CN113322194B - Saccharomyces cerevisiae genetically engineered bacterium knocked into Sic1 gene, construction method and application thereof - Google Patents

Abstract

The invention discloses a saccharomyces cerevisiae gene engineering bacterium with a gene knock-in Sic1, which is formed by modifying original saccharomyces cerevisiae by knocking in the gene Sic1 through a CRISPR-Cas9 technology. As the original strain has excessive bacterial aggregation and immature aggregate in immobilized fermentation, the resistance is higher, mass transfer conduction is hindered, the fermentation period is prolonged, compared with the original saccharomyces cerevisiae strain, the flocculation characteristic of the saccharomyces cerevisiae genetically engineered strain knocked into the Sic1 gene in free fermentation is obviously weakened, the cell adhesion aggregation condition in immobilized fermentation is reduced, the adhesiveness is reduced, free cells are increased, the mass transfer conduction is enhanced, and the fermentation period is shortened.

Description

Saccharomyces cerevisiae genetically engineered bacterium knocked into Sic1 gene, construction method and application thereof

Technical Field

The invention belongs to the technical fields of genetic engineering and microorganisms, and particularly relates to a saccharomyces cerevisiae genetically engineered bacterium knocking in a Sic1 gene, a construction method and application thereof.

Background

The biological membrane is also called as a biological envelope, and is a biological aggregate composed of microbial cells and extracellular matrixes secreted by the microbial cells, and a membranous structure formed by microbial clusters and polysaccharides, proteins, fatty acids and the like secreted by the microbial clusters is attached to the surface of a carrier. The existence of the biological film not only serves as a barrier to create a stable internal environment for the vital activity of cells and mediate the connection between the cells and the matrix, but also plays roles of substance transportation, transmembrane transmission of information, energy conversion and the like, and more importantly, the biological film also serves as an important industrial application, namely immobilized fermentation. Compared to free cell fermentation, the biofilm formed in immobilized fermentation can exhibit higher substrate tolerance and faster fermentation efficiency during fermentation. Under normal conditions, about 8 hours is required for conventional free cell fermentation of 50g glucose, while only 6 hours is required for immobilized cells to convert sugar into ethanol, exhibiting excellent fermentation efficiency and fermentation capacity of immobilized cells. However, too many biological membranes can cause too many bacterial aggregates and immature aggregates, and the resistance is higher, so that mass transfer conduction is hindered, and the fermentation period is prolonged.

Clustered regularly interspaced short palindromic repeats (Clustered Regularly Interspaced Short Palindromic Repeats, i.e., CRISPR) type II systems are bacterial immune systems, and have been engineered for genetic engineering. CRISPR-Cas9 is a third generation gene editing technology which is pushed out by a ZFN, TALENs and other gene editing technologies, and in a few years, the CRISPR-Cas9 technology is popular worldwide, becomes one of the technologies with highest efficiency, simplicity, lowest cost and easiness in starting up in the existing gene editing and gene modification, and becomes the most mainstream gene editing system at present.

Disclosure of Invention

The invention aims to: the invention aims to solve the technical problem of providing a saccharomyces cerevisiae genetically engineered bacterium for knocking in the Sic1 gene aiming at the defects of the prior art.

The invention also solves the technical problem of providing a construction method of the saccharomyces cerevisiae genetically engineered bacteria.

The invention finally solves the technical problem of providing the application of the saccharomyces cerevisiae genetically engineered bacteria.

The invention is characterized in that: the cyclin-dependent kinase inhibitor (cyclin-dependent kinase inhibitor, cki) Sic1 of Saccharomyces cerevisiae is a key regulator of the yeast cell cycle, controls the entry of cells into S phase, and coordinates cell growth and proliferation. Therefore, the invention selects the Sic1 gene as a transformation object to construct the saccharomyces cerevisiae genetic engineering bacteria so as to directionally weaken the flocculation property of the strain and reduce the amount of the biofilm in immobilized fermentation, thereby improving the fermentation efficiency and the fermentation capacity.

In order to solve the first technical problem, the invention discloses a saccharomyces cerevisiae genetically engineered bacterium, which is obtained by knocking in a Sic1 gene into original saccharomyces cerevisiae and then modifying the strain, wherein the nucleotide sequence of the Sic1 gene is shown as SEQ ID NO. 1.

Wherein the saccharomyces cerevisiae is Saccharomyces cerevisiae 1308, and is derived from China center for type culture collection of industrial microorganisms, and the strain collection number is: CICC 1308, commercially available.

Wherein the nucleotide sequence of the Sic1 gene is shown as SEQ ID NO. 1.

The present invention utilizes the CRISPR-Cas9 system for genetic engineering.

In order to solve the second technical problem, the invention discloses a construction method of the saccharomyces cerevisiae genetically engineered bacterium, which is characterized by comprising the following steps:

(1) Changing the target site on the gRNA scafold sequence on Cas9 plasmid to the target site on the saccharomyces cerevisiae Saccharomyces cerevisiae 1308 genome results in a modified plasmid, preferably changing the gene target site on the gRNA scafold sequence on plasmid pcas#60847 to the target site on the saccharomyces cerevisiae Saccharomyces cerevisiae 1308c genome, the target site can be any DNA sequence of about 20nt satisfying the following two conditions: the sequence is specifically present in the genome; the target site is immediately adjacent to the PAM (Protospacer Adjacent Motif) region and upstream of the PAM region,

(2) Extracting the genome of Saccharomyces cerevisiae Saccharomyces cerevisiae 1308;

(3) Taking the genome DNA obtained in the step (2) as a template, and arranging homology arms with the length of 500bp at the upstream and downstream of a target site respectively, wherein the homology arms do not contain the target sequence; the upstream homology arm, the Sic1 gene sequence and the downstream homology arm are used as templates, and the Sic1 gene knock-in component is obtained through overlapping PCR amplification;

(4) And (3) converting the modified plasmid and the Sic1 gene knock-in fragment obtained in the steps (1) and (3) into original Saccharomyces cerevisiae competence to obtain the Saccharomyces cerevisiae genetically engineered strain with the Sic1 gene knockin.

In the step (3), the nucleotide sequence of the upstream homology arm primer is shown as SEQ ID NO.2 and SEQ ID NO. 3.

In the step (3), the nucleotide sequence of the upstream homology arm is shown as SEQ ID NO. 8.

In the step (3), the nucleotide sequence of the amplified Sic1 gene fragment is shown as SEQ ID NO.4 and SEQ ID NO. 5.

In the step (3), the nucleotide sequence of the Sic1 gene is shown as SEQ ID NO. 9.

In the step (3), the nucleotide sequences of the downstream homology arm primers are shown as SEQ ID NO.6 and SEQ ID NO. 7.

In the step (3), the nucleotide sequence of the downstream homology arm is shown as SEQ ID NO. 10.

In the step (3), the nucleotide sequences of the overlapped PCR amplification primers are shown as SEQ ID NO.2 and SEQ ID NO. 7.

In the step (3), the nucleotide sequence of the gene knock-in fragment is shown as SEQ ID NO. 11.

In the step (4), positive transformants were obtained by screening with YPD medium containing 500. Mu.g/mLG 418 to obtain Saccharomyces cerevisiae engineering bacteria into which the Sic1 gene was knocked.

In order to solve the third technical problem, the invention discloses application of the saccharomyces cerevisiae genetically engineered bacterium in weakening cell and medium adhesion in biofilm formation.

Further, the invention discloses application of the saccharomyces cerevisiae genetically engineered bacteria in preparing ethanol by fermentation.

The seed solution of the saccharomyces cerevisiae genetically engineered bacteria is inoculated into a fermentation culture medium according to the volume ratio of 1% -20%; preferably in a volume ratio of 10%.

Preferably, ethanol is produced by immobilized fermentation.

Wherein, the immobilized fermentation takes natural organic carriers, artificial synthetic polymer carriers, artificial inorganic polymer materials and composite materials as immobilized mediums.

Preferably, the immobilized fermentation uses cotton fiber material as an immobilization medium.

Wherein the concentration of the immobilization medium is 10-60 g/L, preferably 40g/L.

Wherein the temperature of the fermentation is 30-40 ℃.

Wherein the fermentation time is 20-30h.

Wherein, the formula of the fermentation medium for fermentation is as follows: 55-110g/L glucose, 2-4g/L peptone, 0.2-0.6g/L ammonium sulfate, 3-5g/L monopotassium phosphate, 2-5g/L yeast extract, 0.2-0.6g/L magnesium sulfate, 0.01-0.05g/L ferrous sulfate heptahydrate, 0.01-0.05g/L zinc sulfate heptahydrate, and the solvent is water.

Preferably, the fermentation medium formulation of the ferment is as follows: 60g/L glucose, 4g/L peptone, 0.5g/L ammonium sulfate, 3g/L monopotassium phosphate, 3g/L yeast extract, 0.5g/L magnesium sulfate, 0.05g/L ferrous sulfate heptahydrate, 0.05g/L zinc sulfate heptahydrate, and the solvent is water.

In order to achieve the above purpose, the technical scheme of the invention is as follows:

the beneficial effects are that: the invention discloses a saccharomyces cerevisiae genetically engineered bacterium knocking in a Sic1 gene, which has the advantages that as the original strain 1308 is excessively aggregated and the aggregate is immature in immobilized fermentation, the resistance is higher, mass transfer conduction is hindered, the fermentation period is prolonged, compared with the original saccharomyces cerevisiae genetically engineered bacterium knocking in the Sic1 gene, the flocculation characteristic of the original saccharomyces cerevisiae strain in free fermentation is obviously weakened, the cell adhesion aggregation condition in immobilized fermentation is reduced, the adhesiveness is reduced, the free cells are increased, the mass transfer conduction is enhanced, and the fermentation period is shortened.

Detailed Description

The present invention will be described in further detail with reference to specific examples. Detailed embodiments and specific operations are given, examples will aid in understanding the present invention, but the scope of the present invention is not limited to the following examples.

Example 1: construction of recombinant 1308-pSic 1.

1. Construction of the Sic1 Gene knock-in Assembly

(1) Making wine by original methodThe genome DNA of yeast (Saccharomyces cerevisiae 1308) is used as a template, and common PCR amplification is utilized to obtain upstream and Sic1 genes and downstream homology arm amplification fragments (the upstream homology arm amplification primer sequences up-F, up-R are respectively shown in SEQ ID NO.2 and SEQ ID NO.3, the Sic1 gene amplification primer sequences Sic1-F, sic1-R are respectively shown in SEQ ID NO.4 and SEQ ID NO.5, and the downstream homology arm amplification primer sequences down-F, down-R are respectively shown in SEQ ID NO.6 and SEQ ID NO. 7); the PCR reaction system is shown in Table 1, and the PCR reaction conditions are as follows: 1) Pre-denaturation at 95℃for 3min; 2) Denaturation at 95℃for 15s, annealing at 60℃for 15s, extension at 72℃for 1min, and three steps were performed for 35 cycles and extension at 72℃for a further 5min. Wherein the annealing temperature depends on the Tm value of the primer, and the extension time at 72℃depends on the length of the amplified fragment (1 kb min ^-1 ). The upstream homologous arm amplified fragment, the Sic1 gene and the downstream homologous arm amplified fragment obtained by PCR amplification are recovered by agarose gel electrophoresis, the nucleotide sequence of the upstream homologous arm amplified fragment is shown as SEQ ID NO.14, the nucleotide sequence of the Sic1 gene amplified fragment is shown as SEQ ID NO.1, and the nucleotide sequence of the downstream homologous arm amplified fragment is shown as SEQ ID NO. 15.

TABLE 1 PCR reaction System

(2) And (3) using the upstream homology arm, the Sic1 gene and the downstream homology arm obtained in the step (1) as templates, using up-F as an upstream primer, using down-R as a downstream primer (the up-F nucleotide sequence is shown as SEQ ID NO.2, the Sic1-down-R nucleotide sequence is shown as SEQ ID NO. 7), and amplifying the Sic1 gene knock-in assembly by using an overlap PCR technology. The reaction system is shown in Table 2, and the PCR conditions are as follows: 1) Pre-denaturation at 95℃for 3min; 2) Denaturation at 95℃for 15s, annealing at 60℃for 15s, extension at 72℃for 2min, and three steps were performed for 35 cycles and extension at 72℃for a further 5min. Wherein the annealing temperature depends on the Tm value of the primer, and the extension time at 72℃depends on the length of the amplified fragmentDegree (1 kb min) ^-1 ). Wherein the annealing temperature depends on the Tm value of the primer, and the extension time at 72℃depends on the length of the amplified fragment (1 kb min ^-1 ). And (3) quantifying the PCR product after the reaction is finished by agarose gel electrophoresis, wherein the agarose gel electrophoresis is shown in figure 1, and cutting and recycling the PCR product to obtain the saccharomyces cerevisiae Sic1 gene knock-in component. The nucleotide sequence of the gene knock-in module is shown as SEQ ID NO. 16.

TABLE 2 PCR reaction System

2. Plasmid modification

(1) Linearized plasmid pCAS#60847 was obtained using restriction enzymes SnaBI and BglII, linearization system as shown in Table 3, and large fragments were recovered in the gel. Using pCAS#60847 sequence as template, using common PCR to amplify to obtain two fragments 1, 2 containing target site of required gene (wherein the sequence of the fragment 1 amplification primer 1-F, 1-R are respectively shown as SEQ ID NO.8 and SEQ ID NO.9, the sequence of the fragment 2 amplification primer 2-F, 2-R are respectively shown as SEQ ID NO.10 and SEQ ID NO.11, the sequence of the target site is shown as SEQ ID NO. 16); the PCR reaction system is shown in Table 4, and the PCR reaction conditions are as follows: 1) Pre-denaturation at 95℃for 3min; 2) Denaturation at 95℃for 15s, annealing at 60℃for 15s, extension at 72℃for 1min, and three steps were performed for 35 cycles and extension at 72℃for a further 5min. Wherein the annealing temperature depends on the Tm value of the primer, and the extension time at 72℃depends on the length of the amplified fragment (1 kb min ^-1 ). Fragments 1 and 2 obtained by PCR amplification are recovered by agarose gel electrophoresis, see FIG. 2, the nucleotide sequence of fragment 1 is shown as SEQ ID NO.17, and the nucleotide sequence of fragment 2 is shown as SEQ ID NO. 18.

TABLE 3 plasmid linearization System

TABLE 4 PCR reaction System

(2) And (3) using fragments 1 and 2 obtained in the step (1) as templates, 1-F as an upstream primer and 2-R as a downstream primer (the nucleotide sequence of 1-F is shown as SEQ ID NO.8, and the nucleotide sequence of 2-R is shown as SEQ ID NO. 11), and amplifying the fragments by using an overlap PCR technology. The reaction system is shown in Table 5, and the PCR conditions are as follows: 1) Pre-denaturation at 95℃for 3min; 2) Denaturation at 95℃for 15s, annealing at 60℃for 15s, extension at 72℃for 1min, and three steps were performed for 35 cycles and extension at 72℃for a further 5min. Wherein the annealing temperature depends on the Tm value of the primer, and the extension time at 72℃depends on the length of the amplified fragment (1 kb min ^-1 ). Wherein the annealing temperature depends on the Tm value of the primer, and the extension time at 72℃depends on the length of the amplified fragment (1 kb min ^-1 ). And (3) quantifying the PCR product after the reaction is finished by agarose gel electrophoresis, and obtaining the saccharomyces cerevisiae gene target site component by gel cutting and recovery, wherein the agarose gel electrophoresis is shown in figure 3. The nucleotide sequence of the target site component is shown as SEQ ID NO. 19.

TABLE 5 PCR reaction System

(3) The overlapping PCR technology amplified fragment and the enzyme digestion plasmid in the step (2) are introduced into the escherichia coli DH5 alpha by utilizing one-step cloning operation, and the DH5 alpha-pCAS#60847-Sic 1 strain is obtained. The obtained plasmid of the target E.coli is extracted. The one-step cloning operation was performed strictly according to the procedures carried out in the one-step cloning kit of Vazyme company. The plasmid extraction process was performed entirely according to the operating requirements built into the plasmid extraction kit of Takara company.

(5) Plasmid restriction enzyme was verified and sequenced.

3. And (5) competent preparation of saccharomyces cerevisiae strains.

(1) Selecting Saccharomyces cerevisiae strain Saccharomyces cerevisiae 1308, inoculating to YPD liquid culture medium, and culturing at 30deg.C and 200r/min overnight to obtain activated seed liquid;

(2) Transferring the seed solution to 100mL of fresh YPD liquid culture medium according to the inoculation proportion of 1% by volume, and continuously culturing at 30 ℃ and 200r/min until the OD600 of the bacterial solution is between 0.8 and 1.2;

(3) Precooling the bacterial liquid obtained in the step (2) for 30min in an ice water bath, and centrifuging at a low temperature and high speed centrifuge at 4 ℃ for 5min at 4000r/min to collect bacterial cells;

(4) Re-suspending the thalli with 25mL of pre-cooled sterile water, centrifuging at a low temperature and high speed centrifuge at 4 ℃ and 4000r/min for 5min to collect thalli, and repeating the process twice; re-suspending the thalli by using 10mL of precooled 1M sorbitol aqueous solution, centrifuging at a low temperature and a high speed of a centrifuge at 4000r/min and a temperature of 4 ℃ for 5min to collect thalli, and repeating the steps twice;

(5) The cells were resuspended in 1mL of 1M aqueous sorbitol and 100. Mu.L of each tube was dispensed.

4. Identification of competent transformants of Saccharomyces cerevisiae strains.

(1) Taking a 1-pipe from the fungus liquid obtained in the third step, adding 1 mu L of the modified plasmid obtained in the second step and 5 mu L of the gene knock-in component obtained in the first step, mixing and transferring into an electric rotating cup;

(2) Placing on ice for 5min;

(3) 1.5kv electric shock for 5.0ms, adding 1mLYPD culture medium to wash out electrotransfer liquid, and culturing at 30deg.C and 200r/min for 1 hr;

(4) Spread on YPD medium plates containing 500 μg/mLG418 and incubated at 30℃until colonies develop;

(5) Picking the transformant obtained in the step (4) as a template, and performing colony PCR amplification by using verification primers (the nucleotide sequences are shown as SEQ ID NO.12 and SEQ ID NO. 13) to identify a positive transformant in which the Sic1 gene is knocked in, as shown in FIG. 4; the nucleotide sequence of the positive transformant is shown as SEQ ID NO. 20;

(6) Positive transformants 1308-pSic1 were selected and activated for 24h in 5mL YPD liquid medium containing 500. Mu.g/mLG 418, and sterilized 30% glycerol 1:1, mixing and preserving at-80 ℃.

The primers used in the above procedure were as follows:

CGAAAACGATAATGCCAATATTTTG(up-F)-SEQ ID NO.2

GGTGGGGTGGAAGGAGTCATAGTGACGCAGAAGAGGTTCT(up-R)-SEQ ID NO.3

AGAACCTCTTCTGCGTCACTATGACTCCTTCCACCCCACC(Sic1-F)-SEQ ID NO.4

AGAAAAAAATAAACATCATATCAATGCTCTTGATCCCTAG(Sic1-R)-SEQ ID NO.5

CTAGGGATCAAGAGCATTGATATGATGTTTATTTTTTTCT(down-F)-SEQ ID NO.6

TTCCAGGAGAAGACAAGGAAGTGGA(down-R)-SEQ ID NO.7

GTCTCTATATACTACGTATAGGAAATG(1-F)-SEQ ID NO.8

CATGGATGTTCTTGTTTGTGAAAGTCCCATTCGCCACCCG(1-R)-SEQ ID NO.9

CACAAACAAGAACATCCATGGTTTTAGAGCTAGAAATAGC(2-F)-SEQ ID NO.10

GCAAGCTAAACAGATCTCTAGACCTATATC(2-R)-SEQ ID NO.11

GTGGATCCTGCGAAAAGACT-SEQ ID NO.12

CCAATGGTTCCTGCTCTTCC-SEQ ID NO.13

example 2

(1) 10. Mu.L of each of glycerol bacteria 1308 (original bacteria) and 1308-pSic1 (knock-in bacteria constructed in example 1) were cultured overnight in a sterilized 5mLYPD liquid medium, and activated;

(2) Transferring the bacterial liquid obtained in the step (1) to 100mL of YPD liquid culture medium according to the inoculation proportion of 1% by volume, and continuously culturing at 30 ℃ and 200r/min until the bacterial liquid OD600 is about 2.0;

(3) 2mL of the bacterial liquid obtained in the step (2) is taken, the absorbance value is measured under the OD600, and the bacterial liquid is diluted by a sterilized YPD liquid culture medium, so that the OD600 of the diluted bacterial liquid is 1;

(4) Adding 190 mu LYPD culture medium and 10 mu L of the bacterial liquid diluted in the step (3) into a 96-well plate, and culturing at 30 ℃ for 24 hours;

(5) Pouring out the 96-well plate bacterial liquid, buffering for 3 times by using 0.01M PBS buffer solution, and drying by beating;

(6) 200 mu L of 1% crystal violet solution is added into a 96-well plate for 10min of dyeing, washed by PBS buffer solution and dried;

(7) 200 mu L of glacial acetic acid is added into a 96-well plate for dissolution, and then the solution is gently shaken, and the yield of the biological film is measured by OD570, and the average value is taken: the OD value of the original strain cultured in a 96-well plate for 24 hours is about 0.52, and the OD value of the knock-in strain of 1308-pSic1 cultured in a 96-well plate for 24 hours is about 0.43. The experimental results are shown in FIG. 5, which shows that the Saccharomyces cerevisiae biofilm knocked-in with the Sic1 gene is significantly reduced.

Example 3

(1) 10. Mu.L of each of glycerol bacteria 1308 (original bacteria) and 1308-pSic1 (knock-in bacteria constructed in example 1) were cultured overnight in a sterilized 5mLYPD liquid medium, and activated;

(2) Transferring the bacterial liquid obtained in the step (1) to 100mL of YPD liquid culture medium according to the inoculation proportion of 1% by volume, and continuously culturing at 30 ℃ and 200r/min until the bacterial liquid OD600 is between 0.8 and 1.2;

(3) Transferring the seed solution obtained in the step (2) into 100mL of fermentation medium according to the inoculation volume ratio of 10%, and dividing the seed solution into two types of free fermentation and immobilized fermentation.

When immobilized fermentation is carried out: adding cotton fiber materials into a fermentation medium as immobilized materials, and adding 4g of cotton fiber medium into each shake flask; fermenting at 30deg.C and 200r/min, after glucose is exhausted, measuring residual sugar content of fermentation liquid by using a sugar meter, and measuring alcohol content in fermentation liquid by using a high performance gas chromatograph;

when the separation fermentation is carried out: only no immobilized material is added, and the rest is the same as immobilized fermentation;

wherein, the formula of the fermentation medium is as follows: 60g/L glucose, 4g/L peptone, 0.5g/L ammonium sulfate, 3g/L monopotassium phosphate, 3g/L yeast extract, 0.5g/L magnesium sulfate, 0.05g/L ferrous sulfate heptahydrate, 0.05g/L zinc sulfate heptahydrate, and the solvent is water.

(4) The fermentation results are shown in FIGS. 6 and 7 (W-wild bacterium free fermentation, WI-wild bacterium immobilized fermentation, pSic 1-knock-in bacterium free fermentation, pSic 1I-knock-in bacterium immobilized fermentation), and as can be seen from the fermentation data, immobilized fermentation has a faster sugar consumption rate and a higher ethanol yield than free fermentation; the immobilized fermentation periods of the original strain and the genetically modified strain 1308-pSic1 are 30h and 23h respectively, the fermentation period of the genetically modified strain is shortened by about 7h, and the sugar consumption rate is improved by about 30%; at the end of the immobilized fermentation, the yields of the original strain and the genetically modified strain 1308-pSic1 ethanol are 21g/L and 34g/L respectively, the yield of the genetically modified strain ethanol is improved by about 13g/L, and the fermentation efficiency is improved by about 61%.

The invention provides a Saccharomyces cerevisiae genetically engineered bacterium modified by CRISPR-Cas9 technology, a construction method and application thereof, and a method and a way for realizing the technical scheme are numerous, the above is only a preferred embodiment of the invention, and it should be pointed out that a plurality of improvements and modifications can be made by those skilled in the art without departing from the principle of the invention, and the improvements and modifications are also regarded as the protection scope of the invention. The components not explicitly described in this embodiment can be implemented by using the prior art.

Sequence listing

<110> university of Nanjing Industrial science

<120> Saccharomyces cerevisiae genetically engineered bacterium with Sic1 gene knocked in, construction method and application thereof

<160> 20

<170> SIPOSequenceListing 1.0

<210> 1

<211> 855

<212> DNA

<213> nucleotide sequence of Sic1 Gene (Artificial Sequence)

<400> 1

atgactcctt ccaccccacc aaggtccaga gggactaggt accttgcgca gcctagtggc 60

aatactagtt ctagtgccct aatgcaaggt caaaagaccc cccaaaagcc ttcacagaac 120

ctagtccctg tcactccctc aacaactaag tcttttaaaa atgcgccatt attagcacct 180

cccaattcga acatgggtat gacctctcca tttaatgggc ttacgtctcc tcaacgctcg 240

ccgtttccaa aatcttcagt gaagaggaca ctattccaat ttgaaagtca tgataatgga 300

acagtaaggg aagagcagga accattgggt cgtgtaaata ggatattgtt tcccacgcag 360

caaaatgtgg atatagatgc agcagaagaa gaagaagaag gagaagttct tcttcccccc 420

agcagaccta catctgccag gcagttacat ttatcacttg aaagagatga gtttgatcag 480

acacatagaa agaagattat taaagatgta cctggtacgc ccagcgacaa ggtgataaca 540

tttgaattgg caaaaaattg gaacaacaac tctccgaaaa atgacgccag gagtcaagaa 600

agtgaagacg aggaagacat catcatcaat ccagtgcggg tgggtaaaaa tccctttgca 660

tcagatgaac tggtcactca ggaaattaga aatgaacgta aaagggcaat gttgagagaa 720

aacccagata tagaagacgt aataacatat gtcaataaga agggagaggt ggtagagaaa 780

cgaaggttaa cggatgaaga aaagagaaga ttcaagccaa aggcattgtt tcaatctagg 840

gatcaagagc attga 855

<210> 2

<211> 25

<212> DNA

<213> Artificial Sequence

<400> 2

cgaaaacgat aatgccaata ttttg 25

<210> 3

<211> 40

<212> DNA

<213> Artificial Sequence

<400> 3

ggtggggtgg aaggagtcat agtgacgcag aagaggttct 40

<210> 4

<211> 40

<212> DNA

<213> Artificial Sequence

<400> 4

agaacctctt ctgcgtcact atgactcctt ccaccccacc 40

<210> 5

<211> 40

<212> DNA

<213> Artificial Sequence

<400> 5

agaaaaaaat aaacatcata tcaatgctct tgatccctag 40

<210> 6

<211> 40

<212> DNA

<213> Artificial Sequence

<400> 6

ctagggatca agagcattga tatgatgttt atttttttct 40

<210> 7

<211> 25

<212> DNA

<213> Artificial Sequence

<400> 7

ttccaggaga agacaaggaa gtgga 25

<210> 8

<211> 27

<212> DNA

<213> Artificial Sequence

<400> 8

gtctctatat actacgtata ggaaatg 27

<210> 9

<211> 40

<212> DNA

<213> Artificial Sequence

<400> 9

catggatgtt cttgtttgtg aaagtcccat tcgccacccg 40

<210> 10

<211> 40

<212> DNA

<213> Artificial Sequence

<400> 10

cacaaacaag aacatccatg gttttagagc tagaaatagc 40

<210> 11

<211> 30

<212> DNA

<213> Artificial Sequence

<400> 11

gcaagctaaa cagatctcta gacctatatc 30

<210> 12

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 12

gtggatcctg cgaaaagact 20

<210> 13

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 13

ccaatggttc ctgctcttcc 20

<210> 14

<211> 500

<212> DNA

<213> Artificial Sequence

<400> 14

gccaatattt tgtttggtaa acatggcatt aacaccgatg tttctgaatt atctgcagct 60

aatctctctc caccattgaa tcataaaaat attttatccc gtaaactatc gatgagtaac 120

accactaata ggagctcaaa taattccaac agtagcgtgc atgactttgg tgcacataca 180

ccggttaata aattaagtat tgcttctgta ttagagtcag tacctcaaga aacaggatat 240

attacaccta acgggaccgg tacaactact acaagtgcca aaaactcacc caatctgaag 300

aatttgtcac tggctatacc tccacatatg agggatcgca gatcaagtaa attgaatgat 360

tcacaaacgg aatttggttc ttttaatttc aggaatttat cggctcttga taaagctaat 420

aaagatgcta taaatagact gaaaagtgaa catttttctg aacaacctgg ggttcacaga 480

agaacctctt ctgcgtcact 500

<210> 15

<211> 501

<212> DNA

<213> Artificial Sequence

<400> 15

tatgatgttt atttttttct caattacaat aacttatata tatatatata tatatgtacg 60

tatatatatt ctcctttgtt agagttaatt tatgatctaa tttcatttct caatttcgag 120

gctaaattag aatttttgaa gtccctaatt tcatattttg tatcaaaact ttaaaatctg 180

gaaatattaa aagcagaata aaacacatat attattctat atagtattgt tacatatttt 240

ggagaacgtc ctatttaacc tatgaatgtg tctatgatag atcattttaa tagaataaaa 300

gccatctaga tatcatctgg gaaagagaat tcaacctttt tttttcctcg agggtcgaaa 360

tcatcatcct ctggaagaat agttctccca gcacttaaca attggaagtt attagggctt 420

tgtggtggat taatttttgg tgttgacggt ggtttgtaat gcgactcccc caagaagtcg 480

tttgatgatt ccacttcctt g 501

<210> 16

<211> 1856

<212> DNA

<213> Artificial Sequence

<400> 16

gccaatattt tgtttggtaa acatggcatt aacaccgatg tttctgaatt atctgcagct 60

aatctctctc caccattgaa tcataaaaat attttatccc gtaaactatc gatgagtaac 120

accactaata ggagctcaaa taattccaac agtagcgtgc atgactttgg tgcacataca 180

ccggttaata aattaagtat tgcttctgta ttagagtcag tacctcaaga aacaggatat 240

attacaccta acgggaccgg tacaactact acaagtgcca aaaactcacc caatctgaag 300

aatttgtcac tggctatacc tccacatatg agggatcgca gatcaagtaa attgaatgat 360

tcacaaacgg aatttggttc ttttaatttc aggaatttat cggctcttga taaagctaat 420

aaagatgcta taaatagact gaaaagtgaa catttttctg aacaacctgg ggttcacaga 480

agaacctctt ctgcgtcact atgactcctt ccaccccacc aaggtccaga gggactaggt 540

accttgcgca gcctagtggc aatactagtt ctagtgccct aatgcaaggt caaaagaccc 600

cccaaaagcc ttcacagaac ctagtccctg tcactccctc aacaactaag tcttttaaaa 660

atgcgccatt attagcacct cccaattcga acatgggtat gacctctcca tttaatgggc 720

ttacgtctcc tcaacgctcg ccgtttccaa aatcttcagt gaagaggaca ctattccaat 780

ttgaaagtca tgataatgga acagtaaggg aagagcagga accattgggt cgtgtaaata 840

ggatattgtt tcccacgcag caaaatgtgg atatagatgc agcagaagaa gaagaagaag 900

gagaagttct tcttcccccc agcagaccta catctgccag gcagttacat ttatcacttg 960

aaagagatga gtttgatcag acacatagaa agaagattat taaagatgta cctggtacgc 1020

ccagcgacaa ggtgataaca tttgaattgg caaaaaattg gaacaacaac tctccgaaaa 1080

atgacgccag gagtcaagaa agtgaagacg aggaagacat catcatcaat ccagtgcggg 1140

tgggtaaaaa tccctttgca tcagatgaac tggtcactca ggaaattaga aatgaacgta 1200

aaagggcaat gttgagagaa aacccagata tagaagacgt aataacatat gtcaataaga 1260

agggagaggt ggtagagaaa cgaaggttaa cggatgaaga aaagagaaga ttcaagccaa 1320

aggcattgtt tcaatctagg gatcaagagc attgatatga tgtttatttt tttctcaatt 1380

acaataactt atatatatat atatatatat gtacgtatat atattctcct ttgttagagt 1440

taatttatga tctaatttca tttctcaatt tcgaggctaa attagaattt ttgaagtccc 1500

taatttcata ttttgtatca aaactttaaa atctggaaat attaaaagca gaataaaaca 1560

catatattat tctatatagt attgttacat attttggaga acgtcctatt taacctatga 1620

atgtgtctat gatagatcat tttaatagaa taaaagccat ctagatatca tctgggaaag 1680

agaattcaac cttttttttt cctcgagggt cgaaatcatc atcctctgga agaatagttc 1740

tcccagcact taacaattgg aagttattag ggctttgtgg tggattaatt tttggtgttg 1800

acggtggttt gtaatgcgac tcccccaaga agtcgtttga tgattccact tccttg 1856

<210> 17

<211> 756

<212> DNA

<213> Artificial Sequence

<400> 17

gtctctatat actacgtata ggaaatgttt acattttcgt attgttttcg attcactcta 60

tgaatagttc ttactacaat ttttttgtct aaagagtaat actagagata aacataaaaa 120

atgtagaggt cgagtttaga tgcaagttca aggagcgaaa ggtggatggg taggttatat 180

agggatatag cacagagata tatagcaaag agatactttt gagcaatgtt tgtggaagcg 240

gtattcgcaa tattttagta gcccgttaca gtccggtgcg tttttggttt tttgaaagtg 300

cgtcttcaga gcgcttttgg ttttcaaaag cgctctgaag ttcctatact ttctagagaa 360

taggaacttc ggaataggaa cttcaaagcg tttccgaaaa cgagcgcttc cgaaaatgca 420

acgcgagctg cgcacataca gctcactgtt cacgtcgcac ctatatctgc gtgttgcctg 480

tatatatata tacatgagaa gaacggcata gtgcgtgttt atgcttaaat gcgtatatgt 540

gttatgtagt atactctttc ttcaacaatt aaatactctc ggtagccaag ttggtttaag 600

gcgcaagact gtaatttatc actacgaaat cttgagatcg ggcgttcgac tcgcccccgg 660

gagagatggc cggcatggtc ccagcctcct cgctggcgcc ggctgggcaa caccttcggg 720

tggcgaatgg gactttcaca aacaagaaca tccatg 756

<210> 18

<211> 181

<212> DNA

<213> Artificial Sequence

<400> 18

gttttagagc tagaaatagc aagttaaaat aaggctagtc cgttatcaac ttgaaaaagt 60

ggcaccgagt cggtgctttt tttatttttt gtcactattg ttatgtaaaa tgccacctct 120

gacagtatgg aacgcaaact tctgtctagt ggatataggt ctagagatct gtttagcttg 180

c 181

<210> 19

<211> 937

<212> DNA

<213> Artificial Sequence

<400> 19

gtctctatat actacgtata ggaaatgttt acattttcgt attgttttcg attcactcta 60

tgaatagttc ttactacaat ttttttgtct aaagagtaat actagagata aacataaaaa 120

atgtagaggt cgagtttaga tgcaagttca aggagcgaaa ggtggatggg taggttatat 180

agggatatag cacagagata tatagcaaag agatactttt gagcaatgtt tgtggaagcg 240

gtattcgcaa tattttagta gcccgttaca gtccggtgcg tttttggttt tttgaaagtg 300

cgtcttcaga gcgcttttgg ttttcaaaag cgctctgaag ttcctatact ttctagagaa 360

taggaacttc ggaataggaa cttcaaagcg tttccgaaaa cgagcgcttc cgaaaatgca 420

acgcgagctg cgcacataca gctcactgtt cacgtcgcac ctatatctgc gtgttgcctg 480

tatatatata tacatgagaa gaacggcata gtgcgtgttt atgcttaaat gcgtatatgt 540

gttatgtagt atactctttc ttcaacaatt aaatactctc ggtagccaag ttggtttaag 600

gcgcaagact gtaatttatc actacgaaat cttgagatcg ggcgttcgac tcgcccccgg 660

gagagatggc cggcatggtc ccagcctcct cgctggcgcc ggctgggcaa caccttcggg 720

tggcgaatgg gactttcaca aacaagaaca tccatggttt tagagctaga aatagcaagt 780

taaaataagg ctagtccgtt atcaacttga aaaagtggca ccgagtcggt gcttttttta 840

ttttttgtca ctattgttat gtaaaatgcc acctctgaca gtatggaacg caaacttctg 900

tctagtggat ataggtctag agatctgttt agcttgc 937

<210> 20

<211> 1029

<212> DNA

<213> Artificial Sequence

<400> 20

gtggatcctg cgaaaagact gggtgcgaaa ggaattcaag aaattaaaga tcacccttat 60

ttcaagaatg tggattggga tcatgtttac gatgaggaag cttcttttgt ccctacaata 120

gacaatccag aagatactga ttattttgac ctaaggggtg cagagctcca agattttgga 180

gacgatatcg aaaacgataa tgccaatatt ttgtttggta aacatggcat taacaccgat 240

gtttctgaat tatctgcagc taatctctct ccaccattga atcataaaaa tattttatcc 300

cgtaaactat cgatgagtaa caccactaat aggagctcaa ataattccaa cagtagcgtg 360

catgactttg gtgcacatac accggttaat aaattaagta ttgcttctgt attagagtca 420

gtacctcaag aaacaggata tattacacct aacgggaccg gtacaactac tacaagtgcc 480

aaaaactcac ccaatctgaa gaatttgtca ctggctatac ctccacatat gagggatcgc 540

agatcaagta aattgaatga ttcacaaacg gaatttggtt cttttaattt caggaattta 600

tcggctcttg ataaagctaa taaagatgct ataaatagac tgaaaagtga acatttttct 660

gaacaacctg gggttcacag aagaacctct tctgcgtcac tatgactcct tccaccccac 720

caaggtccag agggactagg taccttgcgc agcctagtgg caatactagt tctagtgccc 780

taatgcaagg tcaaaagacc ccccaaaagc cttcacagaa cctagtccct gtcactccct 840

caacaactaa gtcttttaaa aatgcgccat tattagcacc tcccaattcg aacatgggta 900

tgacctctcc atttaatggg cttacgtctc ctcaacgctc gccgtttcca aaatcttcag 960

tgaagaggac actattccaa tttgaaagtc atgataatgg aacagtaagg gaagagcagg 1020

aaccattgg 1029

Claims (6)

1. A method for preparing ethanol by fermenting saccharomyces cerevisiae genetically engineered bacteria transferred with a Sic1 gene is characterized in that the strain is obtained by transforming original saccharomyces cerevisiae transferred with the Sic1 gene, the nucleotide sequence of the Sic1 gene is shown as SEQ ID NO.1, the original saccharomyces cerevisiae is from China industry microbiological culture collection center, and the strain is deposited with the number: CICC 1308, ethanol is prepared by immobilized fermentation.

2. The method of claim 1, wherein the genetic engineering is performed using a CRISPR-Cas9 system.

3. The method of claim 1, wherein the saccharomyces cerevisiae genetically engineered bacteria are constructed by:

(1) Changing the target site on the gRNA scaffold sequence on the Cas9 plasmid to the target site on the saccharomyces cerevisiae (Saccharomyces cerevisiae) 1308 genome to obtain a modified plasmid;

(2) Extracting the genome of Saccharomyces cerevisiae (Saccharomyces cerevisiae) 1308;

(3) Taking the genome DNA obtained in the step (2) as a template, and arranging homology arms with the length of 500bp at the upstream and downstream of a target site respectively, wherein the homology arms do not contain the target sequence; the upstream homology arm, the Sic1 gene sequence and the downstream homology arm are used as templates, and Sic1 gene transfer components are obtained through overlapping PCR amplification;

(4) And (3) transforming the modified plasmid and the Sic1 gene transfer module obtained in the steps (1) and (3) into the original Saccharomyces cerevisiae competence to obtain the Saccharomyces cerevisiae gene engineering bacteria into which the Sic1 gene is transferred.

4. The method according to claim 1, wherein the immobilized fermentation uses natural organic carriers, synthetic polymer carriers, artificial inorganic polymer materials and composite materials as an immobilization medium.

5. The method of claim 1, wherein the fermentation temperature is from 30 ℃ to 40 ℃.

6. The method of claim 1, wherein the fermentation medium for fermentation is formulated as follows: 55-110g/L glucose, 2-4g/L peptone, 0.2-0.6g/L ammonium sulfate, 3-5g/L monopotassium phosphate, 2-5g/L yeast extract, 0.2-0.6g/L magnesium sulfate, 0.01-0.05g/L ferrous sulfate heptahydrate, 0.01-0.05g/L zinc sulfate heptahydrate, and the solvent is water.