CN109628328B

CN109628328B - Penicillium beijerinckii capable of preventing and treating sesame wilt and having growth promoting and induced resistance effects, and screening method and application thereof

Info

Publication number: CN109628328B
Application number: CN201910026036.XA
Authority: CN
Inventors: 赵辉; 赵新贝; 倪云霞; 刘新涛; 刘红彦; 高素霞; 刘玉霞; 文艺; 王飞; 千慧敏; 何碧珀; 王婧
Original assignee: Institute of Plant Protection of Henan Academy of Agricultural Sciences
Current assignee: Institute of Plant Protection of Henan Academy of Agricultural Sciences
Priority date: 2019-01-11
Filing date: 2019-01-11
Publication date: 2022-02-15
Anticipated expiration: 2039-01-11
Also published as: CN109628328A

Abstract

The invention discloses a Penicillium beijerinckii strain capable of preventing sesame wilt and having growth promotion and induced resistance, a screening method and application thereof, wherein the Penicillium beijerinckii strain is Penicillium beijerinckii (Penicillium biliiae) 47M-1, is preserved in China center for type culture collection, and has the preservation address: wuhan university collection center, accession number: CCTCC M: 2018899, date of deposit: 12 and 17 months in 2018. The strain has a strong inhibiting effect on the fusarium oxysporum of the sesame, has broad-spectrum antibacterial activity on pathogenic bacteria of other main diseases on the sesame, can promote the growth of crops and induce the crops to generate resistance, has no pathogenicity on the crops, does not generate common chemical and pesticide problems such as drug resistance, pesticide residue, environmental pollution and the like, is healthy and environment-friendly to people and livestock, and meets the requirements of people on ecological agriculture.

Description

Penicillium beijerinckii capable of preventing and treating sesame wilt and having growth promoting and induced resistance effects, and screening method and application thereof

Technical Field

The invention relates to penicillium beijerinckii capable of preventing and treating sesame wilt and having the functions of growth promotion and resistance induction, a screening method and application thereof, belonging to the technical field of microorganisms.

Background

Fusarium wilt is a worldwide important soil-borne disease that damages many food and commercial crops, known as cancer of the plant. Fusarium oxysporum can be infected in the whole growth period of plants, usually a host plant guide tissue vascular bundle system is infected to cause various diseases of plants such as root rot, stem base rot, flower rot, ear rot and the like, and toxin is generated in the metabolic process of growth and development to harm crops, so that the crops are wilted and die, the yield and the quality of the crops are influenced, and the fusarium oxysporum is one of the most difficult important diseases to control in production.

At present, the main methods for preventing and treating the blight are to cultivate disease-resistant varieties, use chemical agents, utilize agricultural measures and the like, but the blight belongs to soil-borne diseases, so the effect is not ideal in prevention and treatment, and an effective prevention and treatment means is lacked. Therefore, the use of microbial agents and their metabolites, which are harmless to the human body and the ecological environment, instead of chemical pesticides, has become a development direction worldwide. Biocontrol bacteria which have been reported in China to have an inhibiting effect on pathogenic bacteria of blight mainly comprise trichoderma, arbuscular mycorrhizal fungi, paecilomyces lilacinus, pseudomonas fluorescens, actinomycetes and the like. The application of penicillium in preventing and treating sesame wilt is not reported.

Disclosure of Invention

The invention aims to provide penicillium beijerinckii which can prevent and control sesame wilt and has the functions of growth promotion and resistance induction, and a screening method and application thereof.

In order to achieve the purpose, the invention adopts the technical scheme that:

the Penicillium beijerinckii can prevent and treat sesame wilt and has the functions of growth promotion and resistance induction, wherein the Penicillium beijerinckii is Penicillium beijerinckii (Penicillium biliiae) 47M-1, is preserved in China center for type culture collection, and has the preservation address: wuhan university collection center, accession number: CCTCC M: 2018899, date of deposit: 12 and 17 months in 2018.

The screening method of the penicillium bailii comprises the following steps: a flat plate dilution separation method is adopted, a soil sample of a rural stone ditch village in Mianchi county, Mianchi city, Sanmenxia city is added with sterile water to prepare diluent with different gradients, 100 mu L of the diluent with different gradients is taken and coated with a Bengal culture medium, a single colony is selected, separated and purified, Fusarium oxysporum (Fusarium oxysporum) is taken as a target bacterium, a strain with strong bacteriostatic activity on the Fusarium oxysporum is screened out by using a flat plate bacteriostatic test, and the strain is identified as penicillium bailii.

An application of Penicillium bailii in preventing and treating sesame diseases is disclosed.

Application of Penicillium beijerinckii in promoting sesame growth is provided.

Application of Penicillium bailii in inducing sesame resistance to wilt disease is provided.

Application of penicillium bailii in preparing a bacterial agent for preventing and treating sesame wilt, promoting sesame growth and inducing resistance of sesame to wilt.

A microbial inoculum prepared from Penicillium bailii for preventing and treating sesame wilt, promoting sesame growth and inducing sesame resistance to wilt.

A preparation method of the microbial inoculum comprises the following steps:

(1) inoculating Penicillium beijerinckii on PDA culture medium, culturing in constant temperature incubator at 28 deg.C under 16 hr illumination/8 hr dark for 5d, and eluting spore with 0.05% (v/v) Tween 80 sterile water to form spore suspension;

(2) preparing a solid fermentation culture medium according to 120 g/bag of soybeans, 0.12 g/bag of maltose and 60 mL/bag of water; flatly laying the prepared solid fermentation culture medium, standing for 10-12 h, and sterilizing at 121 ℃ for 30 min;

(3) inoculating 5mL of spore suspension liquid on a solid fermentation culture medium, fully mixing, continuously keeping the mixture flat overnight, then placing the mixture in a dark constant-temperature incubator at 28 ℃ for culturing for 7-10 days, when the solid fermentation culture medium fully produces spores, spreading the solid fermentation product into a white porcelain dish paved with a layer of sterile newspaper, covering 1 layer of sterile newspaper, placing the white porcelain dish in a glass window capable of being irradiated by sunlight for airing for 5-7 days, collecting spore powder after airing, and forming high spore powder, namely microbial inoculum, wherein the spore content of penicillium bailii in the high spore powder is 2.3 multiplied by 10¹¹CFU/g。

The PDA culture medium is: 200g of peeled potatoes, 20g of glucose and 15-20 g of agar, adding distilled water to a constant volume of 1000mL, subpackaging in triangular flasks, and sterilizing at 121 ℃ for 30 min.

A method for using the microbial inoculum comprises the following steps: the microbial inoculum was resuspended in 0.05% (v/v) Tween 80 sterile water and the spore concentration was adjusted to 1X 10⁸CFU/mL, and root irrigation around the root of sesame.

The invention has the beneficial effects that:

the invention aims to biologically control sesame wilt, through a plate confronting and drug-containing plate method and a potted plant disease prevention test, biocontrol bacteria 47M-1 capable of controlling sesame wilt are screened from soil samples in rural stone ditches in Michii county, West village and county in Mingchi city of three Mengxi for the first time, and the strain is identified as penicillium bailii, not only has strong inhibition effect on fusarium oxysporum of sesame, but also has broad-spectrum bacteriostatic activity on pathogenic bacteria of other main diseases on sesame. Experiments show that the prevention effect of the high spore powder of the strain on the sesame wilt can reach 50 percent, the morbidity of the sesame wilt can be effectively reduced, and the treatment effect of the high spore powder is superior to that of the conventional common chemical pesticide carbendazim. The penicillium bailii screened by the invention can promote the growth of crops and induce the crops to generate resistance after being used, has no pathogenicity to the crops, does not generate chemical and agricultural chemicals common problems such as drug resistance, pesticide residue, environmental pollution and the like, is healthy and environment-friendly to people and livestock, and meets the requirements of people on ecological agriculture.

Drawings

FIG. 1 shows the results of the plate bacteriostasis test of strain 47M-1 and its fermentation filtrate on Fusarium oxysporum. In the figure, A is a flat plate opposite; b is contrast of the plate confrontation; c is a drug-containing flat plate; d is control of drug-containing plates.

FIG. 2 is a phylogenetic tree of Calmodulin (Calmodulin) sequences from strain 47M-1.

FIG. 3 shows the growth promotion test results of strain 47M-1 on potted sesame.

FIG. 4 shows the effect of strain 47M-1 on the relative expression levels of the disease resistance-associated genes NPR1, Coi1, PR1, PR2 and PR3 in sesame roots. The different lower case letters (a, b, c, d) in the figure indicate that there is a significant difference at the 0.05 level between the different treatments at the same time point.

Detailed Description

The following examples further illustrate the embodiments of the present invention in detail.

Experimental materials:

bengal red medium: peptone 5g, glucose 10g, KH₂PO₄ 1g，MgSO₄·7H₂O0.5 g, 1/3000(w/v) Bengal100mL of the solution, 0.1g of chloramphenicol, 15-20 g of agar, 1000mL of distilled water and pH 7.2 +/-0.2.

Charles agar (CZ): chashi concentrate 10mL, K₂HPO₄1.0g, 30g of cane sugar, 17.5g of agar and 1000mL of distilled water.

Charles yeast extract agar (CYA): k₂HPO₄1g, 10mL of Chashi concentrated solution, 5g of yeast extract, 30g of sucrose, 15g of agar and 1000mL of distilled water.

Wort agar (MEA): malt Extract (Malt Extract)20g, peptone 1g, glucose 20g, agar 15g, distilled water 1000 mL.

25% glycerol nitrate agar (G25N): k₂HPO₄0.75g, 7.5mL of Chashi concentrated solution, 3.7g of yeast extract, 250g of glycerol (analytically pure), 12g of agar and 750mL of distilled water.

Chashi concentrated solution: NaNO₃ 30g，KCl 5g，MgSO₄·7H₂O 5g，FeSO₄·7H₂O 0.1g，ZnSO₄·7H₂O 0.1g，CuSO₄·5H₂O0.05 g and distilled water 100 mL.

PDA culture medium: 200g of peeled potato, 20g of glucose and 15-20 g of agar, adding distilled water to a constant volume of 1000mL, and sterilizing at 121 ℃ for 30 min. The PD culture solution is PDA without agar.

MS culture solution: 50mL of I, 5mL of II, III and IV respectively, and water is supplemented to 1000 mL.

I：NH₄NO₃ 33g，KNO₃ 38g，CaCl₂·2H₂O 8.8g，MgSO₄·7H₂O 7.4g，KH₂PO₄3.4g, 1000mL of distilled water;

II：KI 0.166g，H₃BO₃ 1.24g，MnSO₄·4H₂O 4.46g，ZnSO₄·7H₂O 1.72g，Na₂MoO₄·2H₂O0.05g，CuSO₄·5H₂O 0.005g，CoCl₂·6H₂0.005g of O and 1000mL of distilled water;

III：FeSO₄·7H₂O 5.56g，Na₂·EDTA·2H₂o7.46 g and 1000mL of distilled water;

IV: 20g of inositol, 0.1g of nicotinic acid, 60.1g of VB60, 10.02g of VBE, 0.4g of glycine and 1000mL of distilled water.

Example 1 isolation and screening of soil microorganisms

Weighing 1g of soil dried at room temperature in a soil sample of rural stone ditch village in West village, Mianchi county, Mingchi, grinding and sieving, adding 10mL of sterile water for full oscillation to obtain a soil suspension, shaking the soil suspension uniformly, diluting in a gradient manner, coating 100 mu L of different-gradient dilution liquid on a Menglan red culture medium, performing inverted culture in a constant-temperature incubator at 28 ℃ for 48 hours until bacterial colonies grow out, and picking bacterial colonies with different sizes, colors or forms to separate and purify on a PDA culture medium.

Screening biocontrol bacteria by using a plate confronting method: inoculating the sesame fusarium oxysporum on a PDA culture medium, culturing for 5-10 days at 28 ℃, beating a circular mycelium block with the diameter of 5mm by using a sterile puncher, inoculating the circular mycelium block to the center of a new PDA culture medium, inoculating separated bacteria to a position which is 30mm symmetrical to the fusarium oxysporum, and simultaneously setting a single inoculated pathogen bacterial block as a control. Each treatment was repeated 3 times, and the results of the confrontation culture were observed after 5 days (Table 1).

The method comprises the following steps of (1) determining the bacteriostatic rate of separated bacteria by using a drug-containing flat plate method: collecting the isolated bacteria cultured for 5-7 days, collecting spores, and adjusting the concentration of the spores to be 1 × 10⁸And (3) adding CFU/mL into 100mL PD culture solution, performing shake flask fermentation at 28 ℃ and 180r/min for 5d, filtering with 4 layers of sterile gauze to remove mycelium pellets, filtering with a microporous filter membrane with the diameter of 0.22 mu m for 2 times, and mixing the filtrate with PDA culture medium at a ratio of 1: 9(v/v) are mixed evenly to prepare a drug-containing flat plate, meanwhile, sterile water is added into PDA to be used as a reference, and 1 fusarium oxysporum block with the diameter of 5mm is inoculated into the center of each plate. Incubation was carried out at 28 ℃ and the results were observed after 5 days (Table 1).

8 strains with strong bacteriostatic activity on the sesame fusarium oxysporum are screened by the plate confronting and re-screened by the drug-containing plate, the bacteriostatic activity of the 47M-1 fermentation filtrate is found to be strongest, the growth of the fusarium oxysporum is completely inhibited, and the result shows that the bacteriostatic activity of the strain 47M-1 in the plate confronting and the drug-containing plate is strongest (figure 1).

TABLE 1 screening results of antagonistic microorganisms against sesamum oxysporum

Example 2 inhibitory Effect of the Strain 47M-1 on other major disease pathogenic bacteria on sesame

The inhibitory effect of strain 47M-1 on pathogenic bacteria of other major diseases on sesame was measured according to the method described in example 1, and as a result, as shown in Table 2, the diameters of inhibition zones of strain 47M-1 on Pediococcus sessiliflorus (macrophonina phaseolina), Fusarium solani (Fusarium solani), Verticillium somnatum (Bipolaris sokiniana), Corynebacterium polystachys (Corynebacterium cassiacola) and Rhizoctonia solani (Rhizoctonia solani) were 20mm or more in the plate confrontation test; in the drug-containing plate test, except for the polyspora spinosa, other pathogenic bacteria were strongly inhibited. The isolated bacterium 47M-1 is proved to have broad-spectrum bacteriostatic activity on pathogenic bacteria of diseases on sesame.

TABLE 2 inhibitory Effect of the 47M-1 strain and its fermentation filtrate on other major pathogenic bacteria on sesame

Example 3 identification of Strain 47M-1

The activated strain 47M-1 is transferred to a morphological identification medium, placed in an incubator at 28 ℃, cultured in the dark for 7d, and observed and recorded the culture characteristics of the strain 47M-1 on four morphological culture media. Extracting 47M-1 genome DNA, amplifying ITS (internal transcribed spacer) and Calmodulin (Calmodulin) gene sequences by using universal primers, comparing sequencing results on NCBI, and selecting a sequence of a model strain with high similarity to establish a phylogenetic tree.

Morphological characteristics of 47M-1: colony morphology of strain 47M-1 on G25N: the bacterial colony has a radiation groove, produces spores slightly, is gray green, is velvet, has white edges with the thickness of 3-4 mm, has no secretion liquid drops, has no soluble pigment, has pink back and has light pink edges. Colony morphology of strain 47M-1 on CYA: the bacterial colony has a radiation groove, moderately produces spores, is green and flocculent, has a white edge of 3-4 mm, produces secretion liquid drops, produces brown soluble pigment and has a bright yellow back. Conidia on the CYA culture medium are single-rotation, smooth, long-strip-shaped stems and spherical. Colony morphology of strain 47M-1 on CZ: the method has the advantages of no radiation groove, moderate spore production, green and flocculent colony, white edge with the thickness of 3-4 mm, secretion liquid drop production, brown soluble pigment production and bright yellow back. Colony morphology of strain 47M-1 on MEA: the bacterial colony has no radiation groove, produces spores slightly, is dark green and velvet, is flocculent near the center, has yellow-white edges with the length of 4-5 mm, has no secretion liquid drops, produces light yellow soluble pigment and has yellow back.

Sequencing results for 47M-1: the ITS and Calmodulin (Calmodulin) of the strain 47M-1 were sequenced, the similarity between the sequencing results and Penicillium beijerinckii in NCBI database was 99%, in phylogenetic analysis of the two sequences (FIG. 2), 47M-1 and Penicillium beijerinckii were gathered in the same branch, and according to the morphological and evolutionary analysis of ITS and Calmodulin sequences, 47M-1 was identified as Penicillium beijerinceae.

The ITS gene sequencing result is as follows:

CCGGCGTCCGACTGAGGACTCTGGGTCCACCTCCCACCCGTGTCTCTTGTACCATGTTGCTTCGGCGAGCCCGCCTCACGGCCGCCGGGGGGCATCTGCCCCCGGGCCCGCGCCCGCCGAAGCCCCCTCTGAACGCTGTCTGAAGATTGCAGTCTGAGCGATAAGCAAAAATTATTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAACTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCACGGCTTGTGTGTTGGGCCTCCGTCCTCCCCCCGGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGTGTCCGGTCCTCGAGCGTATGGGGCTTTGTCACCCGCTCTGTAGGCCCGGCCGGCGCTGGCCGACCCTCCAACCCCATTTTTTCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAA(SEQ ID NO.1)

calmodulin gene sequencing results were:

GCCAATGGAGCGATTTCGTTGATTGGAAAAAGCGTCGCCTGGAATCAACACTAATGGATGCTTTTTCCCGGGAAATAGGACAAGGATGGCGATGGTGAGTGCGATCGTACTCGGGCTCGATAATTTCAAGATCCGATTATGTCCTCTTGACCGAGTGAACAAATCACTGAGATGAATAAATTCGATAGGACAAATCACCACCAAGGAGCTGGGCACTGTCATGCGCTCCCTCGGCCAGAACCCTTCCGAGTCTGAGCTGCAGGATATGATCAACGAGGTCGACGCCGATAATAACGGTACCATCGATTTCCCTGGTACGCTCTCCCTCCCCTCCGAATGATGATCTCAAGCCCCGAGAAGACTGATATTGACATTGCGACACAGAGTTCCTTACCATGATGGCACGTAAGATGAAGGACACCGACTCCGAGGAGGAGATCCGTGAGGCTTTCAAGGTGTTCGACCGCGACAACAACGGCTTCATCTCCGCCGCCGAGCTGCGCCACGTCATGCCTCCATCGGA(SEQ ID NO.2)

example 4 preparation of bacterial preparation of Penicillium bailii 47M-1

Example 5 preventive Effect of Penicillium beijerinckii 47M-1 on sesame wilt disease

The sesame seeds (Wuchang Ding hemp) are sterilized by 2% (w/v) NaClO for 15-20 min, washed by sterile distilled water for 3 times, and then spread on sterile filter paper for drying. And (3) dibbling the sterilized sesame seeds into seedling trays containing sterile pure vermiculite, wherein 2 grains are placed in each hole, the seedling trays are placed in a constant-temperature incubator with the temperature of 30 ℃ for 16h illumination and the temperature of 28 ℃ for 8h darkness for cultivation, and MS culture solution is poured regularly.

The treatment effect is as follows: selecting 4-leaf 1-heart-stage sesame seedlings with consistent growth vigor, dipping roots and inoculating fusarium oxysporum(1×10⁶CFU/mL), after 3d, root irrigation treatment is carried out on the sesame seeds by using different treatment solutions, 35 plants are treated each, the root irrigation is carried out on each plant for 3mL, after 10d, the morbidity and the disease index are counted, and the prevention and treatment effect is calculated.

Prevention effect: selecting 4-leaf 1-heart-stage sesame seedlings with consistent growth vigor, firstly, irrigating roots of the sesame seeds with different treatment solutions, wherein 15 sesame seeds are treated each, 3mL roots of each sesame seed are irrigated, and after 3 days, the sesame seeds are dipped with roots to inoculate fusarium oxysporum (1 multiplied by 10)⁶CFU/mL), after 10 days, the morbidity is investigated and the morbidity, disease index and prevention and treatment effect are calculated.

The used treatment liquids were respectively:

a: high spore powder diluent of 47M-1 Penicillium beilii with spore concentration of 1 × 10⁸CFU/mL；

B: the bacillus subtilis preparation diluent has the bacterial suspension concentration of 1 multiplied by 10⁸CFU/mL (the preparation is produced by Bailide biotechnology limited company in Ningguo city, and the trade name of the preparation is 10 hundred million CFU/g bacillus subtilis wettable powder);

c: carbendazim 50% wettable powder 500 times diluent (preparation produced by Jiangsu Lanfeng biochemical engineering Co., Ltd.);

d: sterile water (control CK).

Grading standard of sesame wilt disease:

level 0: good growth without manifestation of symptoms;

level 1: leaves are slightly wilted from bottom to top, like water shortage, and can recover in the morning and evening;

and 2, stage: the diseased leaves will wilt and can not be recovered to normal;

and 3, level: the whole plant wilted and could not be recovered to normal, the vascular bundle at the stem base became yellow brown, and the whole plant died.

Disease index ═ Σ (number of diseased plants at each stage × corresponding stage value)/(total number of investigated plants × highest stage value) × 100

Incidence (%). incidence/total treated plants × 100

Relative preventing effect (%) (disease index of control group-disease index of treatment group)/disease index of control group x 100

The results are shown in tables 3 and 4. The results show that the treatment effect and the prevention effect of the penicillium beilii 47M-1 on sesame wilt disease both reach 50 percent, the disease strain rate is obviously reduced, and the prevention effect is obviously better than that of control medicaments of bacillus subtilis and carbendazim under the condition of firstly inoculating pathogenic bacteria and then treating the penicillium beilii 47M-1.

TABLE 347M-1 therapeutic Effect on Fusarium wilt

TABLE 447M-1 has preventive effect on fusarium wilt

Example 6 growth promoting action of Penicillium beijerinckii 47M-1 on sesame

A bacterial suspension of Penicillium beilii 47M-1: diluting the high-spore powder to 1 × 10⁸CFU/mL, spare.

Fermentation filtrate: will be 1 × 10⁸Inoculating the CFU/mL bacterial suspension into 100mL PD culture solution according to 3%, shaking and culturing at 28 ℃ for 5d at 180r/min by a shaking table, and filtering twice by a filter membrane of 0.22 mu m to remove hyphae to obtain sterile filtrate.

The sesame seeds (Zhengzhi 13) are sterilized by 2 percent (w/v) NaClO for 15-20 min, washed by sterile distilled water for 3 times, tiled on sterile filter paper and dried. And (3) sterilizing soil: putting vermiculite into a nutrition pot at a ratio of 3:1(w/w), dibbling sterilized sesame seeds into the nutrition pot, wherein each hole is 6-7 granules, and placing the nutrition pot in a constant-temperature incubator with a temperature of 30 ℃ for 16h illumination/a temperature of 28 ℃ for 8h darkness for culture.

And (3) taking 4-leaf 1-heart-stage sesame seedlings with consistent growth vigor, and irrigating roots of the sesame seedlings with bacterial suspension of penicillium bailii 47M-1 and fermentation filtrate to treat the sesame, wherein each pot is 20mL, and each treatment is performed in 3 pots, and sterile water treatment is used as a control. And 7d, performing secondary root irrigation treatment, and measuring the root length, the plant height, the dry weight and the wet weight of the root and the overground part of the sesame seedling 2 weeks after the primary treatment. Drying at 105 deg.C for 30min, oven drying at 80 deg.C to constant weight, and weighing.

The results showed that (FIG. 3, Table 5) Penicillium beijerinckii 47M-1 was able to increase the plant height, root length, wet weight and dry weight of sesame. The bacterial suspension of the penicillium beilii 47M-1 has obvious growth promoting effect on the root system of sesame, the dry weight of the overground part is increased by 5.92 percent, the dry weight of the root is increased by 29.44 percent, the fermentation filtrate has obvious growth promoting effect on the overground part of a plant, the dry weight of the overground part is increased by 8.25 percent, and the dry weight of the root is increased by 3.7 percent, which indicates that the penicillium beilii 47M-1 has good growth promoting effect.

TABLE 5 growth promoting effect of Penicillium beijerinckii 47M-1 on sesame

Example 7 Induction of sesame resistance to wilt disease by Penicillium bailii 47M-1

Extracting total RNA of the roots of the sesame seeds treated differently, and detecting the purity, concentration and integrity of the total RNA. Then first chain cDNA is synthesized and detected, primers of disease-resistant related genes are synthesized, and changes of relative expression quantity of each gene are detected by adopting real-time fluorescence quantitative PCR. The 4 treatments set for the experiment were: t1: after the penicillium beijerinckii 47M-1 is irrigated to induce for 2 days, the roots are dipped and inoculated with fusarium oxysporum; t2: after 2d of root irrigation with sterile water, dipping the roots to inoculate fusarium oxysporum; t3: after the penicillium beijerinckii 47M-1 is irrigated to induce for 2 days, the roots are dipped in sterile water; t4: and (5) after the roots are irrigated with sterile water for 2 days, the roots are dipped with the sterile water for treatment. Samples were taken at 0h immediately after treatment completion, and then 0h was used as a control.

The test result shows that: after 2d of root irrigation induction treatment of sesame roots by 47M-1 penicillium beilii, fusarium oxysporum is inoculated, the NPR1, Coi1, PR1, PR2 and PR3 genes of the sesame roots start to be obviously up-regulated and expressed at 8h, and compared with plants inoculated with pathogenic bacteria singly, the expression is obviously up-regulated at all sampling time points. In the group with only Penicillium beijerinckii 47M-1, all the genes were up-regulated to different degrees compared with the control group (FIG. 4). The result shows that the penicillium beilii 47M-1 can induce the disease resistance of the root of the sesame and improve the control effect on the sesame wilt through the induction of the resistance.

Sequence listing

<110> institute of plant protection of academy of agricultural sciences of Henan province

<120> penicillium beijerinckii capable of preventing and treating sesame wilt and having growth promoting and induced resistance effects, and screening method and application thereof

<160> 2

<170> SIPOSequenceListing 1.0

<210> 1

<211> 561

<212> DNA

<213> Penicillium beijerinckii (Penicillium biliae)

<400> 1

ccggcgtccg actgaggact ctgggtccac ctcccacccg tgtctcttgt accatgttgc 60

ttcggcgagc ccgcctcacg gccgccgggg ggcatctgcc cccgggcccg cgcccgccga 120

agccccctct gaacgctgtc tgaagattgc agtctgagcg ataagcaaaa attatttaaa 180

actttcaaca acggatctct tggttccggc atcgatgaag aacgcagcga aatgcgataa 240

ctaatgtgaa ttgcagaatt cagtgaatca tcgagtcttt gaacgcacat tgcgccccct 300

ggtattccgg ggggcatgcc tgtccgagcg tcattgctgc cctcaagcac ggcttgtgtg 360

ttgggcctcc gtcctccccc cggggggacg ggcccgaaag gcagcggcgg caccgtgtcc 420

ggtcctcgag cgtatggggc tttgtcaccc gctctgtagg cccggccggc gctggccgac 480

cctccaaccc cattttttca ggttgacctc ggatcaggta gggatacccg ctgaacttaa 540

gcatatcaat aagcggagga a 561

<210> 2

<211> 523

<212> DNA

<213> Penicillium beijerinckii (Penicillium biliae)

<400> 2

gccaatggag cgatttcgtt gattggaaaa agcgtcgcct ggaatcaaca ctaatggatg 60

ctttttcccg ggaaatagga caaggatggc gatggtgagt gcgatcgtac tcgggctcga 120

taatttcaag atccgattat gtcctcttga ccgagtgaac aaatcactga gatgaataaa 180

ttcgatagga caaatcacca ccaaggagct gggcactgtc atgcgctccc tcggccagaa 240

cccttccgag tctgagctgc aggatatgat caacgaggtc gacgccgata ataacggtac 300

catcgatttc cctggtacgc tctccctccc ctccgaatga tgatctcaag ccccgagaag 360

actgatattg acattgcgac acagagttcc ttaccatgat ggcacgtaag atgaaggaca 420

ccgactccga ggaggagatc cgtgaggctt tcaaggtgtt cgaccgcgac aacaacggct 480

tcatctccgc cgccgagctg cgccacgtca tgcctccatc gga 523

Claims

1. The penicillium beijerinckii capable of preventing and treating sesame wilt and having growth promoting and resistance inducing effects is characterized in that the penicillium beijerinckii is penicillium beijerinckii (A)Penicillium bilaiae)47M-1, which is preserved in China center for type culture Collection, with the preservation address: wuhan university collection center, accession number: CCTCC M: 2018899, date of deposit: 12 and 17 months in 2018.

2. Use of penicillium bailii according to claim 1 for the control of sesame diseases.

3. Use of penicillium bailii according to claim 1 for promoting sesame growth.

4. Use of penicillium bailii according to claim 1 for inducing resistance of sesame to blight.

5. Use of penicillium bailii according to claim 1 for the preparation of a fungicide for the control of sesame wilt and for promoting the growth of sesame and inducing resistance of sesame to wilt.

6. An agent for controlling sesame wilt, promoting the growth of sesame and inducing sesame resistance to wilt, which is prepared by using the penicillium bailii according to claim 1.

7. A method for producing the microbial agent according to claim 6, comprising the steps of:

(3) inoculating 5mL of spore suspension liquid on a solid fermentation culture medium, fully mixing, continuously keeping the mixture flat overnight, then placing the mixture in a dark constant-temperature incubator at 28 ℃ for culturing for 7-10 days, when the solid fermentation culture medium fully produces spores, spreading the solid fermentation product into a white porcelain dish paved with a layer of sterile newspaper, covering 1 layer of sterile newspaper, placing the white porcelain dish in a glass window capable of being irradiated by sunlight for airing for 5-7 days, collecting spore powder after airing, and forming high spore powder, namely microbial inoculum, wherein the spore content of penicillium bailii in the high spore powder is 2.3 multiplied by 10¹¹ CFU/g。

8. The method according to claim 7, wherein the PDA culture medium is: 200g of peeled potatoes, 20g of glucose and 15-20 g of agar, adding distilled water to a constant volume of 1000mL, subpackaging in triangular flasks, and sterilizing at 121 ℃ for 30 min.

9. The method of using the microbial preparation according to claim 6, wherein the microbial preparation is resuspended in sterile water containing Tween 80 at 0.05% (v/v) and the spore concentration is adjusted to 1X 10⁸CFU/mL, and root irrigation around the root of sesame.