CN113388588A

CN113388588A - Recombinant bovine herpes simplex virus expressing bovine herpes simplex virus type I gB gene and application thereof

Info

Publication number: CN113388588A
Application number: CN202110764833.5A
Authority: CN
Inventors: 贺笋; 李俊辉; 潘毅平; 赵毅; 程兰玲; 张伟; 唐慧芬; 张慧敏; 张志鹏
Original assignee: Tiankang Pharmaceutical Suzhou Co ltd
Current assignee: Tiankang Pharmaceutical Suzhou Co ltd
Priority date: 2021-07-06
Filing date: 2021-07-06
Publication date: 2021-09-14
Anticipated expiration: 2041-07-06
Also published as: CN113388588B

Abstract

The invention relates to the technical field of biology, and particularly provides a recombinant bovine herpes simplex virus expressing a bovine herpes simplex virus type I gB gene and application thereof. The recombinant bovine sarcoidosis virus provided by the invention contains a bovine herpes virus type I gB gene shown in SEQ ID NO.1, has antigen epitopes of two viruses, can be directly inoculated by taking the virus as a live vector vaccine, avoids operations such as inactivation, adjuvant emulsification and the like, has good immunogenicity on both the bovine sarcoidosis virus and the bovine infectious rhinotracheitis virus, and realizes 'one-shot two prevention'.

Description

Recombinant bovine herpes simplex virus expressing bovine herpes simplex virus type I gB gene and application thereof

Technical Field

The invention relates to the technical field of biology, in particular to a recombinant bovine herpes simplex virus expressing a bovine herpes simplex virus type I gB gene and application thereof.

Background

Bovine herpes virus type i (BHV-i) belongs to an alpha herpes virus, causes Infectious Bovine Rhinotracheitis (IBR) and is manifested as clinical symptoms of respiratory diseases, genital lesions, abortions and even fatal systemic infections. At least 10 glycoproteins exist on the surface of the envelope of BHV-I, among which glycoprotein gB is an important molecule involved in the mechanism of BHV-I entry into host cells and is essential for virus replication. Meanwhile, gB is one of the major antigenic proteins that stimulate the immune response of the host, and induces the host to produce high levels of humoral and cellular immune responses.

The sarcoidosis (LSD), also known as bovine sarcoidosis, bovine nodular dermatitis or bovine pimple Skin Disease, is an acute or subacute infectious Disease of cattle caused by the Virus of the poxviridae sarcoidosis (LSDV).

Currently, epidemic prevention for sarcoidosis: inoculating the seed virus to prepared sheep testis cells, culturing for about 72 hours, harvesting, inactivating with an inactivating agent, and emulsifying with an oil adjuvant.

Epidemic prevention for infectious bovine rhinotracheitis: one is prepared by inoculating infectious bovine rhinotracheitis virus to DMBK cells, culturing for about 72 hours, harvesting, inactivating with an inactivating agent, and emulsifying with an oil adjuvant; the other is prepared by CHO expressing bovine infectious rhinotracheitis gB protein, changing liquid after harvesting, and emulsifying with an oil adjuvant.

However, the vaccines of the schemes need to be prepared by emulsification after inactivation, and the vaccines can only prevent a single epidemic disease after immunization.

In view of the above, the present invention is particularly proposed.

Disclosure of Invention

The first purpose of the invention is to provide a recombinant bovine sarcoidosis virus.

The second object of the present invention is to provide a method for producing the recombinant bovine sarcoidosis virus.

The third object of the present invention is to provide a method for culturing the recombinant bovine sarcoidosis virus.

The fourth purpose of the invention is to provide the application of the recombinant bovine sarcoidosis virus.

The fifth purpose of the invention is to provide a vaccine for preventing the bovine nodular rash and the infectious bovine rhinotracheitis.

The sixth purpose of the invention is to provide a preparation method of the vaccine.

In order to achieve the above purpose of the present invention, the following technical solutions are adopted:

a recombinant bovine sarcoidosis virus, the recombinant bovine sarcoidosis virus being a bovine sarcoidosis virus containing a bovine herpes virus type i gB gene; the nucleotide sequence of the bovine herpes virus type I gB gene is shown as SEQ ID NO. 1.

Furthermore, the bovine herpes virus type I gB gene is inserted into a TK gene of bovine herpes virus, the fragment connection mode is TK1-gB-TK2, and the bovine herpes virus type I gB gene is connected with a first promoter;

preferably, the first promoter comprises p7.5 or p 11.

Furthermore, the 5 'end or the 3' end of the nucleotide sequence of the bovine herpes virus type I gB gene is connected with a reporter gene, the fragment connection mode is TK 1-gB-reporter gene-TK 2 or TK 1-reporter gene-gB-TK 2, the reporter gene is connected with a second promoter, and the second promoter is different from the first promoter;

preferably, the second promoter comprises p7.5 or p 11;

preferably, the reporter gene comprises eGFP, gpt or LacZ.

Further, the fragment was ligated in the manner of TK1-gB-p7.5-p11-eGFP-TK 2.

Furthermore, the nucleotide sequence of the fragment P7.5-gB-TK1 is shown as SEQ ID NO.2, and the nucleotide sequence of the fragment P11-eGFP-TK2 is shown as SEQ ID NO. 3.

The recombinant bovine sarcoidosis virus is prepared by introducing a plasmid containing SEQ ID NO.1 into bovine sarcoidosis virus-infected cells, culturing and screening.

Further, the functional fragment of the plasmid is TK1-gB-P7.5-P11-eGFP-TK2, the nucleotide sequence of the fragment P7.5-gB-TK1 is shown as SEQ ID NO.2, and the nucleotide sequence of the fragment P11-eGFP-TK2 is shown as SEQ ID NO. 3;

preferably, the plasmid is pSP72 or pBluescript II SK (-);

preferably, the cells are sheep testicular cells.

The method for culturing the recombinant bovine herpes zoster virus comprises culturing the recombinant bovine herpes zoster virus on Vero full-suspension cells to obtain the recombinant bovine herpes zoster virus.

The recombinant bovine sarcoidosis virus is applied to the preparation of vaccines for preventing bovine sarcoidosis and bovine infectious rhinotracheitis.

A vaccine for preventing bovine sarcoidosis and infectious bovine rhinotracheitis contains the recombinant bovine sarcoidosis virus as an active ingredient.

The preparation method of the vaccine comprises the steps of uniformly mixing the recombinant bovine sarcoidosis virus and a freeze-drying protective agent, and freeze-drying to obtain the vaccine;

preferably, the lyoprotectant comprises: 1-3% of trehalose, 1-3% of dextran, 0.5-1.5% of mannitol, 0.5-1.5% of polyethylene glycol 4000, 1-3% of cold water fish gelatin, 0.05-2% of Tween 80 and 90-110nmol of glycine.

Compared with the prior art, the invention has the beneficial effects that:

the recombinant bovine sarcoidosis virus provided by the invention contains a bovine herpes virus type I gB gene shown in SEQ ID NO.1, and the virus can express the bovine herpes virus type I antigen while retaining the bovine sarcoidosis virus antigen, so that the virus has antigen epitopes of two viruses, can be directly inoculated by being used as a live vector vaccine, avoids operations such as inactivation, adjuvant emulsification and the like, has good immunogenicity on both the bovine sarcoidosis virus and the bovine infectious rhinotracheitis virus, and realizes 'two prevention by one injection'. Meanwhile, the culture mode of the invention realizes that the recombinant bovine sarcoidosis virus is cultured in the suspended Vero cells, avoids the deficiency of primary cell culture and simplifies the culture process. Compared with the conventional whole virus inactivated vaccine, the vaccine prepared by the recombinant bovine sarcoidosis virus has the advantages of low production cost, good safety and better immune efficacy than that of a single vaccine.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the embodiments or the prior art will be briefly described below, and it is obvious that the drawings in the following description are some embodiments of the present invention, and other drawings can be obtained by those skilled in the art without creative efforts.

FIG. 1 is an identification diagram of pSP72-p7.5-TK1 and pSP72-p11-TK2 in an example of the present invention;

FIG. 2 is an identification diagram of pSP72-P7.5-gB-TK1 and pSP72-P11-EGFP-TK2 in an example of the present invention;

FIG. 3 is a diagram showing the identification of pB-TK1-gB-P7.5-P11-EGFP-TK2 in the examples of the present invention.

Detailed Description

Embodiments of the present invention will be described in detail below with reference to examples, but it will be understood by those skilled in the art that the following examples are only illustrative of the present invention and should not be construed as limiting the scope of the present invention. The examples, in which specific conditions are not specified, were conducted under conventional conditions or conditions recommended by the manufacturer.

Unless otherwise defined, technical and scientific terms used herein have the same meaning as is familiar to those skilled in the art. In addition, any methods or materials similar or equivalent to those described herein can also be used in the present invention.

The invention provides a recombinant bovine herpes zoster virus, which is obtained by inserting expressible bovine herpes zoster virus type I gB gene into the genome of a starting bovine herpes zoster virus. Wherein, the sequence of the bovine herpes virus type I gB gene is shown as SEQ ID NO. 1. The recombinant virus has the antigen of the bovine herpes virus and the antigen of the bovine herpes virus type I, can be directly inoculated as a live vector vaccine, avoids operations such as inactivation, adjuvant emulsification and the like, has good immunogenicity on both the bovine herpes virus and the bovine infectious rhinotracheitis virus, and realizes 'one-needle two-prevention'.

CAATAGGATCTATGGGGGAAATCACAGACCTGGTGGATAAAAAATGGCGGTGTCTGAGCAAAGCTGAGTATCTGAGATCAGGTCGGAAGGTGGTCGCCTTCGACCGGGATGACGACCCTTGGGAAGCCCCTCTCAAGCCTGCAAGGCTGAGTGCTCCAGGAGTGAGAGGGTGGCACACCACCGATGATGTTTACACAGCCCTGGGAAGCGCTGGATTGTATAGAACGGGCACAAGCGTAAACTGCATTGTGGAGGAAGTGGAAGCCAGATCCGTGTACCCCTACGACTCCTTCGCTCTGTCCACCGGTGACATCATTTACATGTCTCCCTTCTATGGCTTGCGGGAAGGAGCTCACAGGGAACACACTTCTTATAGCCCAGAGCGGTTTCAGCAGATAGAGGGCTACTATAAGCGCGACATGGCCACTGGGCGCCGCCTCAAGGAACCTGTTTCACGGAATTTTCTGCGCACCCAACATGTGACTGTGGCTTGGGATTGGGTGCCTAAAAGAAAAAACGTGTGTTCCCTGGCCAAGTGGCGGGAGGCTGATGAAATGCTGAGAGATGAGAGCAGGGGTAATTTCCGCTTTACGGCCAGGTCATTGAGCGCCACCTTCGTGAGCGACTCCCATACATTTGCCCTGCAGAATGTGCCCCTGAGCGATTGCGTAATAGAGGAGGCTGAAGCCGCCGTCGAACGAGTGTACAGGGAACGGTACAATGGTACTCACGTCCTGTCAGGCAGTCTCGAAACCTACCTGGCTCGAGGTGGATTTGTTGTGGCCTTCAGGCCAATGCTTTCAAATGAGCTCGCTAAGTTGTACCTCCAGGAATTGGCCAGATCAAACGGAACACTGGAAGGACTTTTTGCAGCCGCTGCCCCAAAACCTGGCCCTAGAAGAGCTAGAAGAGCTGCTCCAAGCGCTCCTGGAGGACCAGGAGCCGCAAATGGACCAGCAGGTGATGGCGATGCTGGAGGAAGAGTGACAACCGTGAGTAGCGCCGAATTTGCAGCCTTGCAGTTTACTTACGACCATATACAGGATCATGTCAATACAATGTTTTCTAGGCTCGCTACCTCATGGTGCCTGCTCCAGAACAAGGAGCGAGCTCTTTGGGCAGAAGCTGCTAAACTGAATCCAAGCGCAGCAGCTTCAGCCGCACTGGATCGCAGAGCAGCCGCAAGAATGCTGGGCGATGCCATGGCTGTGACATACTGCCATGAACTCGGCGAAGGACGAGTCTTTATTGAGAATAGCATGAGGGCTCCAGGGGGAGTTTGCTACTCTAGACCACCAGTGTCTTTCGCCTTTGGGAATGAGTCTGAGCCAGTGGAAGGGCAGCTGGGCGAGGATAACGAGCTGTTGCCAGGACGGGAGTTGGTGGAACCGTGTACGGCTAATCACAAGAGGTACTTCCGATTCGGGGCCGATTACGTGTATTACGAAAACTACGCTTACGTCAGGAGGGTGCCGCTGGCAGAATTGGAAGTAATTTCTACGTTTGTGGATCTCAACCTCACCGTGCTGGAGGATCGGGAGTTCTTGCCTCTGGAGGTCTACACCCGAGCCGAGTTGGCAGACACAGGCCTGCTGGATTATTCCGAGATCCAGAGGCGAAACCAGCTTCACGAGCTTAGGTTTTACGATATTGACAGAGTGGTAAAAACAGACGGGAACATGGCAATTATGCGAGGCTTGGCCAACTTCTTCCAAGGACTGGGTGCCGTAGGACAAGCTGTGGGTACAGTGGTACTGGGAGCCGCTGGCGCTGCCTTGTCAACTGTTTCAGGTATAGCCTCTTTCATCGCTAATCCTTTTGGTGCGCTGGCTACTGGCCTCTTGGTGCTGGCAGGTCTTGTGGCCGCTTTTCTCGCATATAGGTACATATCACGGCTGCGCTCAAACCCGATGAAGGCTCTTTATCCTATCACCACCAGGGCACTCAAAGACGACGCAAGAGGAGCGACTGCCCCTGGTGAAGAAGAAGAGGAGTTTGACGCCGCAAAGCTGGAGCAGGCACGAGAAATGATTAAGTATATGAGCCTGGTGTCAGCTGTCGAGAGACAGGAACACAAAGCTAAAAAATCTAACAAGGGAGGCCCTCTCCTTGCCACACGGCTTACACAACTGGCTCTTAGAAGACGAGCGCCGCCCGAGTATCAACAATTGCCTATGGCTGATGTCGGCGGCGCCC CGCGGATCAT(SEQ ID NO.1)

In one embodiment, in order to achieve the two immunogenicity of the recombinant bovine sarcoidosis virus, the bovine herpes virus type I gB gene is inserted into the TK gene of the bovine sarcoidosis virus, which does not affect the antigen expression of the bovine sarcoidosis virus and destroys the function of the TK gene, facilitating virus screening, and the fragment is linked in a manner of TK1-gB-TK2, and the bovine herpes virus type I gB gene is linked with a first promoter, which may be TK 1-first promoter-gB-TK 2 or TK 1-gB-first promoter-TK 2, in order to ensure the expression of the gB gene. Wherein, the first promoter can be p7.5 or p 11.

In one embodiment, to achieve the identification screening of recombinant bovine sarcoidosis virus, the nucleotide sequence of the bovine herpes virus type I gB gene is linked at the 5 'or 3' end to a reporter gene in the form of TK 1-gB-reporter-TK 2 or TK 1-reporter-gB-TK 2, it being understood that to ensure that the reporter gene is expressible, the reporter gene is linked to a second promoter, specifically TK 1-gB-first promoter-second promoter-reporter-TK 2, TK 1-reporter-second promoter-first promoter-gB-TK 2, and so forth, with the first promoter being different from the second promoter. Wherein, the second promoter can be p7.5 or p 11.

Preferably, the reporter gene includes eGFP, gpt or LacZ, etc.

In a preferred embodiment, the fragment is ligated in the manner TK1-gB-p7.5-p11-eGFP-TK 2.

In a preferred embodiment, the nucleotide sequence of the fragment P7.5-gB-TK1 is shown in SEQ ID NO.2, and the nucleotide sequence of the fragment P11-eGFP-TK2 is shown in SEQ ID NO. 3.

CTAGTAAGCTCATCTATATACTATATAGTAATACCAATACTCAAGACTACGAAACTGATACAATCTCTTATCATGTGGGTAATGTTCTCGATGTCGATAGCCATATGCCCGGTAGTTGCGATATACATAAACTGATCACTAATTCCAAACCCACCCGCTTTTTATAGTAAGTTTTTCACCCATAAATAATAAATACAATAATTAATTTCTCGTAAAAGTAGAAAATATATTCTAATTTATTGCACGGTAAGGAAGTAGAATCATAAAGAACAGTGACGGATCCCCGGGATCTATGGGGGAAATCACAGACCTGGTGGATAAAAAATGGCGGTGTCTGAGCAAAGCTGAGTATCTGAGATCAGGTCGGAAGGTGGTCGCCTTCGACCGGGATGACGACCCTTGGGAAGCCCCTCTCAAGCCTGCAAGGCTGAGTGCTCCAGGAGTGAGAGGGTGGCACACCACCGATGATGTTTACACAGCCCTGGGAAGCGCTGGATTGTATAGAACGGGCACAAGCGTAAACTGCATTGTGGAGGAAGTGGAAGCCAGATCCGTGTACCCCTACGACTCCTTCGCTCTGTCCACCGGTGACATCATTTACATGTCTCCCTTCTATGGCTTGCGGGAAGGAGCTCACAGGGAACACACTTCTTATAGCCCAGAGCGGTTTCAGCAGATAGAGGGCTACTATAAGCGCGACATGGCCACTGGGCGCCGCCTCAAGGAACCTGTTTCACGGAATTTTCTGCGCACCCAACATGTGACTGTGGCTTGGGATTGGGTGCCTAAAAGAAAAAACGTGTGTTCCCTGGCCAAGTGGCGGGAGGCTGATGAAATGCTGAGAGATGAGAGCAGGGGTAATTTCCGCTTTACGGCCAGGTCATTGAGCGCCACCTTCGTGAGCGACTCCCATACATTTGCCCTGCAGAATGTGCCCCTGAGCGATTGCGTAATAGAGGAGGCTGAAGCCGCCGTCGAACGAGTGTACAGGGAACGGTACAATGGTACTCACGTCCTGTCAGGCAGTCTCGAAACCTACCTGGCTCGAGGTGGATTTGTTGTGGCCTTCAGGCCAATGCTTTCAAATGAGCTCGCTAAGTTGTACCTCCAGGAATTGGCCAGATCAAACGGAACACTGGAAGGACTTTTTGCAGCCGCTGCCCCAAAACCTGGCCCTAGAAGAGCTAGAAGAGCTGCTCCAAGCGCTCCTGGAGGACCAGGAGCCGCAAATGGACCAGCAGGTGATGGCGATGCTGGAGGAAGAGTGACAACCGTGAGTAGCGCCGAATTTGCAGCCTTGCAGTTTACTTACGACCATATACAGGATCATGTCAATACAATGTTTTCTAGGCTCGCTACCTCATGGTGCCTGCTCCAGAACAAGGAGCGAGCTCTTTGGGCAGAAGCTGCTAAACTGAATCCAAGCGCAGCAGCTTCAGCCGCACTGGATCGCAGAGCAGCCGCAAGAATGCTGGGCGATGCCATGGCTGTGACATACTGCCATGAACTCGGCGAAGGACGAGTCTTTATTGAGAATAGCATGAGGGCTCCAGGGGGAGTTTGCTACTCTAGACCACCAGTGTCTTTCGCCTTTGGGAATGAGTCTGAGCCAGTGGAAGGGCAGCTGGGCGAGGATAACGAGCTGTTGCCAGGACGGGAGTTGGTGGAACCGTGTACGGCTAATCACAAGAGGTACTTCCGATTCGGGGCCGATTACGTGTATTACGAAAACTACGCTTACGTCAGGAGGGTGCCGCTGGCAGAATTGGAAGTAATTTCTACGTTTGTGGATCTCAACCTCACCGTGCTGGAGGATCGGGAGTTCTTGCCTCTGGAGGTCTACACCCGAGCCGAGTTGGCAGACACAGGCCTGCTGGATTATTCCGAGATCCAGAGGCGAAACCAGCTTCACGAGCTTAGGTTTTACGATATTGACAGAGTGGTAAAAACAGACGGGAACATGGCAATTATGCGAGGCTTGGCCAACTTCTTCCAAGGACTGGGTGCCGTAGGACAAGCTGTGGGTACAGTGGTACTGGGAGCCGCTGGCGCTGCCTTGTCAACTGTTTCAGGTATAGCCTCTTTCATCGCTAATCCTTTTGGTGCGCTGGCTACTGGCCTCTTGGTGCTGGCAGGTCTTGTGGCCGCTTTTCTCGCATATAGGTACATATCACGGCTGCGCTCAAACCCGATGAAGGCTCTTTATCCTATCACCACCAGGGCACTCAAAGACGACGCAAGAGGAGCGACTGCCCCTGGTGAAGAAGAAGAGGAGTTTGACGCCGCAAAGCTGGAGCAGGCACGAGAAATGATTAAGTATATGAGCCTGGTGTCAGCTGTCGAGAGACAGGAACACAAAGCTAAAAAATCTAACAAGGGAGGCCCTCTCCTTGCCACACGGCTTACACAACTGGCTCTTAGAAGACGAGCGCCGCCCGAGTATCAACAATTGCCTATGGCTGATGTCGGCGGCGCCCCGCGGATGGACTACGGGTATATCCACCTCATCATTGGTCCAATGTTCTCAGGTAAAAGCACAGAACTCATAAGGATTGTGAAGCGGTATCAGATCGCACAGTATAAATGCTGCGTGGTGAAATATCTGAAGGATATCCGGTACGGAAATTCTGTATATACCCACGATAACAACCATGTAAGCGCCATCAGCACCACTCTGCTGTATGATGTCGTCGACAAGATCATGACCGCGG(SEQ ID NO.2)；

AGATGCATCGATAGCGATGCTACGCTAGTCACAATCACCACTTTCATATTTAGAATATATGTATGTAAAAATATAGTAGAATTTCATTTTGTTTTTTTCTATGCTATAAATAGATCTATGTCTAGAGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGGTAGATTTATGCATCCTCTTGTCATGAGAAGTCGAATTGTTCCCATTCTGTGTGTTGCAGCTACAGATGGAGATACATAGAGATACTCGTGGATTTTGCTTAGTGTTGAGTTTTGTTCTGGTTGTGAACTAAAAGTTTATACATTTGCAGGAAATAAATAGCCTTTTGTTTAAATCAAAAGGTCTTACCTATGTTATTGCGTGAGGCATTGGATCCCAAAGAGAGAACTCCAAAATGCGAGGCTACATGTTATGGACTAGTATCAGGTTGGGAGACCTCCTGAGAAGCTCCAGCAAGTAAGCCTCGATCACGCAAAATGTTTGAGGTCTGATGTTCAATAGCTTGTTTTGTTTCACTTTGCTTTGGACTTTCTTTTCGCCAATGAGCTATGTTTCTGATGGTTTTCACTCTTTTGGTGTGTAGAGAACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACAGAATTCAGTAAATGGAGTGCTACAAAGACGCCGCTTTTAGCAAACGGATAACAAAAGAAAAGGAGATCGAGTTGATCGGCGGTAAAGAGAAATATAAATCTGTGTGTCGCAAGTGCTATTTCCTGGAAGGGCCCACTGCT(SEQ ID NO.3)

The invention also provides a preparation method of the recombinant bovine sarcoidosis virus, which comprises the steps of introducing the plasmid containing SEQ ID NO.1 into bovine sarcoidosis virus infected cells, culturing and screening to obtain the recombinant bovine sarcoidosis virus. The mode utilizes the principle that the transfer vector plasmid and the bovine sarcoidosis virus realize homologous recombination in host cells to integrate exogenous genes into a specific genome site of the bovine sarcoidosis virus. Preferably, the homologous recombination segment of the plasmid and the bovine sarcoidosis virus is TK1-gB-P7.5-P11-eGFP-TK2, the nucleotide sequence of the segment P7.5-gB-TK1 is shown as SEQ ID NO.2, and the nucleotide sequence of the segment P11-eGFP-TK2 is shown as SEQ ID NO. 3. Wherein, the plasmid is preferably pSP72 or pBluescript II SK (-), and the cell is preferably sheep testis cell.

The invention also provides a culture method of the recombinant bovine herpes zoster virus, which is to culture the recombinant bovine herpes zoster virus on Vero full-suspension cells to obtain the recombinant bovine herpes zoster virus. The domestication method of the Vero whole suspension cells comprises the following steps:

culturing Vero adherent cells in a serum-containing culture medium after recovery, wherein the addition amount of serum is 8%, continuously transmitting for 2-3 generations, reducing the serum content after the cells are stably proliferated, reducing the serum content by 2% every transmission generation, adding 2% of yeast extract and 2% of plant hydrolyzed protein into the culture medium after the serum concentration is reduced to 5%, continuously maintaining the original serum concentration for culture if the cells grow slowly until the serum content is reduced to 1%, and directly transferring the Vero adherent cells into a shake flask for suspension culture after the cells grow stably and culturing for 1-2 generations. Adopting serum-free suspension culture medium, adding 1% yeast extract, 1% plant hydrolyzed protein, and culturing Vero suspension cells in shake flask at 1.0 × 10⁶cells/mL was the initial seeding density, cell viability and density were calculated daily, passage after doubling (about 68h), culture conditions were: 37 ℃ and 5.0% CO₂The humidity is more than 60 percent, and the culture is carried out in a culture shaker of 80r/min-120r/min (50mm orbital throw shake). Transferring the Vero adherent cells into a suspension culture medium, and adding vitamins, amino acids, inorganic salts and the like which are suitable for suspension culture, wherein L-glutamine (1mmol/L), L-glutamic acid (1.5mmol/L), L-leucine (0.05mmol/L) and L-methionine (1.5 mmol/L); vitamin B6(1.5mg/L), vitamin B12(1.0mg/L), nicotinamide (0.15 mg/L); magnesium sulfate (1.5mg/L), and culturing until the cells are stable, partially freezing, and partially continuing to subculture the recombinant virus culture antigen.

The recombinant bovine sarcoidosis virus provided by the invention can be used for preparing vaccines for preventing bovine sarcoidosis and bovine infectious rhinotracheitis. Compared with the conventional whole virus inactivated vaccine, the vaccine has low production cost and can generate good immune efficacy in application. The vaccine is prepared by mixing recombinant bovine sarcoidosis virus with a freeze-drying protective agent, and freeze-drying. The freeze-drying protective agent comprises: 1-3% of trehalose, 1-3% of dextran, 0.5-1.5% of mannitol, 0.5-1.5% of polyethylene glycol 4000, 1-3% of cold water fish gelatin, 0.05-2% of Tween 80 and 90-110nmol of glycine.

The invention is further illustrated by the following specific examples, which, however, are to be construed as merely illustrative, and not limitative of the remainder of the disclosure in any way whatsoever.

EXAMPLE 1 preparation of transfer vector plasmid

Construction of pSP72-p7.5-gB-TK1 plasmid

According to the P7.5 and TK1 gene sequences, enzyme cutting sites HindIII (AAGCT) are added at the 5 'end of a P7.5 promoter, and enzyme cutting sites BamH I (GGATC) are added at the 3' end; the 5 'end of TK1 is added with a restriction enzyme cutting site SalII (CCGCGG), and the 3' end is added with a restriction enzyme cutting site SacII (CCGCGG); p7.5 and TK1 were artificially synthesized in conjunction.

The 5 'end of gB gene is added with enzyme cutting site BamHI (GGATC), the 3' end is added with enzyme cutting site SalII (CCGCGG), and the gene is artificially synthesized.

Carrying out double enzyme digestion on the vector pSP72 and the vector P7.5-TK1 by HindIII and SacII respectively, removing enzyme digestion buffer solution by using a gel recovery kit after the enzyme digestion is finished to obtain pSP72 and the vector P7.5-TK1 with enzyme digestion sites linearly, connecting the pSP72 and the vector P7.5-TK1 by using T4DNA ligase, transforming the product into competent cells, coating agarose solid culture medium (AmP) for overnight culture in an incubator at 37 ℃, picking a single colony in a test tube containing the culture solution on the next day, and placing the test tube in a shaker at 37 ℃ for overnight culture. The plasmid was extracted and identified as positive and named pSP72-p7.5-TK 1. The identification picture is shown in lane 1 of FIG. 1.

Carrying out double enzyme digestion on the vector pSP72-P7.5-TK1 and gB genes respectively by using BamHI and SalII, removing enzyme digestion buffer solution by using a gel recovery kit after the enzyme digestion is finished, obtaining pSP72-P7.5-TK1 and gB DAN with linear enzyme digestion sites, connecting the pSP72-P7.5-TK1 and gB DAN by using T4DNA ligase, transforming products into competent cells, coating agarose solid culture medium (AmP), carrying out incubator overnight culture at 37 ℃, picking single colonies in a test tube containing the culture solution on the next day, and placing the test tube in a shaker at 37 ℃ for overnight culture. The plasmid was extracted and identified as positive and named pSP72-p7.5-gB-TK 1. The identification picture is shown in lane 2 of FIG. 2.

Construction of pSP72-P11-EGFP-TK2 plasmid

According to the gene sequences of P11 and TK2, a restriction enzyme site BspdII (ATCGAT) is added at the 5 'end of a P11 promoter, and a restriction enzyme site BglII (AGATCT) is added at the 3' end; adding an enzyme cutting site EcoRI (GAATTC) at the 5 'end of TK2, and adding an enzyme cutting site ApaI (GGGCCC) at the 3' end; P11-TK2 are linked together and artificially synthesized.

The EGFP gene is artificially synthesized by adding a cleavage site BglII (AGATCT) at the 5 'end and adding a cleavage site EcoRI (GAATTC) at the 3' end.

With BspDI and ApaICarrying out double enzyme digestion on the vector pSP72 and the vector P11-TK2 respectively, removing enzyme digestion buffer solution by using a gel recovery kit after the enzyme digestion is finished, obtaining pSP72 and P11-TK2 with linear enzyme digestion sites, connecting the pSP72 and the P11-TK2 by using T4DNA ligase, transforming the product into competent cells, coating an agarose solid culture medium (AmP) on the competent cells, carrying out overnight culture in a 37 ℃ incubator, picking a single colony in a test tube containing the culture solution on the next day, and placing the test tube in a 37 ℃ shaking table for overnight culture. The plasmid was extracted and identified as positive and named pSP72-P11-TK 2. The identification picture is shown in lane 2 of FIG. 1.

Carrying out double enzyme digestion on the vector pSP72-P11-TK2 and gB genes respectively by BglII and EcoRI, removing an enzyme digestion buffer solution by using a gel recovery kit after the enzyme digestion is finished, obtaining pSP72-P11-TK2 and EGFP DAN which are linear and provided with enzyme digestion sites, connecting the pSP72-P11-TK2 and the EGFP DAN by using T4DNA ligase, transforming the product into competent cells, coating agarose solid culture medium (AmP), carrying out incubator overnight culture at 37 ℃, picking a single colony in a test tube containing the culture solution on the next day, and placing the test tube in a shaker at 37 ℃ for overnight culture. Extracting plasmid, identifying positive, and naming the plasmid as pSP72-P11-EGFP-TK 2. The identification picture is shown in lane 4 of FIG. 2.

Construction of pB-TK1-gB-P7.5-P11-EGFP-TK2 transfer vector

The vector pBluescript II SK (-) and the vector pSP72-p7.5-gB-TK1 were double digested with HindIII and SacII, after the digestion was completed, the vector and the target fragment p7.5-gB-TK1 were recovered with a gel recovery kit to obtain a linear pBluescript II SK (-) having a cleavage site (hereinafter referred to as pB) and a p7.5-gB-TK1 fragment, which were ligated with T4DNA ligase, the competent cells were transformed, the competent cells were plated with agarose solid medium (Amp), cultured overnight at 37 ℃ in a incubator, and a single colony was picked the next day in a tube containing the culture medium and cultured overnight at 37 ℃ in a shaker. Extracting plasmid, identifying positive, and naming the plasmid as pB-p7.5-gB-TK 1.

Carrying out double enzyme digestion on the vectors pB-P7.5-gB-TK1 and pSP72-P11-EGFP-TK2 by BspdI and ApaI respectively, recovering the vector and a target fragment by using a gel recovery kit after the enzyme digestion is finished, obtaining the linear pB-P7.5-gB-TK1 and P11-EGFP-TK2 with enzyme digestion sites, connecting the products into competent cells by using T4DNA ligase, coating agarose solid culture medium (AmP), carrying out incubator overnight culture at 37 ℃, picking single colonies in a test tube containing culture solution on the next day, and placing a shaker at 37 ℃ for overnight culture. Extracting plasmid, identifying positive, and naming the plasmid as pB-TK1-gB-P7.5-P11-EGFP-TK 2. The enzyme cleavage was identified in lane 2 of FIG. 3.

Example 2 preparation of recombinant bovine sarcoidosis Virus

Spreading LT cells (sheep testicular cells) on a 6-well plate, inoculating the LT cells on the 6-well plate with a bovine nodular rash attenuated strain according to a multiple of infection (M.O.I.) number of 0.1 after the cells grow into a monolayer, adsorbing at 37 ℃ for 2h, and transfecting the prepared recombinant transfer plasmid pB-TK1-gB-P7.5-P11-EGFP-TK2 by using a liposome according to a Lipofectamine method^TMTransfection was performed separately in the 2000Transfection Reagent kit instructions. Each well of cells is recombined with 2-3 mug of pB-TK1-gB-P7.5-P11-EGFP-TK2 plasmid,

the liposome is diluted with OPTI-MEM in an amount of about 100 to 200. mu.L, which is about 3 times the amount of DNA used (mass to volume ratio). After 48h of transfection, the fluorescence was observed under a fluorescence microscope, and the progressive development of cytopathic effect was observed. When 90% of the cells were diseased and fluorescence was present, the cell culture plates were stored at-70 ℃.

Purification of recombinant bovine sarcoidosis virus

Spreading sheep testis cell (LT) on 6-well plate, diluting the harvested virus by 10 times gradient after cell growth to form single layer, and collecting 10^－5～10^－7100. mu.L of each was added to a 6-well plate containing LT cells, and each well was supplemented with 2mL of serum-free MEM for 2 hours. After 2 hours, the culture supernatant was discarded, and sterile low-melting-point gel was mixed with 2% serum-containing MEM, and the mixture was applied to cells inoculated with recombinant viruses, and after gelling and solidification, the cells were placed at 37 ℃ with 5% CO₂In the incubator, after 2 days, the fluorescence appearsAnd (3) marking the light part, taking out the fluorescence-marked area from a six-well plate in a biosafety cabinet, putting the fluorescence-marked area into a centrifugal tube containing 1.5ml of serum-free culture medium, freezing and thawing for three times, inoculating a part of LT cells, using a part of LT cells for molecular biological identification, and continuously performing amplification culture on positive cells, wherein the name of the fluorescence-marked area is r LSD-IBRV-g B.

Example 3 domestication of recombinant bovine sarcoidosis Virus

Culturing Vero adherent cells in a serum-containing culture medium after recovery, wherein the addition amount of serum is 8%, continuously transmitting for 2-3 generations, reducing the serum content after the cells are stably proliferated, reducing the serum content by 2% every transmission generation, adding 2% of yeast extract and 2% of plant hydrolyzed protein into the culture medium after the serum concentration is reduced to 5%, continuously maintaining the original serum concentration for culture if the cells grow slowly until the serum content is reduced to 1%, and directly transferring the Vero adherent cells into a shake flask for suspension culture after the cells grow stably and culturing for 1-2 generations. Adopting serum-free suspension culture medium, adding 1% yeast extract, 1% plant hydrolyzed protein, and culturing Vero suspension cells in shake flask at 1.0 × 10⁶cells/mL was the initial seeding density, cell viability and density were calculated daily, passage after doubling (about 68h), culture conditions were: 37 ℃ and 5.0% CO₂The culture was carried out in a shaker at a humidity of > 60% and a speed of 80r/min of 120r/min (50mm orbital throw shake). Transferring the Vero adherent cells into a suspension culture medium, and adding vitamins, amino acids, inorganic salts and the like which are suitable for suspension culture, wherein L-glutamine (1mmol/L), L-glutamic acid (1.5mmol/L), L-leucine (0.05mmol/L) and L-methionine (1.5 mmol/L); vitamin B6(1.5mg/L), vitamin B12(1.0mg/L), nicotinamide (0.15 mg/L); magnesium sulfate (1.5mg/L) was added to the culture.

After the cells are stably proliferated, inoculating the amplified r LSD-IBRV-g B to inoculate the cells with the MOI of 0.1, harvesting the viruses when the cell viability is close to 60%, freezing and storing, measuring the poison price, continuously proliferating on the suspended Vero, and when the virus titer reaches 10^7.5TCID₅₀at/mL, acclimation was considered successful.

Example 4 preparation of vaccine for preventing bovine sarcoidosis and infectious bovine rhinotracheitis

The virus titer r LSD-IBRV-g B is mixed with freeze-drying protective agent (2% trehalose, 3% dextran, 1% mannitol, 1% polyethylene glycol 4000, 2% cold water fish gelatin, 0.1% Tween 80 and 100nmol glycine) and then freeze-dried. Three bottles were randomly drawn for virus content determination, and the immune dose per head was about 10^6.5TCID₅₀/mL。

Example 5 Security verification

Selecting 20 calves of 3-5 months old, 15 calves as immunization group, and 5 calves as control, wherein the immunization group is injected with 1mL (containing 10% of the total weight)^7.5TCID₅₀) And a control group is injected with 1mL of diluent intradermally, and the body temperature is continuously monitored at fixed points, and ingestion and abnormal clinical symptoms are observed. The results show that: the body temperature and the ingestion of the immune group and the control group are not affected, and abnormal clinical symptoms are avoided.

Example 6 validation of efficacy

Selecting 20 calves of 3-5 months old, and dividing into four groups, wherein the groups are LSD low virulent strain, r LSD-IBRV-g B recombinant virus and IBRV whole virus inactivated vaccine respectively. Grouping is shown in Table 1

Table 1 three different vaccine efficacy test groups

Note: "-" does not apply.

Serum was collected from vein blood collection 21 days after primary immunization and 14 days after secondary immunization for detection of neutralizing antibody, and the serum was diluted 1:2 times. The results show that: the neutralizing capacity of the recombinant virus of the rLSD-IBRV-g B to the LSD is obviously higher than the single-vaccine immunity efficacy of the LSD; the immunization efficiency of the rLSD-IBRV-g B recombinant virus is obviously higher than that of an IBRV inactivated vaccine, and the result is shown in a table 2.

TABLE 2 neutralizing antibody titers after immunization with different vaccines

Example 7 cost accounting

The cost of LSD attenuated virus per 100 heads is 3 yuan, the cost of IBRV whole virus inactivated vaccine is 30 yuan, the cost of Vero suspension culture r LSD-IBRV-g B recombinant virus per 100 heads prepared by the invention is only 1 yuan, the production cost is extremely low, and the progress of the invention is highlighted. The results are shown in Table 3.

TABLE 3 cost accounting

While particular embodiments of the present invention have been illustrated and described, it would be obvious that various other changes and modifications can be made without departing from the spirit and scope of the invention. It is therefore intended to cover in the appended claims all such changes and modifications that are within the scope of this invention.

SEQUENCE LISTING

<110> Tiankang pharmaceutical (Suzhou) Co., Ltd

<120> recombinant bovine sarcoidosis virus expressing bovine herpes virus type I gB gene and application thereof

<160> 3

<170> PatentIn version 3.5

<210> 1

<211> 2206

<212> DNA

<213> Artificial sequence

<400> 1

caataggatc tatgggggaa atcacagacc tggtggataa aaaatggcgg tgtctgagca 60

aagctgagta tctgagatca ggtcggaagg tggtcgcctt cgaccgggat gacgaccctt 120

gggaagcccc tctcaagcct gcaaggctga gtgctccagg agtgagaggg tggcacacca 180

ccgatgatgt ttacacagcc ctgggaagcg ctggattgta tagaacgggc acaagcgtaa 240

actgcattgt ggaggaagtg gaagccagat ccgtgtaccc ctacgactcc ttcgctctgt 300

ccaccggtga catcatttac atgtctccct tctatggctt gcgggaagga gctcacaggg 360

aacacacttc ttatagccca gagcggtttc agcagataga gggctactat aagcgcgaca 420

tggccactgg gcgccgcctc aaggaacctg tttcacggaa ttttctgcgc acccaacatg 480

tgactgtggc ttgggattgg gtgcctaaaa gaaaaaacgt gtgttccctg gccaagtggc 540

gggaggctga tgaaatgctg agagatgaga gcaggggtaa tttccgcttt acggccaggt 600

cattgagcgc caccttcgtg agcgactccc atacatttgc cctgcagaat gtgcccctga 660

gcgattgcgt aatagaggag gctgaagccg ccgtcgaacg agtgtacagg gaacggtaca 720

atggtactca cgtcctgtca ggcagtctcg aaacctacct ggctcgaggt ggatttgttg 780

tggccttcag gccaatgctt tcaaatgagc tcgctaagtt gtacctccag gaattggcca 840

gatcaaacgg aacactggaa ggactttttg cagccgctgc cccaaaacct ggccctagaa 900

gagctagaag agctgctcca agcgctcctg gaggaccagg agccgcaaat ggaccagcag 960

gtgatggcga tgctggagga agagtgacaa ccgtgagtag cgccgaattt gcagccttgc 1020

agtttactta cgaccatata caggatcatg tcaatacaat gttttctagg ctcgctacct 1080

catggtgcct gctccagaac aaggagcgag ctctttgggc agaagctgct aaactgaatc 1140

caagcgcagc agcttcagcc gcactggatc gcagagcagc cgcaagaatg ctgggcgatg 1200

ccatggctgt gacatactgc catgaactcg gcgaaggacg agtctttatt gagaatagca 1260

tgagggctcc agggggagtt tgctactcta gaccaccagt gtctttcgcc tttgggaatg 1320

agtctgagcc agtggaaggg cagctgggcg aggataacga gctgttgcca ggacgggagt 1380

tggtggaacc gtgtacggct aatcacaaga ggtacttccg attcggggcc gattacgtgt 1440

attacgaaaa ctacgcttac gtcaggaggg tgccgctggc agaattggaa gtaatttcta 1500

cgtttgtgga tctcaacctc accgtgctgg aggatcggga gttcttgcct ctggaggtct 1560

acacccgagc cgagttggca gacacaggcc tgctggatta ttccgagatc cagaggcgaa 1620

accagcttca cgagcttagg ttttacgata ttgacagagt ggtaaaaaca gacgggaaca 1680

tggcaattat gcgaggcttg gccaacttct tccaaggact gggtgccgta ggacaagctg 1740

tgggtacagt ggtactggga gccgctggcg ctgccttgtc aactgtttca ggtatagcct 1800

ctttcatcgc taatcctttt ggtgcgctgg ctactggcct cttggtgctg gcaggtcttg 1860

tggccgcttt tctcgcatat aggtacatat cacggctgcg ctcaaacccg atgaaggctc 1920

tttatcctat caccaccagg gcactcaaag acgacgcaag aggagcgact gcccctggtg 1980

aagaagaaga ggagtttgac gccgcaaagc tggagcaggc acgagaaatg attaagtata 2040

tgagcctggt gtcagctgtc gagagacagg aacacaaagc taaaaaatct aacaagggag 2100

gccctctcct tgccacacgg cttacacaac tggctcttag aagacgagcg ccgcccgagt 2160

atcaacaatt gcctatggct gatgtcggcg gcgccccgcg gatcat 2206

<210> 2

<211> 2711

<212> DNA

<213> Artificial sequence

<400> 2

ctagtaagct catctatata ctatatagta ataccaatac tcaagactac gaaactgata 60

caatctctta tcatgtgggt aatgttctcg atgtcgatag ccatatgccc ggtagttgcg 120

atatacataa actgatcact aattccaaac ccacccgctt tttatagtaa gtttttcacc 180

cataaataat aaatacaata attaatttct cgtaaaagta gaaaatatat tctaatttat 240

tgcacggtaa ggaagtagaa tcataaagaa cagtgacgga tccccgggat ctatggggga 300

aatcacagac ctggtggata aaaaatggcg gtgtctgagc aaagctgagt atctgagatc 360

aggtcggaag gtggtcgcct tcgaccggga tgacgaccct tgggaagccc ctctcaagcc 420

tgcaaggctg agtgctccag gagtgagagg gtggcacacc accgatgatg tttacacagc 480

cctgggaagc gctggattgt atagaacggg cacaagcgta aactgcattg tggaggaagt 540

ggaagccaga tccgtgtacc cctacgactc cttcgctctg tccaccggtg acatcattta 600

catgtctccc ttctatggct tgcgggaagg agctcacagg gaacacactt cttatagccc 660

agagcggttt cagcagatag agggctacta taagcgcgac atggccactg ggcgccgcct 720

caaggaacct gtttcacgga attttctgcg cacccaacat gtgactgtgg cttgggattg 780

ggtgcctaaa agaaaaaacg tgtgttccct ggccaagtgg cgggaggctg atgaaatgct 840

gagagatgag agcaggggta atttccgctt tacggccagg tcattgagcg ccaccttcgt 900

gagcgactcc catacatttg ccctgcagaa tgtgcccctg agcgattgcg taatagagga 960

ggctgaagcc gccgtcgaac gagtgtacag ggaacggtac aatggtactc acgtcctgtc 1020

aggcagtctc gaaacctacc tggctcgagg tggatttgtt gtggccttca ggccaatgct 1080

ttcaaatgag ctcgctaagt tgtacctcca ggaattggcc agatcaaacg gaacactgga 1140

aggacttttt gcagccgctg ccccaaaacc tggccctaga agagctagaa gagctgctcc 1200

aagcgctcct ggaggaccag gagccgcaaa tggaccagca ggtgatggcg atgctggagg 1260

aagagtgaca accgtgagta gcgccgaatt tgcagccttg cagtttactt acgaccatat 1320

acaggatcat gtcaatacaa tgttttctag gctcgctacc tcatggtgcc tgctccagaa 1380

caaggagcga gctctttggg cagaagctgc taaactgaat ccaagcgcag cagcttcagc 1440

cgcactggat cgcagagcag ccgcaagaat gctgggcgat gccatggctg tgacatactg 1500

ccatgaactc ggcgaaggac gagtctttat tgagaatagc atgagggctc cagggggagt 1560

ttgctactct agaccaccag tgtctttcgc ctttgggaat gagtctgagc cagtggaagg 1620

gcagctgggc gaggataacg agctgttgcc aggacgggag ttggtggaac cgtgtacggc 1680

taatcacaag aggtacttcc gattcggggc cgattacgtg tattacgaaa actacgctta 1740

cgtcaggagg gtgccgctgg cagaattgga agtaatttct acgtttgtgg atctcaacct 1800

caccgtgctg gaggatcggg agttcttgcc tctggaggtc tacacccgag ccgagttggc 1860

agacacaggc ctgctggatt attccgagat ccagaggcga aaccagcttc acgagcttag 1920

gttttacgat attgacagag tggtaaaaac agacgggaac atggcaatta tgcgaggctt 1980

ggccaacttc ttccaaggac tgggtgccgt aggacaagct gtgggtacag tggtactggg 2040

agccgctggc gctgccttgt caactgtttc aggtatagcc tctttcatcg ctaatccttt 2100

tggtgcgctg gctactggcc tcttggtgct ggcaggtctt gtggccgctt ttctcgcata 2160

taggtacata tcacggctgc gctcaaaccc gatgaaggct ctttatccta tcaccaccag 2220

ggcactcaaa gacgacgcaa gaggagcgac tgcccctggt gaagaagaag aggagtttga 2280

cgccgcaaag ctggagcagg cacgagaaat gattaagtat atgagcctgg tgtcagctgt 2340

cgagagacag gaacacaaag ctaaaaaatc taacaaggga ggccctctcc ttgccacacg 2400

gcttacacaa ctggctctta gaagacgagc gccgcccgag tatcaacaat tgcctatggc 2460

tgatgtcggc ggcgccccgc ggatggacta cgggtatatc cacctcatca ttggtccaat 2520

gttctcaggt aaaagcacag aactcataag gattgtgaag cggtatcaga tcgcacagta 2580

taaatgctgc gtggtgaaat atctgaagga tatccggtac ggaaattctg tatataccca 2640

cgataacaac catgtaagcg ccatcagcac cactctgctg tatgatgtcg tcgacaagat 2700

catgaccgcg g 2711

<210> 3

<211> 1401

<212> DNA

<213> Artificial sequence

<400> 3

agatgcatcg atagcgatgc tacgctagtc acaatcacca ctttcatatt tagaatatat 60

gtatgtaaaa atatagtaga atttcatttt gtttttttct atgctataaa tagatctatg 120

tctagagtga gcaagggcga ggagctgttc accggggtgg tgcccatcct ggtcgagctg 180

gacggcgacg taaacggcca caagttcagc gtgtccggcg agggcgaggg cgatgccacc 240

tacggcaagc tgaccctgaa gttcatctgc accaccggca agctgcccgt gccctggccc 300

accctcgtga ccaccctgac ctacggcgtg cagtgcttca gccgctaccc cgaccacatg 360

aagcagcacg acttcttcaa gtccgccatg cccgaaggct acgtccagga ggtagattta 420

tgcatcctct tgtcatgaga agtcgaattg ttcccattct gtgtgttgca gctacagatg 480

gagatacata gagatactcg tggattttgc ttagtgttga gttttgttct ggttgtgaac 540

taaaagttta tacatttgca ggaaataaat agccttttgt ttaaatcaaa aggtcttacc 600

tatgttattg cgtgaggcat tggatcccaa agagagaact ccaaaatgcg aggctacatg 660

ttatggacta gtatcaggtt gggagacctc ctgagaagct ccagcaagta agcctcgatc 720

acgcaaaatg tttgaggtct gatgttcaat agcttgtttt gtttcacttt gctttggact 780

ttcttttcgc caatgagcta tgtttctgat ggttttcact cttttggtgt gtagagaacc 840

atcttcttca aggacgacgg caactacaag acccgcgccg aggtgaagtt cgagggcgac 900

accctggtga accgcatcga gctgaagggc atcgacttca aggaggacgg caacatcctg 960

gggcacaagc tggagtacaa ctacaacagc cacaacgtct atatcatggc cgacaagcag 1020

aagaacggca tcaaggtgaa cttcaagatc cgccacaaca tcgaggacgg cagcgtgcag 1080

ctcgccgacc actaccagca gaacaccccc atcggcgacg gccccgtgct gctgcccgac 1140

aaccactacc tgagcaccca gtccgccctg agcaaagacc ccaacgagaa gcgcgatcac 1200

atggtcctgc tggagttcgt gaccgccgcc gggatcactc tcggcatgga cgagctgtac 1260

agaattcagt aaatggagtg ctacaaagac gccgctttta gcaaacggat aacaaaagaa 1320

aaggagatcg agttgatcgg cggtaaagag aaatataaat ctgtgtgtcg caagtgctat 1380

ttcctggaag ggcccactgc t 1401

Claims

1. A recombinant bovine sarcoidosis virus, wherein the recombinant bovine sarcoidosis virus is a bovine sarcoidosis virus containing a bovine herpes virus type i gB gene; the nucleotide sequence of the bovine herpes virus type I gB gene is shown as SEQ ID NO. 1.

2. The recombinant bovine sarcoidosis virus according to claim 1, wherein the bovine herpes virus type i gB gene is inserted in the TK gene of bovine sarcoidosis in a fragment connection TK1-gB-TK2, the bovine herpes virus type i gB gene being linked to a first promoter;

preferably, the first promoter comprises p7.5 or p 11.

3. The recombinant bovine sarcoidosis virus according to claim 2, wherein the nucleotide sequence of the bovine herpesvirus type i gB gene is linked at the 5 'or 3' end to a reporter gene in the form of a fragment in which TK 1-gB-reporter gene-TK 2 or TK 1-reporter gene-gB-TK 2 is linked to a second promoter, which is different from the first promoter;

preferably, the second promoter comprises p7.5 or p 11;

preferably, the reporter gene comprises eGFP, gpt or LacZ;

preferably, the fragment is ligated in the manner TK1-gB-p7.5-p11-eGFP-TK 2.

4. The recombinant bovine sarcoidosis virus according to claim 3, wherein the nucleotide sequence of the fragment P7.5-gB-TK1 is represented in SEQ ID No.2 and the nucleotide sequence of the fragment P11-eGFP-TK2 is represented in SEQ ID No. 3.

5. The method for producing a recombinant bovine sarcoidosis virus of claim 1, wherein the recombinant bovine sarcoidosis virus is obtained by introducing a plasmid containing SEQ ID No.1 into bovine sarcoidosis virus-infected cells and culturing and screening the cells.

6. The preparation method of claim 5, wherein the functional fragment of the plasmid is TK1-gB-P7.5-P11-eGFP-TK2, the nucleotide sequence of the fragment P7.5-gB-TK1 is shown as SEQ ID NO.2, and the nucleotide sequence of the fragment P11-eGFP-TK2 is shown as SEQ ID NO. 3;

preferably, the plasmid is pSP72 or pBluescript II SK (-);

preferably, the cells are sheep testicular cells.

7. The method for culturing a recombinant bovine sarcoidosis virus according to any one of claims 1 to 4, wherein the recombinant bovine sarcoidosis virus is cultured on Vero whole suspension cells to obtain the recombinant bovine sarcoidosis virus.

8. Use of a recombinant bovine sarcoidosis virus according to any one of claims 1 to 4 in the manufacture of a vaccine for the prevention of bovine sarcoidosis and infectious bovine rhinotracheitis.

9. A vaccine for preventing bovine sarcoidosis and infectious bovine rhinotracheitis, characterized in that the recombinant bovine sarcoidosis virus according to any one of claims 1 to 4 is the active ingredient.

10. The method of claim 9, wherein the vaccine is prepared by mixing recombinant bovine sarcoidosis virus with a lyoprotectant and lyophilizing the mixture;