CN113444648B

CN113444648B - Penicillium wine strain, biocontrol agent and application

Info

Publication number: CN113444648B
Application number: CN202110691174.7A
Authority: CN
Inventors: 尹燕妮; 王宁; 商庆华; 陈云; 马忠华
Original assignee: Zhejiang University ZJU
Current assignee: Zhejiang University ZJU
Priority date: 2021-06-22
Filing date: 2021-06-22
Publication date: 2022-04-01
Anticipated expiration: 2041-06-22
Also published as: CN113444648A

Abstract

The invention discloses a penicillium vinosum strain, a biocontrol agent and application. The Penicillium vinaceum strain is classified and named as Penicillium vinaceum (Penicillium vinaceum) PV401, and the preservation number is CGMCC No. 22402. The penicillium vinosum PV401 has an obvious antagonistic effect on fusarium graminearum, and the biocontrol agent prepared from the fermentation metabolite of the penicillium vinaceum PV401 can effectively inhibit the growth of fusarium graminearum hyphae, the germination of spores and the generation of vomitoxin, and has good application in preventing and treating wheat scab.

Description

Penicillium wine strain, biocontrol agent and application

Technical Field

The invention relates to the technical field of biological control of plant diseases, in particular to a penicillium vinosum strain, a biocontrol agent and application thereof.

Background

Wheat (Triticum aestivum L.) is one of the leading food crops of humans, providing 20% of the calories and proteins for approximately 25 billion people worldwide, however, wheat production is increasingly stressed by abiotic (heat, cold, drought, etc.) and biotic (pests, weeds, etc.), with wheat scab caused by fusarium complex species being one of the major diseases in wheat production. In recent years, due to global warming and the popularization of rice-wheat, corn-wheat crop rotation and no-tillage technology, the incidence frequency of wheat scab in each wheat production area around the world is increasing, the incidence range is gradually expanding, and the trend is aggravated. Moreover, wheat scab causes wheat yield reduction and quality reduction, and simultaneously generates mycotoxin, mainly comprising Deoxynivalenol (DON), Zearalenone (ZEN) and the like. The DON toxin can not only damage wheat tissues and cause tissue pathological changes to cause ear withering and wilting, but also remains in crop grains, is difficult to degrade and has serious threat to the health of people and livestock.

The prevention and control of wheat scab at present mainly comprises three aspects: breeding disease-resistant variety, chemical prevention and biological prevention and treatment, etc. In the aspect of breeding disease-resistant varieties, the latest research results at present discover that a glutathione-S-transferase gene Fhb7 is a resistance gene of wheat scab, and the gene can degrade various mycotoxins causing the scab so as to play a role in disease resistance, the discovery of the gene has important guiding significance for disease-resistant breeding work, but complete immunity to the scab cannot be achieved, and the improvement of the disease-resistant character of the varieties still faces challenges; chemical control is the main means for controlling wheat scab at present, but a series of problems can be caused by using a large amount of chemical agents for a long time, such as easy degradation of soil quality, environmental pollution, drug resistance of pathogenic bacteria and the like; the biological control has the advantages of difficult resistance generation, long lasting period, small environmental pollution, safety to crops, human and livestock and the like, thereby having good application prospect. At present, the researches on strains with biological control effect on wheat scab are mainly focused on Bacillus (Bacillus spp.), Pseudomonas (Pseudomonas spp.), Trichoderma spp (Trichoderma spp.) and the like, and the biological control on wheat scab has great development potential.

Disclosure of Invention

Aiming at the problems in the prior art, the invention provides a penicillium vinosum strain, a biocontrol agent and application thereof, aiming at solving the problem of difficulty in controlling wheat scab.

The Penicillium vinaceum strain provided by the invention is separated from field soil of poplar hillock in the stone dam town of Ming-Yan village, Ming-province, Anhui province, is named as Penicillium vinaceum (Penicillium vinaceum) PV401 in a classification manner, has a preservation time of 2021 years, 4 months and 9 days, has a preservation place of China general microbiological culture Collection center (CGMCC No): 22402.

optionally, the penicillium vinosum strain is applied to prevention and treatment of wheat scab.

Optionally, the penicillium vinosum strain is applied to inhibiting the growth of fusarium graminearum, rhizoctonia cerealis, gaeumannomyces graminis, botrytis cinerea, fusarium graminearum and fusarium oxysporum hyphae and is applied to inhibiting the germination of fusarium graminearum spores.

Optionally, the Fusarium oxysporum includes Fusarium oxysporum watermelon specialization (Fusarium oxysporum f.sp.niveum) and Fusarium oxysporum melon specialization (Fusarium oxysporum f.sp.melonis).

Optionally, the penicillium vinosum strain is applied to reduction of fusarium graminearum vomitoxin.

The invention also provides a biocontrol agent which comprises the crude extract of the fermentation liquor of the penicillium vinaceum strain. The fermentation product of the penicillium vinosum strain can inhibit germination of fusarium graminearum spores and reduce production of vomitoxin.

Optionally, the crude extract of the fermentation liquid is prepared by the following method:

providing a fermentation broth of a penicillium vinaceum strain;

and filtering the fermentation liquor, and extracting and evaporating filtrate to obtain a crude extract of the fermentation liquor.

Optionally, the activated penicillium vinosum is inoculated into the PDB culture solution to be cultured for 10-14 days, so as to obtain the fermentation solution.

Optionally, the penicillium vinaceum strain is transferred to a PDA plate from a PDA slant culture medium, and is transferred to a first generation after being cultured at a constant temperature of 25 ℃ for 4 days, so that the activated penicillium vinaceum strain is obtained.

Optionally, the formula of the PDB culture solution is: 200g of potato, 20g of glucose and 1L of deionized water, sterilizing at 121 ℃ for 20min, and naturally adjusting the pH value.

Optionally, the biocontrol agent further comprises a solvent, wherein the solvent is one or more of methanol, ethyl acetate and water.

The invention also provides a method for preventing and controlling wheat scab, wherein the biocontrol agent is diluted and inoculated to the ear of wheat at the ear sprouting stage of wheat.

Optionally, the concentration of the biocontrol agent after dilution is 0.25-0.5 g/L.

The invention provides penicillium vinosum PV401, which has obvious antagonistic action on fusarium graminearum, and the biocontrol agent developed by the strain can effectively inhibit the germination of fusarium graminearum spores, hypha growth and vomitoxin generation, and has good application prospect.

Drawings

FIG. 1 is a colony morphology observation diagram of strain PV 401;

FIG. 2 is a phylogenetic tree of Penicillium vinaceum PV 401;

FIG. 3 is a graph showing the results of the plate-confrontation test of Penicillium vinaceum PV401 with Fusarium graminearum, A: fusarium graminearum, B: b1 is Fusarium graminearum, B2 is Penicillium vinaceum PV 401;

FIG. 4 is a graph showing the results of the effect of a biocontrol agent on the germination of fusarium graminearum spores, A: methanol is added, B is the biocontrol agent prepared in example 4;

FIG. 5 is a graph showing the effect of a biocontrol agent on the growth of Fusarium graminearum hyphae, A: no biocontrol agent is added, B: the biocontrol agent prepared in example 4;

FIG. 6 is a graph showing the effect of a biocontrol agent on the production of emetic toxin by Fusarium graminearum, A: no biocontrol agent and methanol are added, B: adding methanol, C: the biocontrol agent prepared in example 4;

FIG. 7 is a diagram of the control effect of the biocontrol agent on wheat scab, A: control group sprayed with water, B: the biocontrol agent prepared in example 4 was sprayed diluted 1000 times.

FIG. 8 is a graph showing the results of a plate-confrontation test of Penicillium vinaceum PV401 with six other pathogenic bacteria, A: six pathogenic bacteria, wherein A1 is Rhizoctonia cerealis (Rhizoctonia cerealis), A2 is Populospermum graminearum (Gaeumunomyces graminis), A3 is Botrytis cinerea (Botrytis cinerea), A4 is Fusarium canopium (Fusarium fujikuroi), A5 is Fusarium oxysporum watermelon specialization type (Fusarium oxysporum f.sp.noveum), A6 is Fusarium oxysporum melon specialization type (Fusarium oxysporum f.sp.melonis); b: penicillium vinaceum PV401 is opposite to six kinds of pathogenic bacteria.

Fig. 9 is a graph showing the inhibitory effect of a biocontrol agent on six other pathogenic bacteria, a: six pathogenic bacteria separately cultured in a medium without added biocontrol agent, wherein A1 is Rhizoctonia cerealis (Rhizoctonia cerealis), A2 is Podospora graminearum (Gaeumannomyces graminis), A3 is Botrytis cinerea (Botrytis cinerea), A4 is Fusarium fujikuroi (Fusarium fujikuroi), A5 is Fusarium oxysporum watermelon specialization type (Fusarium oxysporum f.sp.niveum), A6 is Fusarium oxysporum melon specialization type (Fusarium oxysporum f.sp.melo); b: the biocontrol agent prepared in example 4 was added to the culture medium of six pathogenic bacteria.

Detailed Description

The technical solutions of the present invention will be further described with reference to the following embodiments, but the present invention is not limited thereto.

The following examples relate to media and reagent compositions comprising:

potato dextrose agar medium (PDA medium): 200g of potato, 20g of glucose, 12g of agar powder and 1L of deionized water, and sterilizing at 121 ℃ for 20min, wherein the pH value is natural.

Potato dextrose broth (PDB broth): 200g of potato, 20g of glucose and 1L of deionized water, sterilizing at 121 ℃ for 20min, and naturally adjusting the pH value.

0.7mol/L NaCl solution: 40.908g NaCl, 1L deionized water, sterilized at 121 ℃ for 20min, natural pH.

YEPD culture solution: 10g of peptone, 3g of yeast extract, 20g of glucose and deionized water are added until the volume is 1L, and the mixture is sterilized at 121 ℃ for 20min and has pH of 6.7.

CMC culture solution: 15.0g of CMC-Na, 1g of yeast extract and NH₄NO₃ 1g，KH₂PO₄ 1g，MgSO₄·7H₂0.5g of O and deionized water are added to the solution until the volume is 1L, and the solution is sterilized for 20min at 121 ℃.

4% sucrose aqueous solution: weighing 4g of sucrose, dissolving in 100mL of deionized water, sterilizing at 121 ℃ for 20min, and naturally adjusting pH.

TBI culture solution: 30g of cane sugar and KH₂PO₄ 1g，MgSO₄·7H₂O 0.5g，KCl 0.5g，FeSO₄·7H₂O0.01g, putrescine acid salt 1.47g, Trace element 200 μ L, deionized water to volume of 1L, and sterilizing at 121 deg.C for 20min at pH 4.

EXAMPLE 1 isolation, purification and screening of the strains

Weighing 1g of AnhuiAdding field soil of Yangguang mountain of Yangyoucun in rock dam of Mingguang city into plastic test tube filled with 10mL0.7mol/L NaCl solution, shaking for mixing, diluting the mixed liquid to 10^-1，10^-2，10^-3And after uniform mixing, taking 100 mu L of liquid, coating the liquid on a PDA culture medium added with antibiotics, repeating three steps for each gradient, carrying out inverted culture at 25 ℃, observing a flat plate every day, purifying strains growing on the flat plate, storing the obtained purified strains in a sterile environment at 4 ℃ for later use, and classifying and numbering according to the collection area.

The outer ring of the strain separated in the soil is punched by a puncher with the inner diameter of 6mm, and the outer ring is planted to one side of a PDA plate with the diameter of 9cm, and the other side of the PDA plate is inoculated with a fusarium graminearum PH-1 bacterial plate with the diameter of 6 mm. The spacing between the strain and fusarium graminearum is about 6 cm. One side of the PDA plate is inoculated with a fusarium graminearum PH-1 bacterial dish, and the other side is not treated as a negative control. The strain is placed in an incubator at 25 ℃ and with a photoperiod of 12h for culture, the width of the inhibition zone is observed after 7d, and the growth inhibition rate of the strain on fusarium graminearum hyphae is calculated.

The hypha growth inhibition ratio (%) (control PH-1 colony diameter-treatment PH-1 colony diameter)/control PH-1 colony diameter × 100%.

Screening out a strain which is numbered PV401 and has the effect of inhibiting the growth of fusarium graminearum.

Example 2 morphological Observation and identification of Strain PV401

The strain PV401 was inoculated on PDA plates and cultured at 25 ℃ for 7 days, the colonies started to appear white, and after several days of culture the colonies appeared grayish green, producing a large number of conidia, see FIG. 1.

The DNA of the strain was extracted and PCR amplified with the fungal universal primers ITS1 (5'-TCCGT AGGTGAACCTG CGG-3') (SEQ ID NO: 1) and ITS4 (5'-TCCTCCGCTTATTGATATGC-3') (SEQ ID NO: 2). The PCR reaction system was 25. mu.L: 1 uL each of the upstream and downstream primers (10. mu. mol/L) ITSl and ITS4, 2.5. mu.L DNA template, 12.5. mu.L Taq Mix, ddH₂O8. mu.L. 5min at 94 ℃; 30 cycles of 94 ℃ for 30s, 53 ℃ for 1min, 72 ℃ for 1 min; 10min at 72 ℃. The PCR amplification product is sent to Hangzhou Ongke Biotech cockThe sequence analysis was carried out, and the sequence results were as follows:

GCCCTCACTGGGAAGGTCCTCCGCCTTATTGATATGCTTAAGTTCAGCGGGTATCCCTACCTGATCCGAGGTCAACCTGGATAAAAATTTGGGTTGATCGGCAAGCGCCGGCCGGGCCTACAGAGCGGGTGACAAAGCCCCATACGCTCGAGGACCGGACGCGGTGCCGCCGCTGCCTTTCGGGCCCGTCCCCCGGAATCGGAGGACGGGGCCCAACACACAAGCCGTGCTTGAGGGCAGCAATGACGCTCGGACAGGCATGCCCCCCGGAATACCAGGGGGCGCAATGTGCGTTCAAAGACTCGATGATTCACTGAATTTGCAATTCACATTACGTATCGCATTTCGCTGCGTTCTTCATCGATGCCGGAACCAAGAGATCCGTTGTTGAAAGTTTTAAATAATTTATATTTTCACTCAGACTACAATCTTCAGACAGAGTTCGAGGGTGTCTTCGGCGGGCGCGGGCCCGGGGGCGTGAGCCCCCCGGCGGCCAGTTAAGGCGGGCCCGCCGAAGCAACAAGGTAAATAAACACGGGTGGGAGGTTGGACCCAGAGGGCCCTCACTCGGTAATGATCCTTCCGCAGGTCCCCTAACGGAAGGGTTCAGAATGG(SEQ ID NO：3)

referring to fig. 2, Blast comparison analysis is performed on the sequencing result on NCBI, a phylogenetic tree is constructed, and the sequencing result is identified as Penicillium vinaceum (Penicillium vinaceum) by combining morphological analysis, is classified and named as Penicillium vinaceum PV401, and is stored in the china common microbial strain preservation management center, wherein the strain preservation number is CGMCC No: 22402.

example 3 Penicillium vinaceum PV401 and Fusarium graminearum plate confrontation experiment

Punching the outer ring of the activated penicillium vinosum PV401 by using a puncher with the inner diameter of 6mm, inoculating the outer ring to one side of a PDA plate with the diameter of 9cm, and inoculating a fusarium graminearum PH-1 bacteria dish with the diameter of 6mm to the other side of the PDA plate. The spacing between the two bacteria was about 6 cm. Inoculating fusarium graminearum PH-1 bacteria on one side of a PDA plate and taking the other side as a negative control without treatment, and repeating for 3 times. The plate is placed in an incubator at 25 ℃ and with a photoperiod of 12h for culture, and the bacteriostatic effect is observed after 7 d. The hypha growth inhibition rate was (control PH-1 colony diameter-treatment PH-1 colony diameter)/control PH-1 colony diameter × 100%.

Referring to FIG. 3, Fusarium graminearum PH-1(B1) in the biocontrol agent-treated group B was significantly inhibited by Penicillium vinaceum PV401(B2) compared to the control group A, and the rate of inhibition of mycelial growth of Fusarium graminearum PH-1 was 28.2%.

EXAMPLE 4 preparation of biocontrol agents

Activating and inoculating penicillium vinosum PV401 to a PDA (potato dextrose agar) solid culture medium from a storage tube, culturing for 7 days at 25 ℃, punching a bacterium plate on a flat plate by using a puncher with the diameter of 6mm, inoculating the bacterium plate to a conical flask filled with 500mL of PDB culture solution, fermenting for 10-14 days at 25 ℃, filtering by using 2 layers of gauze, and performing filtration on the obtained filtrate by using ethyl acetate according to the weight ratio of 1: 1, evaporating the ethyl acetate layer in a rotary evaporator, re-dissolving the obtained crude extract of the fermentation liquor by using methanol to obtain the biocontrol agent with the concentration of 0.26g/mL, and storing the biocontrol agent in a refrigerator at the temperature of minus 20 ℃ for later use.

EXAMPLE 5 Effect of biocontrol agents on Fusarium graminearum hyphae growth

The biocontrol agent prepared in example 4 was mixed according to the following ratio of 1: adding the volume ratio of 200 into a PDA culture medium cooled to below 50 ℃, pouring the plate after fully mixing, taking a plate added with methanol with the same volume as a control group, inoculating fusarium graminearum into the center of each plate after the plate is solidified, culturing for 5 days at 25 ℃, setting 3 times of repetition for each plate, observing whether the growth of fusarium graminearum is inhibited or not after 5 days, photographing, recording, measuring the growth diameter of hyphae after 5 days of culture, and calculating the inhibition rate according to the following formula:

the inhibition rate (%) (average diameter of control group-average diameter of experimental group)/average diameter of control group x 100%) is shown in fig. 4, the inhibition rate of the biocontrol agent on fusarium graminearum hyphae reaches 92.8%, and the growth of fusarium graminearum hyphae is significantly inhibited.

Example 6 Effect of biocontrol agents on Fusarium graminearum spore germination

Punching three bacterial dishes on the edge of a pH-1 plate of fusarium graminearum, placing the bacterial dishes into an erlenmeyer flask filled with 100mL of CMC culture solution, shaking at 25 ℃, 180rpm for 3 days, filtering spores by using 3 layers of filter paper after 3 days, centrifuging at 5000rpm for 10 minutes, and diluting the obtained spores to 5x10 by using 4% of sucrose water⁵Absorbing 100uL of CFU/mL into a 1.5mL centrifuge tube, adding 0.5 uL of the biocontrol agent prepared in the embodiment 4 into the centrifuge tube, uniformly mixing, absorbing 20 uL of the biocontrol agent onto a glass slide, and placing the glass slide into a wet box; taking no biocontrol agent as a control, repeating each experiment for 3 times, and observing the germination condition of the spores under a microscope after 4-6 h.

Referring to fig. 5, compared with the control group (a), the biocontrol agent added in the treatment group (B) has an inhibition rate of 100% on fusarium graminearum spores, which indicates that the fermentation metabolite of penicillium vinaceum PV401 can significantly inhibit the germination of fusarium graminearum spores.

Example 7 Effect of biocontrol Agents on Fusarium graminearum DON toxin production

Pricking the small bacterium balls at the edge of a fusarium graminearum flat plate by using sterilized toothpicks, transferring the small bacterium balls into 30mL YEPD culture solution, and shaking at 25 ℃ and 180rpm for 21-24 h; transferring the small bacterium balls into a sterilized 2mL centrifuge tube, adding 1 steel ball, and grinding by using a sample grinder for 45Hz and 90 s; pipetting 30. mu.L of the ground sample into a conical flask containing 30mL of TBI medium, and adding 50. mu.L of the biocontrol agent prepared in example 4 thereto, shaking at 28 ℃ for 7 days, and treating with an equal volume of methanol as a negative control, CK represents no biocontrol agent; the assay of the toxin-on-vomitoxin (DON) content was performed using an enzyme-linked immunoassay kit for vomitoxin (DON) purchased from jiangsu vissai scientific and biological development ltd.

Referring to fig. 6, the treatment group (B) did not reduce the production of DON toxin in fusarium graminearum compared to the control group (a), indicating that the solvent methanol of the biocontrol agent did not inhibit, while the production of DON toxin by fusarium graminearum in the treatment group (C) decreased by 70%, indicating that the fermentation metabolite of penicillium vinaceum PV401 significantly inhibited the production of fusarium graminearum DON toxin.

Example 8 wheat scab control test

Selecting wheat at the initial stage of field flowering, collecting wheat ears, cutting the wheat ears to the same height, and removing all leaves; the biocontrol agent prepared in example 4 was sprayed onto the ear of wheat in 1000-fold dilution, and the ear of wheat was naturally dried, using sterile water as a control, and then the stem of the ear of wheat was placed in sterile water and maintained at room temperature overnight, and then 10. mu.L of a spore suspension of Fusarium graminearum PH-1 (concentration: 4X 10) was injected into a single flower of the ear of wheat⁵mL), marking spikelets inoculated with pathogenic bacteria on glumes, putting the spikelets in an artificial climate box, alternately culturing the spikelets in the artificial climate box at the temperature of 25 ℃, the humidity of 80 percent, the illumination time of 12h and the darkness of 12h for 4-6d, observing and recording the incidence of head gibberellic disease of wheat, and calculating the diseaseAnd (4) index.

Grading standard of disease severity: grade 1, diseased panicles account for less than 1/4 of the whole panicles; grade 2, diseased panicles account for 1/4-l/2 of the whole panicles; grade 3, diseased panicles account for 1/2-3/4 of the whole panicles; grade 4, diseased panicles account for more than 3/4 of the whole panicle. The disease index ∑ (number of diseased plants at each stage × the disease grade value)/(total number of investigated plants × highest grade value) × 100%.

Referring to fig. 7, the disease index of wheat in the control group (a) is 92.8%, and the disease index of wheat in the treatment group (B) is 32.1%, which indicates that the fermentation metabolite of penicillium vinosum PV401 can effectively prevent and treat wheat scab, and the prevention and treatment effect reaches 67.9%.

Example 9 inhibitory Effect of Penicillium vinaceum PV401 against other pathogenic bacteria

The outer ring of the activated penicillium vinosum PV401 is punched by a puncher with the inner diameter of 6mm, and is inoculated to one side of a PDA flat plate with the diameter of 9cm, the other side of the flat plate is inoculated with Rhizoctonia cerealis (Rhizoctonia cerealis) which is 6mm in diameter, Gaeumannomyces graminis (Gaeumannomyces graminis), Botrytis cinerea (Botrytis cinerea), Fusarium graminis (Fusarium fujikuroi), Fusarium oxysporum (Fusarium oxysporum) which is a special type watermelon (Fusarium oxysporum f.sp.niveum) and Fusarium melo which is a special type Fusarium oxysporum (melon) which is a special type melon. The spacing between the two bacteria was about 6 cm. Inoculating pathogenic bacteria on one side of the PDA plate and performing no treatment on the other side of the PDA plate as negative control, and repeating for 3 times. The plate is placed in an incubator at 25 ℃ and with a photoperiod of 12h for culture, and the bacteriostatic effect is observed after 7 d. The hypha growth inhibition rate was (control PH-1 colony diameter-treatment PH-1 colony diameter)/control PH-1 colony diameter × 100%.

Referring to fig. 8, the inhibition rates of the penicillium vinosum PV401 on the growth of hyphae of six pathogenic bacteria, namely rhizoctonia cerealis (A1), fusarium graminearum (A2), botrytis cinerea (A3), bakanae disease of rice (A4), fusarium oxysporum (A5) and fusarium meloni (A6), are respectively 31.1%, 29.3%, 33.6%, 19.1%, 12.1% and 20%, and the inhibition rate of the penicillium vinosum PV401 on the fusarium oxysporum and the inhibition rate on the botrytis cinerea are found to be the lowest.

The biocontrol agent prepared in example 4 was then mixed as described in 1: adding 200 volume ratios into a PDA culture medium cooled to below 50 ℃, pouring plates after fully mixing, inoculating bacteria dishes of pathogenic bacteria such as wheat sharp eyespot, wheat take-all, gray mold, rice bakanae disease, watermelon fusarium wilt, sweet melon fusarium wilt and the like into the centers of the plates after the plates are solidified, culturing for 5 days at 25 ℃, setting 3 times for each plate, observing whether the growth of the pathogenic bacteria is inhibited or not after 5 days, photographing, recording and measuring the growth diameter of hyphae after 5 days of culture, and calculating the inhibition ratio according to the following formula:

the inhibition rate (%) of the biocontrol agent on the hyphae of Rhizoctonia cerealis (A1), Sclerotinia cerealis (A2), Botrytis cinerea (A3), Rhizoctonia solani (A4), Fusarium oxysporum (A5) and Cucumis melo (A6) is almost 100%, and the growth of the hyphae of the pathogenic bacteria is significantly inhibited.

The invention screens out a penicillium vinosum PV401 which has good antagonistic action with fusarium graminearum, and provides an effective way for solving the problem of difficult control of wheat scab; the biocontrol agent prepared by the strain fermentation liquor has strong inhibition effects on fusarium graminearum spore germination, hypha growth and vomitoxin yield, and has good application prospects.

Appropriate changes and modifications to the embodiments described above will become apparent to those skilled in the art from the disclosure and teachings of the foregoing description. Therefore, the present invention is not limited to the specific embodiments disclosed and described above, and some modifications and variations of the present invention should fall within the scope of the claims of the present invention. Furthermore, although specific terms are employed herein, they are used in a generic and descriptive sense only and not for purposes of limitation.

SEQUENCE LISTING

<110> Zhejiang university

<120> Penicillium wine strain, biocontrol agent and application

<130>

<160> 3

<170> PatentIn version 3.3

<210> 1

<211> 19

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 1

tccgtaggtg aacctgcgg 19

<210> 2

<211> 20

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 2

tcctccgctt attgatatgc 20

<210> 3

<211> 615

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 3

gccctcactg ggaaggtcct ccgccttatt gatatgctta agttcagcgg gtatccctac 60

ctgatccgag gtcaacctgg ataaaaattt gggttgatcg gcaagcgccg gccgggccta 120

cagagcgggt gacaaagccc catacgctcg aggaccggac gcggtgccgc cgctgccttt 180

cgggcccgtc ccccggaatc ggaggacggg gcccaacaca caagccgtgc ttgagggcag 240

caatgacgct cggacaggca tgccccccgg aataccaggg ggcgcaatgt gcgttcaaag 300

actcgatgat tcactgaatt tgcaattcac attacgtatc gcatttcgct gcgttcttca 360

tcgatgccgg aaccaagaga tccgttgttg aaagttttaa ataatttata ttttcactca 420

gactacaatc ttcagacaga gttcgagggt gtcttcggcg ggcgcgggcc cgggggcgtg 480

agccccccgg cggccagtta aggcgggccc gccgaagcaa caaggtaaat aaacacgggt 540

gggaggttgg acccagaggg ccctcactcg gtaatgatcc ttccgcaggt cccctaacgg 600

aagggttcag aatgg 615

Claims

1. The Penicillium vinosum strain is characterized by being classified and named as Penicillium vinosum (Penicillium vinatum) PV401 with the preservation number of CGMCC No. 22402.

2. A biocontrol agent comprising a crude extract of fermentation broth of the strain penicillium vinaceum as claimed in claim 1.

3. The biocontrol agent according to claim 2, wherein the crude extract of fermentation broth is prepared by the following method:

providing a fermentation broth of a penicillium vinaceum strain;

4. The biocontrol agent according to claim 3, wherein the fermentation broth is obtained by inoculating activated Penicillium wine into PDB culture medium and culturing for 10 to 14 days.

5. The biocontrol agent according to claim 2, further comprising a solvent, wherein the solvent is one or more of methanol, ethyl acetate, and water.

6. A method for controlling wheat scab, characterized in that the biocontrol agent as defined in claim 2 is diluted and inoculated to the ear of wheat at the ear emergence stage of wheat.

7. The method according to claim 6, wherein the concentration of the biocontrol agent after dilution is 0.25-0.5 g/L.

8. The use of the penicillium vinosum strain according to claim 1 for controlling wheat scab.

9. The penicillium vinosum strain according to claim 1, for use in inhibiting the growth of fusarium graminearum, rhizoctonia cerealis, gaeumannomyces graminis, botrytis cinerea, fusarium graminearum and fusarium oxysporum hyphae and for use in inhibiting the germination of fusarium graminearicum spores.

10. The use of a strain of penicillium vinosum according to claim 1 for reducing the vomiting toxin of fusarium graminearum.