+) plasmid cuts back to close the enzyme that fragment 1 μ l, B/ contain the fragment KCE of CE gene and cuts back to close fragment 1 μ l, T ₄dNA ligase 1 μ l, sterilized water are mended to 10 μ l.Mixing is placed on 16 DEG C of connections and spends the night, and 75 DEG C of deactivation 10min, directly transform after ice bath.

(4) conversion of product is connected

Getting the connection product 5 μ l that step (3) obtains next day adds in the centrifuge tube containing 100 μ l e. coli bl21 (DE3) competent cells, ice bath 0.5h; Put into 42 DEG C of water bath heat-shocked 90s, take out ice bath 2min rapidly; Add LB nutrient solution 400 μ l, 37 DEG C of constant-temperature tables cultivate 1h; Add X-Gal60 μ l, IPTG4 μ l, mixing, take out 200-400 μ l and coat on the LB flat board containing 50 μ g/ml sulphuric acid kanamycins.Be inverted dull and stereotyped, put 37 DEG C of constant incubators cultivations and spend the night to single colony growth.

(5) extraction of plasmid

Screen according to blue hickie, random picking 2 single bacterium colonies of white, respectively called after pET-30a-CE-1 bacterium colony and pET-30a-CE-2 bacterium colony, and be inoculated in 5ml respectively and contain in the LB liquid nutrient medium of 50 μ g/ml kantlex, 37 DEG C of constant-temperature shaking culture are spent the night.According to " molecular cloning " alkaline lysis method, extract plasmid in a small amount, obtain recombinant plasmid pET-30a-CE-1 and pET-30a-CE-2 respectively.Recombinant plasmid pET-30a-CE-1 and pET-30a-CE-2 is carried out agarose gel electrophoresis analysis, and result as shown in Figure 5.

In Fig. 5,1:DNA molecular weight standard; 2: vector plasmid pET-30a (+); 3: recombinant plasmid pET-30a-CE-1; 4: recombinant plasmid pET-30a-CE-2.

Fig. 5 shows, the size of recombinant plasmid pET-30a-CE-1 with pET-30a-CE-2 all conforms to expection.Checked order further by recombinant plasmid pET-30a-CE-1 and pET-30a-CE-2, sequencing result shows that the size of recombinant plasmid is 5857bp.

(6) qualification of recombinant plasmid

1. enzyme cuts qualification

Respectively with recombinant plasmid pET-30a-CE-1 and pET-30a-CE-2 for template, carry out double digestion qualification with NdeI and XhoI.By digestion products electrophoresis in 1% sepharose, result as shown in Figure 6.

In Fig. 6, M:DL2000DNAMarker; The NdeI+XhoI double digestion product of 1: the fragment KCE containing CE gene; The NdeI+XhoI double digestion product of 2: recombinant plasmid pET-30a-CE-1; The NdeI+XhoI double digestion product of 3: recombinant plasmid pET-30a-CE-2.

Fig. 6 shows, the endonuclease bamhi size of recombinant plasmid conforms to expection (clip size containing CE gene is 615bp), is positive recombinant plasmid.By this kind of plasmid called after CE/pET-30a, the bacterium called after CE/pET-30a colibacillus engineering in its source.

2. sequencing

Select CE/pET-30a colibacillus engineering clone to serve Hai Sheng work Bioisystech Co., Ltd and carry out the order-checking of T7 universal primer forward, Sequencing chromatogram as shown in Figure 7.

Sequencing result is as shown in SEQIDNo.4.In SEQIDNo.4, 54-59 position is that restriction endonuclease NdeI enzyme cuts recognition site 5 '-CATATG-3 ' (comprising initiator codon 5 '-ATG-3 '), 57-356 position is encoding gene (C gene) sequence of CFP10 Protein Epitopes, 357-380 position is the coding gene sequence 5 '-GGTGGTGGCGGATCTGGTGGCGGT-3 ' of connecting arm, 381-665 position is encoding gene (E gene) sequence of the 6 kDa early secretory antigenic target epitope after optimizing, 666-668 position is terminator codon 5 '-TAA-3 ', 670-675 position is that restriction endonuclease XhoI enzyme cuts recognition site 5 '-CTCGAG-3 '.Result shows, the CE gene order (i.e. 57-665 position in SEQIDNo.4) in CE/pET-30a plasmid is completely the same with the sequence (in SEQIDNo.1 4-612 position) of design.

5’-GGGCGGAACATTCCCTCTAGAATAATTTTGTTTAACTTTAAGAAGGAGATATA CATATGGCAGAGA TGAAGACTGATGCAGCTACTCTGGCACAAGAAGCAGGTAACTTCGAACGTATCTCTGGTGACCTGAAAACCCAGATC GATCAGGTTGAATCTACTGCAGGTTCTCTGCAGGGTCAATGGCGTGGTGCTGCAGGTACTGCTGCACAAGCTGCAGT TGTACGTTTCCAAGAAGCAGCCAATAAGCAGAAGCAGGAACTGGATGAAATCTCTACTAACATTCGTCAGGCAGGTG TTCAATACTCTCGTGCTGATGAAGAGCAACAGCAAGCACTGAGCTCTCAAATGGGTTTCGGTGGTGGCGGATCTGGT GGCGGTATGACCGAACAGCAGTGGAACTTCGCAGGTATCGAAGCTGCAGCTTCTGCTATTCAGGGTAACGTTACCTC TATCCACTCTCTGCTGGATGAAGGTAAACAGTCTCTGACCAAACTGGCAGCTGCATGGGGTGGTTCTGGTTCTGAAG CTTACCAGGGTGTTCAGCAGAAATGGGATGCTACCGCAACCGAACTGAACAACGCACTGCAGAACCTGGCTCGTACC ATCTCTGAAGCTGGTCAGGCTATGGCTTCTACCGAAGGTAACGTTACTGGTATGTTCGCTTAAACTCGAGCACCACCACCACCACCACTGAGATC-3’(SEQIDNo.4)

Three, the abduction delivering of CE/pET-30a colibacillus engineering and qualification

1, CE/pET-30a colibacillus engineering is inoculated in 6ml containing in the LB nutrient solution of 50 μ g/ml sulphuric acid kanamycins, put 37 DEG C, 200rpm constant temperature oscillator cultivates after 8h, by volume percentage composition 1% transferred species is to 50ml containing in the LB nutrient solution of 50 μ g/ml sulphuric acid kanamycins, puts 37 DEG C, 200rpm constant temperature oscillator is cultured to OD ₆₀₀during for 0.6-0.9, add the IPTG that final concentration is 0.5mmol/L, induction 1-4hr, obtains bacterium liquid.

1 × loading buffer 10 μ l is added the precipitation sample from 40 μ l bacterium liquid, after suspendible, put 100 DEG C of boiling water bath 5min, after the centrifugal 5min of 10000rpm, get supernatant liquor 10 μ l and carry out SDS-PAGE (resolving gel concentration is 12%, and concentrated gum concentration is 5%), deposition condition is: spacer gel constant voltage 80V, separation gel constant voltage 120V, treats bottom tetrabromophenol sulfonphthalein electrophoresis to gel, stops electrophoresis.With coomassie brilliant blue R250 staining fluid dyeing 6h, clear to band with destainer decolouring.

SDS-PAGE result before and after CE/pET-30a colibacillus engineering IPTG induces as shown in Figure 8.

In Fig. 8,1: protein molecular weight standard; Before 2:CE/pET-30a colibacillus engineering IPTG induces; 3:CE/pET-30a colibacillus engineering IPTG induces 1 hour; 4:CE/pET-30a colibacillus engineering IPTG induces 2 hours; 5:CE/pET-30a colibacillus engineering IPTG induces 3 hours; 6:CE/pET-30a colibacillus engineering IPTG induces 4 hours; Arrow indication is the band of recombination fusion protein CE.

Fig. 8 shows, CE/pET-30a colibacillus engineering thalline has dense band of expression to occur near relative molecular mass 21035Da position, and IPTG induces 3-4 hour expression amount maximum.

2, expression condition and expression-form qualification

CE/pET-30a colibacillus engineering is inoculated in 10ml containing in the LB nutrient solution of 50 μ g/ml sulphuric acid kanamycins, after putting 37 DEG C of constant temperature oscillator incubated overnight, by volume percentage composition 1% transferred species is to 2 bottles of 50ml containing in the LB nutrient solution of 50 μ g/ml sulphuric acid kanamycins, puts 37 DEG C of constant temperature oscillators and is cultured to OD ₆₀₀during for 0.6-0.8, add the IPTG that final concentration is 0.5mmol/L, carry out induction 4hr respectively at 37 DEG C with 15 DEG C, obtain the bacterium liquid after the bacterium liquid after CE/pET-30a colibacillus engineering 37 DEG C induction and 15 DEG C of inductions respectively.Respectively by the thalline ultrasonication in bacterium liquid, after centrifugal, obtain the upper cleer and peaceful precipitation after the upper cleer and peaceful precipitation after CE/pET-30a colibacillus engineering 37 DEG C induction and CE/pET-30a colibacillus engineering 15 DEG C induction, each cleer and peaceful precipitation is carried out SDS-PAGE electrophoretic analysis respectively, and partial results as shown in Figure 9.

In Fig. 9,1: protein molecular weight standard (TaKaRa-D530A: stripe size is followed successively by 97.2,66.4,44.3,29.0,20.1kDa from top to bottom); Supernatant after 2:CE/pET-30a colibacillus engineering 37 DEG C induction; Supernatant after 3:CE/pET-30a colibacillus engineering 15 DEG C induction.

Fig. 9 shows, CE/pET-30a colibacillus engineering is all present in the supernatant of its bacterium liquid at 37 DEG C of recombination fusion protein CE with 15 DEG C of secreting, expressings.

Four, recombination fusion protein CE high-density, high expression level fermentation

1, CE/pET-30a colibacillus engineering (recombinant bacterium) is carried out to the high density fermentation of 100L fermentor tank, carry out IPTG induction at logarithmic phase, after induction, 4h puts tank.

Fermenting process is as follows:

(1) seed culture

The CE/pET-30a colibacillus engineering preserved in glycerine pipe access is equipped with in the 500ml Erlenmeyer flask of 200mlLB substratum (kantlex containing 50 μ g/ml) by the inoculum size with 0.1%, 200r/min, cultivates 8-12h to OD for 37 DEG C ₆₀₀reach 3.0-6.0, obtain seed liquor.

(2) fermentor cultivation

1. the formula of fermention medium and supplemented medium is as shown in table 2.

The formula of table 2 fermention medium and supplemented medium

2. seed liquor step (1) obtained is inoculated in fermention medium carries out fermentation culture according to the inoculum size of 2%, culture temperature 37 DEG C, pH6.8, control dissolved oxygen scope, at 30-80%, adopt exponential fed-batch feeding strategy (be less than 1g/L for standard adjustment feed supplement with the sugared content of the nutrient solution of fermentation culture and add speed).OD ₆₀₀start abduction delivering when reaching 25-35, inductor IPTG final concentration is 0.5mM, stops fermentation culture after induction 4h.Adopt 100L fermentor tank cultured continuously 5 batches, result is as shown in table 3.

Table 3 Fermentation Process of Parameter record

2, getting CE/pET-30a colibacillus engineering IPTG in step 1 respectively induces the fermented liquid of the fermented liquid of rear 1h, 2h, 3h and 4h and the CE/pET-30a colibacillus engineering before inducing to carry out thalline ultrasonication, the supernatant of the fermented liquid of the CE/pET-30a colibacillus engineering before centrifugal cleer and peaceful induction of getting the fermented liquid of the induction of CE/pET-30a colibacillus engineering 1h, 2h, 3h and 4h respectively carries out SDS-PAGE analysis, and result as shown in Figure 10.

In Figure 10,1: Protein Marker; 2: the supernatant of the fermented liquid of the CE/pET-30a colibacillus engineering before induction; 3-6 represents the supernatant of the fermented liquid of the induction of CE/pET-30a colibacillus engineering 1h, 2h, 3h and 4h respectively; Arrow indication is the band of recombination fusion protein CE.

Result shows, during IPTG induction 4h, the expression amount of recombination fusion protein CE reaches maximum, and target protein expression amount is greater than 4g/L.

Five, the Isolation and characterization of recombination fusion protein CE

1, microorganism collection and fragmentation

Adopt tubular-bowl centrifuge to collect CE/pET-30a colibacillus engineering thalline, then by thalline by volume 1: 5 ratio be resuspended in 20mMTris damping fluid (pH8.0), with the broken thalline of 12000psi homogenization pressure 2 times.

2, supernatant collection

The centrifugal 20min of 10000rpm is adopted to collect broken rear supernatant liquor.

3, ultrafiltration and concentration I

After coli somatic fragmentation, discharge a large amount of impurity and the volume of feed liquid is comparatively large, be unfavorable for Image processing, therefore first adopt hyperfiltration process to carry out initial gross separation and concentrated.

Recombination fusion protein CE albumen theoretical molecular is 21,035Da, therefore 300KD ultra-filtration membrane is first selected to dialyse, to retain centrifugal residual micro-solid substance and part macromolecule impurity, then 5KD ultra-filtration membrane is adopted to carry out concentrated to remove small molecular weight impurity, buffer exchange is carried out with 3-5 times of displacement liquid I (20mMTris, pH8.0) when being concentrated into 3-5 times of volume.

4, DEAEsepharoseFastFlow column purification

Adopt damping fluid C1A phase (20mMTris, pH8.0) and C1B phase (20mMTris, 0.3MNaCl, pH8.0).To balance each other anion-exchange column DEAEsepharoseFastFlow post (internal diameter of post is a 200mm) 2.0-4.0 column volume with C1A, collect balance liquid; Concentrated solution upper prop step 3 obtained, collects and passes liquid; Adopt 0-70%B linear gradient elution, collect elutriant, elution volume is 10 column volumes, and flow velocity is 30L/h, and determined wavelength is 280nm.Carry out RP-HPLC analysis to the main peak of elutriant, RP-HPLC analysis condition is: C4 analytical column (model KromasilC4300-5C4), temperature 30 DEG C, determined wavelength 214nm, flow velocity 1mL/min.Carry out gradient elution (wherein mobile phase A is 0.1% trifluoroacetic acid-aqueous solution, and Mobile phase B is 0.08% trifluoroacetic acid-acetonitrile solution) by table 4, obtain main peak albumen.Result as shown in figure 11.

Table 4 elution program

5, AminobutylSepharose6FastFlow column purification

Adopt damping fluid C2A phase (20mMTris, pH8.0) and C2B phase (20mMTris, 0.3MNaCl, pH8.0).To balance each other ion exchange column AminobutylSepharose6FastFlow post (internal diameter of post is a 100mm) 2.0-4.0 column volume with C2A, main peak albumen C2A phase dilution 1-2 times of upper prop that step 4 is obtained, 20%B-70%B linear gradient elution after employing 20%C2B phase prewashing 1.5-2.0 column volume, collect elutriant, elution volume is 10 column volumes, flow velocity is 15L/h, and determined wavelength is 280nm.Carry out RP-HPLC analysis to the main peak of elutriant, RP-HPLC analysis condition is: C4 analytical column (model KromasilC4300-5C4), temperature 30 DEG C, determined wavelength 214nm, flow velocity 1mL/min.Carry out gradient elution (wherein mobile phase A is 0.1% trifluoroacetic acid-aqueous solution, and Mobile phase B is 0.08% trifluoroacetic acid-acetonitrile solution) by table 5, obtain main peak albumen.Result as shown in figure 12.

Table 5 elution program

6, ultrafiltration and concentration II

The main peak albumen collected after the AminobutylSepharose6FastFlow chromatography of step 5, adopts 5KD ultra-filtration membrane to carry out buffer exchange.First, after target protein being concentrated 3-5 times of volume, displacement liquid II (20mMTris, pH8.0 solution) is then used to replace below 3-5 times of volume to permeate conductance to 2.0.

7, QSepharoseHighPerformance column purification

Adopt damping fluid C3A phase (20mMTris, pH8.0) and C3B phase (20mMTris, 0.3MNaCl, pH8.0).To balance each other ion exchange column QSepharoseHighPerformance post (internal diameter of post is a 50mm) 2.0-4.0 column volume with C3A, collect balance liquid, the concentrated solution upper prop that step 6 is obtained, collection passes liquid, adopt 0-70%B linear gradient elution, collect elutriant, elution volume is 10 column volumes, and flow velocity is 30L/h.Determined wavelength is 280nm.Carry out RP-HPLC analysis to the main peak of elutriant, RP-HPLC analysis condition is: C4 analytical column (model KromasilC4300-5C4), temperature 30 DEG C, determined wavelength 214nm, flow velocity 1mL/min.Carry out gradient elution (wherein mobile phase A is 0.1% trifluoroacetic acid-aqueous solution, and Mobile phase B is 0.08% trifluoroacetic acid-acetonitrile solution) by table 6, collect main peak albumen.Result as shown in figure 13.

Table 6 elution program

8, ultrafiltration and concentration III

Main peak albumen is collected after the QSepharoseHighPerformance chromatography of step 7,1.0-1.5L is concentrated into through 5KD ultra-filtration membrane, with displacement liquid III (5.488g/L Sodium Citrate (two water), 0.281g/L Citric Acid (water), 0.4g/L Polysorbate 20, pH6.3) replace 12-15 times of volume, controlling final concentrated solution cumulative volume is 1-1.5L.Final concentration 94.5g/L trehalose (two water) stirring and dissolving is added according to setting volume, regulate pH to 6.3 ± 0.1, finally use displacement liquid III (5.488g/L Sodium Citrate (two water), 0.281g/L Citric Acid (water), 0.4g/L Polysorbate 20, pH6.3) polishing to setting volume.

9, Sterile Filtration

Ultrafiltration and concentration liquid step 8 obtained filters through 0.22 μm of sterilizing filter and be stoste in aseptic PE bottle (Nalgene).Preserve in-70 ± 10 DEG C of lucifuge sealings, it is 24 months that validity period is fixed tentatively.

Six, the qualification of recombination fusion protein CE

1, the N of the recombination fusion protein CE of step 5 final purification holds 15 amino acid analysis results to be MAEMKTDAATLAQEA, and 15 aminoacid sequences held with recombination fusion protein CE (albumen shown in the SEQIDNo.2) N of design are completely the same.

2, the mass spectroscopy molecular weight of the recombination fusion protein CE of purifying is 21035Da, with the molecular weight 21035Da (molecular weight of the albumen shown in SEQIDNo.2) of Theoretical Calculation closely.

The recombination fusion protein CE of this embodiment step 5 final purification is adopted to carry out following embodiment 2 and 3.

The recombination fusion protein CE of embodiment 2, purifying is used for guinea pig skin test

The recombination fusion protein CE of purifying embodiment 1 prepared is used for the tuerculoderma of cavy, former as skin allergic reaction using it, obtain desirable delayed type hypersensitivity, specificity is higher than existing commercial purified protein derivative of tuberculin (PPD).

One, the cultivation of thalline and the preparation of hot deactivation thalline and quantitatively

Below operate and all aseptically carry out:

1, seed culture

By 13 kinds of bacterial strain type strain Mycobacterium tuberculosis H37Rvs (M.tuberculosis), bacill calmette-guerin (M.bovisBCG, be called for short BCG), mycobacterium tuberculosis var bovis (M.bovis), mycobacterium habana (M.simiae, ATCC25275), Soviet Union adds mycobacterium (M.szulgai, ATCC35799), mycobacterium gordonae (M.gordonae, ATCC14470), Mycobacterium intracellulare (M.intracellulare, ATCC13950), pale yellow mycobacterium (M.gilvum, ATCC43909), achromatic mycobacterium (M.nonchromogenicum, TMC1481), golden mycobacterium (M.aurum, ATCC23366), mycobacterium kansasii (M.kansasii, ATCC12478), micro-yellow mycobacterium (M.flavescens, and Mycobacterium phlei (M.phlei ATCC14474), ATCC11758) dry powder pipe mixes with sterilized water respectively, be seeded to modified Russell medium respectively, cultivate 3 weeks for 37 DEG C, etc. growing into cauliflower form, transferred species is led in the triangular pyramidal bottle of substratum in 50ml Soviet Union respectively again, putting 37 DEG C of cultivations makes its film forming grow for 3 weeks, as few in mycoderm growth, need transferred species again, until when mycoderm floats over media surface in flakes, enlarged culturing again.

2, enlarged culturing

The logical substratum 200ml of dress Soviet Union in each 500ml Erlenmeyer flask, by the mycoderm difference transferred species in the seed bottle of above-mentioned steps 1 above the logical medium liquid of Soviet Union, does not shake, makes mycoderm float over media surface as far as possible, cultivate 3-4 week for 37 DEG C.

3, bacterial strain deactivation

Each strain culturing bottle of step 2 is put 80 DEG C of hot deactivations of water bath with thermostatic control 3 hours.

4, thalline washing

Each bacterium liquid step 3 obtained, in the centrifugal 10min of 5000rpm, abandons supernatant, washs bacterium precipitation, three times repeatedly with aseptic PBS.Electronic balance takes each bacterial weight.

5, bacterial cell disruption

By each bacterium precipitation that appropriate aseptic PBS suspending step 4 obtains, ultrasonication thalline (totally 15 minutes) under condition of ice bath.

6, bacteria concentration is determined

With each thalline that aseptic PBS dilution step 5 obtains, bacteria concentration is made to be 20mg/ml (weight in wet base).Before use, add isopyknic Freund's incomplete adjuvant, make each mycobacterium final concentration be 10mg/ml, obtain the mycobacterium bacterium liquid of each deactivation.

Two, tuerculoderma

1, cavy sensitization

After cavy observes 7d, back cropping, carries out PPD skin test, and PPD skin test method is: intradermal injection 5IUPPD, and after injection, 24h, 48h, 72h observe injection site with or without red and swollen and Callosity reaction.If cavy that is reactionless or reaction very weak (diameter is less than 5mm), be then that PPD skin test is negative, for sensitization.

The cavy of PPD skin test feminine gender is divided into 13 groups at random, often organizes 6, male and female half and half.Often organize the mycobacterium bacterium liquid that cavy injects the deactivation that a kind of step one obtains respectively.Injection site: femoribus internus inguinal region; Injected dose: 0.5ml (5mg); Frequency injection: one week sensitization once, is total to sensitization four times.Prepare the Mycobacterium tuberculosis H37Rv group sensitized guinea pig of deactivation respectively, the bacill calmette-guerin (BCG) of deactivation organizes sensitized guinea pig, the mycobacterium tuberculosis var bovis group sensitized guinea pig of deactivation, the mycobacterium habana group sensitized guinea pig of deactivation, the Soviet Union of deactivation adds mycobacterium group sensitized guinea pig, the mycobacterium gordonae group sensitized guinea pig of deactivation, the Mycobacterium intracellulare group sensitized guinea pig of deactivation, the pale yellow mycobacterium group sensitized guinea pig of deactivation, the achromatic mycobacterium group sensitized guinea pig of deactivation, the golden mycobacterium group sensitized guinea pig of deactivation, the mycobacterium kansasii group sensitized guinea pig of deactivation, the micro-yellow mycobacterium group sensitized guinea pig of deactivation and the Mycobacterium phlei group sensitized guinea pig of deactivation.The PPD skin test of following steps 2 within one week, is carried out again after last sensitization.

2, wheel rim method tuerculoderma

For getting rid of cavy individual difference, with reference to " Products in China code ", wheel rim method is adopted to make a skin test.

6 sensitized guinea pigs of each group that respectively prepared by step 1, after clean hair is shaved at back, perform 5 tuerculoderma points mark successively, adopt volume be the aseptic PBS (negative control) of 0.1ml, 5IUPPD (positive control) reference liquid, the diluent of 1.0 μ g recombinant C FP10 albumen, the diluent of 1.0 μ g Recombinant ESAT6 albumen, the purifying of 1.0 μ g embodiments 1 preparations the diluent (all diluting with aseptic PBS) of recombination fusion protein CE carry out intradermal injection at every guinea pig back tuerculoderma point successively wheel rim.Respectively at 24h, 48h, 72h, double-blind method measures the longitudinal and transverse diameter of injection site skin erythema, and the mean value both calculating.

Three, experimental result

PBS (negative control) injection point local 24,48,72h is all without erythematous response, delayed type hypersensitivity (the delayedtypehypersensitivity of major part cavy injection point during 72h, DTH) diameter is less than 5mm, lose statistical significance, therefore no longer data statistics is carried out to the longitudinal and transverse diameter of PBS injection point and 72h.The Mycobacterium tuberculosis H37Rv group of deactivation and the bacill calmette-guerin (BCG) of deactivation are organized sensitized guinea pig 24h, 48hDTH and react diameter result as shown in table 7 and table 8, and the mycobacterium group sensitized guinea pig 24hDTH reaction mean diameter result of 13 groups of deactivations is as shown in table 9.

Mycobacterium tuberculosis H37Rv group sensitized guinea pig 24h, 48hDTH reaction (cm) of table 7 deactivation

The bacill calmette-guerin (BCG) of table 8 deactivation organizes sensitized guinea pig 24h, 48hDTH reaction (cm)

Table 9 different proteantigen skin test 24h respectively organizes the DTH reaction result of sensitized guinea pig

Time effect

The result of his-and-hers watches 7 is analyzed, SPSS software is adopted to carry out paired-samples T-test to the data of PPD, CFP10, ESAT6, CE antigen 24h, 48h respectively, result shows: the DTH reaction mean diameter of PPD, CFP10, ESAT6 and CE antigen 24h is all greater than DTH reaction mean diameter (P<0.05) of its 48h, and the DTH reaction mean diameter of 48h is all greater than the DTH mean diameter of its 72h.After visible injection, 24h is the Optimal observational duration of cavy skin test.

Sex-effects

The result of his-and-hers watches 7 and table 8 is analyzed.SPSS software is adopted to carry out Wilks'Lambda analysis between the Mycobacterium tuberculosis H37Rv group cavy male and female individuality of deactivation, result shows: no matter be investigate monoclonal antibody is former or investigates four antigens simultaneously, all do not have significant difference (Wilks'Lambda result P=0.6547>0.05) between sex.Same analysis is carried out to the bacill calmette-guerin group of deactivation, leads to the same conclusion, namely between sex, there is no significant difference (Wilks'Lambda result P=0.7119>0.05).

Recombinant protein antigen brings out the DTH reaction of the different mycobacterium sensitized guinea pigs of deactivation

The cavy local DTH of PPD (positive control) and each recombinant protein antigen react mean diameter >5mm for positive reaction.Table 9 shows, PPD can induce the cavy of the non-tuberculous mycobacteria sensitization of the mycobacterium tuberculosis complex of deactivation (comprising Mycobacterium tuberculosis H37Rv, bacill calmette-guerin and mycobacterium tuberculosis var bovis) and most of deactivation to produce strong skin reaction, only has the cavy of the non-tuberculous mycobacteria of minority deactivation (comprising mycobacterium kansasii, micro-yellow mycobacterium and Mycobacterium phlei) sensitization to produce weak skin reaction.And recombinant C E, ESAT6 and CFP10 albumen all only the induction Mycobacterium tuberculosis H37Rv group sensitized guinea pig of deactivation, the mycobacterium tuberculosis var bovis group sensitized guinea pig of deactivation produce strong skin reaction, and weak skin reaction is all only produced to the cavy of the bacill calmette-guerin of deactivation and other 10 kinds tested non-tuberculous mycobacteria sensitization.

Four, the routine tuberculosis patient of tuberculosis infection T cell Spot Jest (T-SPOT.TB) kit assay 72 of CE-ELISPOT test and the development of England Oxford immunological technique company is applied to the reaction of recombination fusion protein CE, Recombinant ESAT6 albumen, recombinant C FP10 albumen, comprising 45 routine pulmonary tuberculosis or be associated with the tuberculosis at other position, 18 routine bone tuberculosis and 9 routine dropsy of serous cavity patients, the 42 routine male sex, 30 routine women, the mean age 39.6 ± 18.5.Result is as shown in table 10.

Table 10 applies the routine tuberculosis patient of ELISPOT analysis of experiments 72 to the reaction result of CE, ESAT6, CFP10

Result shows, in 72 routine tuberculosis patients, it is 58.3% that the ELISPOT that recombination fusion protein CE stimulates tests positive rate, it is 44.4% that the ELISPOT that Recombinant ESAT6 albumen stimulates tests positive rate, the ELISPOT test positive rate that recombinant C FP10 albumen stimulates is 43.1%, ESAT6 and CFP10 associating positive rate is 55.6%.The above results shows, ESAT6 and CFP10 antigen all can be identified by human T-cell, induces strong cellullar immunologic response, produces a large amount of IFN-γ, illustrates that these two kinds of antigens all have more T cell antigen determinant.The antigen-specific CD4 of Different Individual ⁺t lymphocyte is incomplete same to the reaction of ESAT6 and CFP10, and the impact of identification by idiogenetics factor of antigen is described, may be individuality exists caused by HLA polymorphism.

Embodiment 3, tuerculoderma for non-deactivation Mycobacterium tuberculosis H37Rv sensitized guinea pig

The recombination fusion protein CE of purifying embodiment 1 prepared is applied to the tuerculoderma of non-deactivation Mycobacterium tuberculosis H37Rv sensitized guinea pig, former as skin allergic reaction using it, obtains desirable delayed type hypersensitivity.

One, the cultivation of thalline and the preparation of thalline and quantitatively

Below operate and all aseptically carry out:

1, seed culture

By effective for Mycobacterium tuberculosis H37Rv type strain dry powder sterilized water mixing, inoculation modified Russell medium, put 37 DEG C to cultivate 3 weeks, etc. growing into cauliflower form, then transferred species is in the triangular pyramidal bottle of the logical substratum of 50ml Soviet Union, and putting 37 DEG C of cultivations makes its film forming grow for 3 weeks, as few in mycoderm growth, need transferred species again, until when mycoderm floats over media surface in flakes, then enlarged culturing.

2, enlarged culturing

The logical substratum 200ml of dress Soviet Union in 500ml Erlenmeyer flask, by mycoderm difference transferred species in the seed bottle of above-mentioned steps 1, does not shake, makes mycoderm float over media surface as far as possible above the logical medium liquid of Soviet Union, cultivate 3-4 week, obtain nutrient solution for 37 DEG C.

3, thalline washing

Nutrient solution step 2 obtained, in the centrifugal 10min of 5000rpm, abandons supernatant, washs bacterium precipitation, three times repeatedly with aseptic PBS.Electronic balance takes bacterial weight.

4, bacterial cell disruption

Obtain with appropriate aseptic PBS suspending step 3 bacterium precipitation, ultrasonication thalline (totally 15 minutes) under condition of ice bath, centrifugal obtain bacterium precipitation.

5, bacteria concentration is determined

Take with electronic balance the bacterium precipitation that 0.1g step 4 obtains, by the aseptic PBS-Tween80 suspendible bacterium precipitation of 100ml, dilute bacterium with aseptic PBS, make Mycobacterium tuberculosis H37Rv final concentration be 10 μ g/ml, obtain Mycobacterium tuberculosis H37Rv bacterium liquid.

Two, tuerculoderma

1, cavy sensitization

After cavy observes 7d, back cropping, carries out PPD skin test, and PPD skin test method is: intradermal injection 5IUPPD, and after injection, 24h, 48h, 72h observation injection site reacts with or without redness.If cavy that is reactionless or reaction very weak (diameter is less than 5mm), be then that PPD skin test is negative, for sensitization.

Select the cavy of 6 PPD skin test feminine genders, male and female half and half, the Mycobacterium tuberculosis H37Rv bacterium liquid that injecting step one obtains.Injection site: femoribus internus inguinal region; Injected dose: 0.5ml (5 μ g); Frequency injection: one week sensitization once, is total to sensitization four times.Prepare Mycobacterium tuberculosis H37Rv group sensitized guinea pig.The PPD skin test of following steps 2 within one week, is carried out again after last sensitization.

2, wheel rim method tuerculoderma

For getting rid of cavy individual difference, with reference to " Products in China code ", wheel rim method is adopted to carry out titration.

6 Mycobacterium tuberculosis H37Rv group sensitized guinea pigs prepared by step 1, after clean hair is shaved at same back, perform 6 tuerculoderma points mark successively, adopt volume be the aseptic PBS (negative control) of 0.1ml, 5IUPPD (positive control) reference liquid, the diluent of recombination fusion protein CE of 0.6 μ g purifying, the diluent of the recombination fusion protein CE of 0.8 μ g purifying, the diluent of the recombination fusion protein CE of 1.0 μ g purifying, the recombination fusion protein CE of 1.2 μ g purifying diluent (all diluting with aseptic PBS) successively wheel rim carry out intradermal injection.Respectively at 24h, 48h, 72h, double-blind method measures the longitudinal and transverse diameter of injection site skin erythema, and the mean value (mm) both calculating.

Three, experimental result

During 72h, the DTH reaction diameter of major part cavy is less than 5mm, loses statistical significance, therefore no longer carries out data statistics to the longitudinal and transverse diameter of 72h.PBS (negative control) injection point local is without erythematous response.The DTH reaction diameter result of Mycobacterium tuberculosis H37Rv group sensitized guinea pig 24h, 48h is as shown in table 11.

The recombination fusion protein CE of table 11 purifying brings out non-deactivation mycobacterium tuberculosis sensitized guinea pig DTH and reacts

Table 11 shows, the recombination fusion protein CE of the purifying of 0.6 μ g, 0.8 μ g, 1.0 μ g and 1.2 μ g all can induce the cavy of non-killed mycobacterium H37Rv sensitization to produce strong skin reaction.

Above-mentioned experimental result shows, the recombination fusion protein CE of purifying prepared by embodiment 1 is former as skin allergic reaction, for the cavy of mycobacterium tuberculosis, mycobacterium tuberculosis var bovis sensitization, can induce specifically and produce strong delayed type hypersensitivity; And for the cavy of non-tuberculous mycobacteria sensitization in bacill calmette-guerin, most of environment, only induction produces weak delayed type hypersensitivity; And it in existing commercial skin diagnosis reagent PPD, can be used for the medicine preparing diagnosis of tuberculosis mycobacterial infections to the high specificity of mycobacterium tuberculosis.Therefore, the present invention will have broad application prospects in the diagnosis and auxiliary diagnosis lungy of tuberculosis infection.

Claims

1. an albumen is following protein a) or b):

A) protein shown in SEQIDNo.2;

2. the biomaterial relevant to albumen according to claim 1 is following B1) or B2):

B1) nucleic acid molecule of albumen described in coding claim 1;

B2) containing B1) expression cassette of described nucleic acid molecule, recombinant vectors, recombinant microorganism or transgenic cell line.

3. biomaterial according to claim 2, is characterized in that: B1) described nucleic acid molecule is following 1) or 2) or 3) shown in gene:

1) DNA molecular shown in 4-612 position in SEQIDNo.1;

2) under strict conditions with 1) DNA molecule hybridize that limits and protein DNA molecule described in claim 1 of encoding;

3) with 1) or 2) DNA molecular that limits have more than 90% identity and protein DNA molecule described in claim 1 of encoding.

4. the preparation method of albumen described in claim 1, comprises the steps: the nucleic acid molecule of albumen described in coding claim 1 to import in Host Strains to obtain recombinant bacterium, induces described recombinant bacterium to express albumen according to claim 1.

5. method according to claim 4, is characterized in that: described nucleic acid molecule imports described Host Strains by recombinant expression vector;

The described recombinant bacterium of described induction is expressed to comprise and described recombinant bacterium is carried out fermentation culture in the fermentation medium, and makes described recombinant bacterium express albumen according to claim 1 with IPTG induction.

6. the method according to claim 4 or 5, is characterized in that: described IPTG induction make described recombinant bacterium express albumen according to claim 1 after also comprise the step of albumen described in purifying.

7. albumen according to claim 1 and/or the application of the biomaterial described in Claims 2 or 3 in the product preparing detection or auxiliary detection m tuberculosis infection.

8. albumen according to claim 1 and/or the biomaterial described in the Claims 2 or 3 application in the product of the disease that preparation detects or auxiliary detection mycobacterium tuberculosis causes.

9. application according to claim 8, is characterized in that: described disease is tuberculosis.

10. application according to claim 9, is characterized in that: described tuberculosis is the outer tuberculosis of pulmonary tuberculosis or lung.