CN112779172B - Recombinant saccharomyces cerevisiae genetically engineered bacterium, construction method and application thereof - Google Patents

Abstract

The invention discloses a recombinant saccharomyces cerevisiae gene engineering bacterium, a construction method and application thereof, wherein the Gis4 gene of the recombinant saccharomyces cerevisiae is inactivated. Compared with the original saccharomyces cerevisiae strain, the flocculation characteristic of the recombinant saccharomyces cerevisiae gene engineering strain is obviously enhanced in free fermentation, and the biofilm formed in immobilized fermentation is increased, so that the biological yield is increased, the fermentation period is shortened, and the fermentation efficiency is improved.

Description

Recombinant saccharomyces cerevisiae genetically engineered bacterium, construction method and application thereof

Technical Field

The invention belongs to the technical fields of genetic engineering and microorganisms, and in particular relates to a recombinant saccharomyces cerevisiae genetic engineering bacterium for knocking out Gis4 genes, a construction method thereof and application thereof in promoting formation of biological films.

Background

The biological membrane is also called as a biological envelope, and is a biological aggregate composed of microbial cells and extracellular matrixes secreted by the microbial cells, and a membranous structure formed by microbial clusters and polysaccharides, proteins, fatty acids and the like secreted by the microbial clusters is attached to the surface of a carrier. The existence of the biological membrane not only serves as a barrier to create a stable internal environment for the vital activity of the cells and mediate the connection between the cells and the matrix, but also plays roles in substance transport, transmembrane transmission of information, energy conversion and the like, which are all determined by the structure of the biological membrane. Biological membranes are also an important industrial application-immobilized fermentation. Compared to free cell fermentation, the biofilm formed in immobilized fermentation can exhibit higher substrate tolerance and faster fermentation efficiency during fermentation. Under normal conditions, about 8 hours is required for conventional free cell fermentation of 50g glucose, while only 6 hours is required for immobilized cells to convert sugar into ethanol, exhibiting excellent fermentation efficiency and fermentation capacity of immobilized cells.

Disclosure of Invention

The invention aims to: the invention aims to solve the technical problem of providing a recombinant saccharomyces cerevisiae gene engineering bacterium for knocking out the Gis4 gene aiming at the defects of the prior art.

The invention also solves the technical problem of providing a construction method of the recombinant saccharomyces cerevisiae genetically engineered bacteria.

The invention finally solves the technical problem of providing the application of the saccharomyces cerevisiae genetically engineered bacteria.

The invention is characterized in that: gis4 is a new component of a system that establishes tolerance to Na+ and Li+ ions in Saccharomyces cerevisiae. By participating in transcriptional regulation of the ENA1 gene encoding the critical na+/li+ export pump, its function is played in achieving salt tolerance. Therefore, the invention selects the Gis4 gene as a transformation object to construct recombinant saccharomyces cerevisiae gene engineering bacteria so as to improve the amount of biofilm in immobilized fermentation and further improve the fermentation efficiency and the fermentation capacity

In order to solve the first technical problem, the invention discloses a recombinant saccharomyces cerevisiae genetically engineered bacterium, wherein the Gis4 gene of the recombinant saccharomyces cerevisiae is inactivated.

Wherein the Saccharomyces cerevisiae is Saccharomyces cerevisiae S288c and is derived from China center for type culture Collection of microorganisms.

Wherein the nucleotide sequence of the Gis4 gene after inactivation is shown as SEQ ID NO. 2; the nucleotide sequence of the Gis4 gene before inactivation is shown as SEQ ID NO. 1.

In order to solve the second technical problem, the invention discloses a construction method of the recombinant saccharomyces cerevisiae genetically engineered bacterium, which is characterized by comprising the following steps:

(1) Amplifying to obtain an upstream homologous arm and a downstream homologous arm of the Gis4 gene by taking genomic DNA of Saccharomyces cerevisiae as a template; using plasmid PUG6 as a template, and amplifying to obtain a resistance G418 target fragment;

(2) Taking the upstream homology arm, the downstream homology arm and the resistant G418 target fragment of the Gis4 gene obtained in the step (1) as templates, and amplifying by overlapping PCR to obtain a gene knockout fragment;

(3) And (3) converting the gene knockout fragment obtained in the step (2) into saccharomyces cerevisiae competence to obtain the recombinant saccharomyces cerevisiae genetically engineered bacterium.

In the step (1), the nucleotide sequence of the upstream homology arm primer of the amplified Gis4 gene is shown as SEQ ID NO.3 and SEQ ID NO. 4.

In the step (1), the nucleotide sequence of the upstream homology arm of the Gis4 gene is shown as SEQ ID NO. 9.

In the step (1), the nucleotide sequence of the homologous arm primer at the downstream of the amplified Gis4 gene is shown as SEQ ID NO.5 and SEQ ID NO. 6.

In the step (1), the nucleotide sequence of the downstream homology arm of the Gis4 gene is shown as SEQ ID NO. 10.

In the step (1), the nucleotide sequence of the primer of the amplified resistance G418 target fragment is shown as SEQ ID NO.7 and SEQ ID NO. 8.

In the step (1), the nucleotide sequence of the resistant G418 target fragment is shown as SEQ ID NO. 11.

In the step (2), the nucleotide sequences of the overlapped PCR amplification primers are shown as SEQ ID NO.3 and SEQ ID NO. 6.

In the step (2), the nucleotide sequence of the gene knockout fragment is shown as SEQ ID NO. 12.

In the step (3), positive transformants were obtained by screening with YPD medium containing 500. Mu.g/mLG 418 to obtain a Gis4 gene knockout Saccharomyces cerevisiae genetically engineered bacterium.

In order to solve the third technical problem, the invention discloses application of the recombinant saccharomyces cerevisiae genetically engineered bacteria in promoting formation of a biological film.

Further, the invention discloses application of the recombinant saccharomyces cerevisiae genetically engineered bacteria in preparing ethanol by fermentation.

Wherein, the seed solution of the recombinant saccharomyces cerevisiae genetically engineered bacteria is inoculated into a fermentation culture medium according to the volume ratio of 5-20%; preferably in a volume ratio of 10%.

Preferably, ethanol is produced by immobilized fermentation.

Wherein, the immobilized fermentation takes natural organic carriers, artificial synthetic polymer carriers, artificial inorganic polymer materials and composite materials as immobilized mediums.

Preferably, the immobilized fermentation uses cotton fiber material as an immobilization medium.

Wherein the concentration of the immobilization medium is 10-70 g/L, preferably 40g/L.

Wherein the temperature of the fermentation is 30-40 ℃.

Wherein the fermentation time is 20-30h.

Wherein, the formula of the fermentation medium for fermentation is as follows: 55-110g/L glucose, 3-6g/L peptone, 0.5-1g/L ammonium sulfate, 3-6g/L monopotassium phosphate, 3-6g/L yeast extract, 0.5-1g/L magnesium sulfate, 0.05-1g/L ferrous sulfate heptahydrate, 0.05-1g/L zinc sulfate heptahydrate, and water as solvent.

Preferably, the fermentation medium formulation of the ferment is as follows: 60g/L glucose, 4g/L peptone, 0.5g/L ammonium sulfate, 3g/L monopotassium phosphate, 3g/L yeast extract, 0.5g/L magnesium sulfate, 0.05g/L ferrous sulfate heptahydrate, 0.05g/L zinc sulfate heptahydrate, and the solvent is water.

The beneficial effects are that: compared with the prior art, the invention has the following advantages:

the invention discloses a saccharomyces cerevisiae gene engineering bacterium for knocking out Gis4 genes, which has longer fermentation period and lower fermentation efficiency because the formation of a biological film of an original strain S288c is too small in immobilized fermentation, compared with the flocculation characteristic of the original saccharomyces cerevisiae strain in free fermentation, the saccharomyces cerevisiae gene engineering bacterium for knocking out the Gis4 genes is obviously enhanced, the formed biological film in immobilized fermentation is increased, the biological yield is increased, the fermentation period is shortened, and the fermentation efficiency is improved.

Drawings

The foregoing and/or other advantages of the invention will become more apparent from the following detailed description of the invention when taken in conjunction with the accompanying drawings and detailed description.

FIG. 1 is an agarose gel electrophoresis of upstream and downstream homology arms of the Gis4 gene in example 1, wherein M: DNA molecular weight marker, up: gis4F (521 bp), down: gis4R (524 bp).

FIG. 2 is an agarose gel electrophoresis of a G418 resistant fragment of example 1, wherein M: DNA molecular weight marker, G418: the G418 gene amplified fragment (1357 bp).

FIG. 3 is a PCR identification electrophoretogram of Gis4 gene deleted transformant in example 1, wherein M: a DNA molecular weight marker; w is the original control group, and 1 and 2 are two positive transformants (2402 bp) respectively.

FIG. 4 is a staining and destaochromic chart of the original bacteria S288c (W) and Gis4 gene knockout bacteria (DeltaGis 4) of example 2 in a 96-well plate for 1 day.

FIG. 5 shows fermentation residual sugar data of the original bacteria S288c (W) and Gis4 gene knockout bacteria (DeltaGis 4) in free fermentation and immobilized fermentation in example 3.

FIG. 6 is ethanol data of fermentation products of the free fermentation and immobilized fermentation of the original bacteria S288c (W) and Gis4 gene knockout bacteria (ΔGis4) in example 3.

Detailed Description

The experimental methods described in the following examples are all conventional methods unless otherwise specified; the reagents and materials, unless otherwise specified, are commercially available.

Example 1: construction of recombinant S288 c-DeltaGis 4

1. Construction of Gis4 Gene knockout fragment

(1) The genomic DNA of the original Saccharomyces cerevisiae (Saccharomyces cerevisiae S288 c) is used as a template, and the upstream and downstream homology arm amplified fragments (upstream homology arm amplification primers) of the Gis4 gene are obtained by common PCR amplificationThe sequences Gis4-up-F, gis4-up-R are respectively shown as SEQ ID NO.3 and SEQ ID NO. 4; the downstream homology arm amplification primer sequences Gis4-down-F, gis4-down-R are respectively shown as SEQ ID NO.5 and SEQ ID NO. 6; the PCR reaction system is shown in Table 1, and the PCR reaction conditions are as follows: 1) Pre-denaturation at 95℃for 3min; 2) Denaturation at 95℃for 15s, annealing at 60℃for 15s, extension at 72℃for 1min, and three steps were performed for 35 cycles and extension at 72℃for a further 5min. Wherein the annealing temperature depends on the Tm value of the primer, and the extension time at 72℃depends on the length of the amplified fragment (1 kb min ^-1 ). The upstream and downstream homology arm amplified fragments of the Gis4 gene obtained by PCR amplification are recovered by agarose gel electrophoresis, as shown in FIG. 1, and the nucleotide sequence of the upstream homology arm amplified fragment of the Gis4 gene is shown as SEQ ID NO.9, and the nucleotide sequence of the downstream homology arm amplified fragment of the Gis4 gene is shown as SEQ ID NO. 10.

TABLE 1 PCR reaction System

(2) Using plasmid PUG6 as a template, and performing common PCR amplification to obtain a target fragment of the resistance G418 gene (the sequences G418-F, G418-R of the G418 gene amplification primers are respectively shown as SEQ ID NO.7 and SEQ ID NO. 8); the PCR reaction system is shown in Table 2, and the PCR reaction conditions are as follows: 1) Pre-denaturation at 95℃for 3min; 2) Denaturation at 95℃for 15s, annealing at 65℃for 15s, extension at 72℃for 1.5min, and three steps were performed for 35 cycles and extension at 72℃for a further 5min. Wherein the annealing temperature depends on the Tm value of the primer, and the extension time at 72℃depends on the length of the amplified fragment (1 kb min ^-1 ). Wherein the annealing temperature depends on the Tm value of the primer, and the extension time at 72℃depends on the length of the amplified fragment (1 kb min ^-1 ). The G418 gene amplified fragment obtained by agarose gel electrophoresis, see figure 2, is recovered by cutting gel, and the nucleotide sequence of the G418 gene amplified fragment is shown as SEQ ID NO. 11.

TABLE 2 PCR reaction System

(3) The upstream homology arm and the downstream homology arm of the Gis4 gene obtained in the step (1) and the G418 resistance fragment obtained in the step (2) are used as templates, the Gis4-up-F is used as an upstream primer, the Gis4-down-R is used as a downstream primer (the nucleotide sequence of the Gis4-up-F is shown as SEQ ID NO.3, the nucleotide sequence of the Gis4-down-R is shown as SEQ ID NO. 6), and the Gis4 gene knockout fragment is amplified by using an overlap PCR technology. The reaction system is shown in Table 3, and the PCR conditions are as follows: 1) Pre-denaturation at 95℃for 3min; 2) Denaturation at 95℃for 15s, annealing at 60℃for 15s, extension at 72℃for 2min, and three steps were performed for 35 cycles and extension at 72℃for a further 5min. Wherein the annealing temperature depends on the Tm value of the primer, and the extension time at 72℃depends on the length of the amplified fragment (1 kb min ^-1 ). Wherein the annealing temperature depends on the Tm value of the primer, and the extension time at 72℃depends on the length of the amplified fragment (1 kb min ^-1 ). And (3) quantifying the PCR product after the reaction is finished by agarose gel electrophoresis, and obtaining the saccharomyces cerevisiae Gis4 gene knockout component by gel cutting and recovery, wherein the agarose gel electrophoresis is shown in figure 3. The nucleotide sequence of the gene knockout fragment is shown in SEQ ID NO. 12.

TABLE 3 PCR reaction System

2. And (5) competent preparation of saccharomyces cerevisiae strains.

(1) Selecting Saccharomyces cerevisiae strain Saccharomyces cerevisiae S288c, inoculating to YPD liquid culture medium, and culturing at 30deg.C and 200r/min overnight to obtain activated seed solution;

(2) Transferring the seed solution to 100mL of fresh YPD liquid culture medium according to the inoculation proportion of 1% by volume, and continuously culturing at 30 ℃ and 200r/min until the OD600 of the bacterial solution is between 0.8 and 1.2;

(3) Precooling the bacterial liquid obtained in the step (2) for 30min in an ice water bath, and centrifuging at a low temperature and high speed centrifuge at 4 ℃ for 5min at 4000r/min to collect bacterial cells;

(4) Re-suspending the thalli with 25mL of pre-cooled sterile water, centrifuging at a low temperature and high speed centrifuge at 4 ℃ and 4000r/min for 5min to collect thalli, and repeating the process twice; re-suspending the thalli by using 10mL of precooled 1M sorbitol aqueous solution, centrifuging at a low temperature and a high speed of a centrifuge at 4000r/min and a temperature of 4 ℃ for 5min to collect thalli, and repeating the steps twice;

(5) The cells were resuspended in 1mL of 1M aqueous sorbitol and 100. Mu.L of each tube was dispensed.

3. Identification of Saccharomyces cerevisiae strain-sensitive transformants.

(1) Taking a tube 1 of the fungus liquid obtained in the second step, adding 10 mu L of the gene knockout fragment obtained in the first step, mixing and transferring into an electric rotating cup;

(2) Placing on ice for 5min;

(3) 1.5kv electric shock for 5.0ms, adding 1mLYPD culture medium to wash out electrotransfer liquid, and culturing at 30deg.C and 200r/min for 1 hr;

(4) Spread on YPD medium plates containing 500 μg/mLG418 and incubated at 30℃until colonies develop;

(5) Picking the transformant obtained in the step (4) and extracting genome as a template, and performing colony PCR amplification by using verification primers (the nucleotide sequences are shown as SEQ ID NO.3 and SEQ ID NO. 6) to identify a positive transformant in which the Gis4 gene is knocked out; the nucleotide sequence of the Gis4 gene after inactivation is shown as SEQ ID NO. 2;

(6) Positive transformants S288c- ΔGis4 were selected for activation in 5mL YPD liquid medium containing 500. Mu.g/mLG 418 for 24h with sterilized 30% glycerol 1:1, mixing and preserving at-80 ℃.

The primers used in the above procedure were as follows:

GGGCGACTATTTTGACAATG(Gis4-up-F)-SEQ ID NO.3

gtattctgggcctccatgtcTATTTGACCACTGATCATCC(Gis4-up-R)-SEQ ID NO.4

gaatgctggtcgctatactgTCTTTATCAGAACAGTCAGG(Gis4-down-F)-SEQ ID NO.5

GTACCTGCAGAACCACTGTT(Gis4-down-R)-SEQ ID NO.6

GGATGATCAGTGGTCAAATAgacatggaggcccagaatac(G418-F)-SEQ ID NO.7

CCTGACTGTTCTGATAAAGAcagtatagcgaccagcattc(G418-R)-SEQ ID NO.8

example 2

(1) Adding 10 μl of each of glycerol bacteria S288c (original bacteria) and S288c- ΔGis4 (knock-out bacteria constructed in example 1) into sterilized 5mLYPD liquid medium, culturing overnight, and activating;

(2) Transferring the bacterial liquid obtained in the step (1) to 100mL of YPD liquid culture medium according to the inoculation proportion of 1% by volume, and continuously culturing at 30 ℃ and 200r/min until the bacterial liquid OD600 is about 1.5;

(3) 2mL of the bacterial liquid obtained in the step (2) is taken, the absorbance value is measured under the OD600, and the bacterial liquid is diluted by a sterilized YPD liquid culture medium, so that the OD600 of the diluted bacterial liquid is 1;

(4) Adding 190 mu LYPD culture medium and 10 mu L of the bacterial liquid diluted in the step (3) into a 96-well plate, and culturing at 30 ℃ for 24 hours;

(5) Pouring out the 96-well plate bacterial liquid, buffering for 3 times by using 0.01M PBS buffer solution, and drying by beating;

(6) 200 mu L of 1% crystal violet solution is added into a 96-well plate for 10min of dyeing, washed by PBS buffer solution and dried;

(7) 200 mu L of glacial acetic acid is added into a 96-well plate for dissolution, and then the solution is gently shaken, and the yield of the biological film is measured by OD570, and the average value is taken: the OD of S288c was about 0.2 in 96-well plates, and the OD of S288c- ΔGis4 knockout strain was about 0.5 in 96-well plates. The experimental results are shown in FIG. 4, which shows that the Saccharomyces cerevisiae biofilm knocked out of Gis4 gene is obviously increased.

Example 3

(1) Adding 10 μl of each of glycerol bacteria S288c (original bacteria) and S288c- ΔGis4 (knock-out bacteria constructed in example 1) into sterilized 5mLYPD liquid medium, culturing overnight, and activating;

(2) Transferring the bacterial liquid obtained in the step (1) to 100mL of YPD liquid culture medium according to the inoculation proportion of 1% by volume, and continuously culturing at 30 ℃ and 200r/min until the bacterial liquid OD600 is between 0.8 and 1.2;

(3) Transferring the seed solution obtained in the step (2) into 100mL of fermentation medium according to the inoculation volume ratio of 10%, and dividing the seed solution into two types of free fermentation and immobilized fermentation.

When immobilized fermentation is carried out: adding cotton fiber materials into a fermentation medium as immobilized materials, and adding 4g of cotton fiber medium into each shake flask; fermenting at 30deg.C and 200r/min, after glucose is exhausted, measuring residual sugar content of fermentation liquid by using a sugar meter, and measuring alcohol content in fermentation liquid by using a high performance gas chromatograph;

when the separation fermentation is carried out: only no immobilized material is added, and the rest is the same as immobilized fermentation;

wherein, the formula of the fermentation medium is as follows: 60g/L glucose, 4g/L peptone, 0.5g/L ammonium sulfate, 3g/L monopotassium phosphate, 3g/L yeast extract, 0.5g/L magnesium sulfate, 0.05g/L ferrous sulfate heptahydrate, 0.05g/L zinc sulfate heptahydrate, and the solvent is water.

(4) The fermentation results are shown in FIG. 5 and FIG. 6 (W-wild bacteria free fermentation, WI-wild bacteria immobilized fermentation, deltaGis 4-knockout bacteria free fermentation, deltaGis 4-knockout bacteria immobilized fermentation), and the fermentation data show that the immobilized fermentation has a faster sugar consumption rate and a higher ethanol yield than the free fermentation; the immobilized fermentation periods of the original strain S288c and the genetically modified strain S288 c-delta Gis4 are 30h and 22h respectively, the fermentation period of the genetically modified strain is shortened by about 8h, and the sugar consumption rate is improved by about 27%; at the end of the immobilized fermentation, the ethanol yield of the original strain S288c and the genetically modified strain S288 c-DeltaGis 4 are 19g/L and 30g/L respectively, the ethanol yield of the genetically modified strain is improved by about 11g/L, and the fermentation efficiency is improved by about 58%.

The invention provides a recombinant saccharomyces cerevisiae genetically engineered bacterium, a construction method and an application thought and method thereof, and a method and a way for realizing the technical scheme are more, the above is only a preferred embodiment of the invention, and it should be pointed out that a plurality of improvements and modifications can be made by a person of ordinary skill in the art without departing from the principle of the invention, and the improvements and modifications are also considered as the protection scope of the invention. The components not explicitly described in this embodiment can be implemented by using the prior art.

Sequence listing

<110> university of Nanjing Industrial science

<120> a recombinant saccharomyces cerevisiae genetically engineered bacterium, and construction method and application thereof

<160> 12

<170> SIPOSequenceListing 1.0

<210> 1

<211> 2325

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 1

atgcaaaaat ccgttagagt gggcgactat tttgacaatg atgacaatgg tttgtggtcg 60

tggtacttaa caaacctcag attaggcgat tttgaagaac ttataggcaa tcaattaaaa 120

tacactctgt taaaaagatt tctgaatagt catttttatg gtgataacaa tatttcggcc 180

aggccaaaca agaagatttt gttagtttcc atcccagaga atgttcatga agatatctcc 240

atattggaaa tcttcctcaa agattacttt catctggaaa aattagaaca cattcaaatc 300

tcaaaattaa ctcactccca ctgctacaat catgaaaatc attacctatt gacggacaac 360

ctcaacaatt tccaagaccc taccttttta gaatttgcga gtacaagttg gcaagttcaa 420

aaaaattcca aggctttaaa caataacaat agaaattcaa taccaccacc cacaatatct 480

tcatcaaaag cttcaaacgg gaagctagaa tcaaacgttt cggatgatca gtggtcaaat 540

ataaataccc agacttcaac agctacccga actaatacga atacgaggac tttgacatct 600

ccggacacag ttgatataaa cgttacatcc gtgaatagtc aaagcaataa taatgatacg 660

cctcaagata atgaaaacga agttgatgaa gaggatgcca caagttctat agtcctaaat 720

ttttctcatt cgcgaacagt agattcaaag cctaatagac tacccaaaat ttttccatca 780

tacactaatg aagactatac accgtcacat tccgagataa tgtcaataga tagttttgct 840

ggcgaagacg tatcatccac atatcccgga caagacctga gtttaactac tgccaggcgc 900

gaggatgaaa gtggtcagga tgaagttgag gatcattata gcagagtctc acatgatcta 960

ggtgacgaga gtatcgatca agcaagttat agcatggaaa gttcggtcag ctacactagc 1020

tatagtagta gcagtaatag tagtagtgcc cactacagtt taagcagtag cagccgaggt 1080

aatccaaaac gtgaaaacat cgatcacacg aatgccacct atgtctctga attgtcaagt 1140

ataacgagtt ctatagacaa tttaactact tcgacaaccc cagaggagga ggataattta 1200

attcatcata actatgacgc ccaagggtat ggatcaggag aggacgatgg agaagaggtt 1260

tatgatgatg aagatctttc ttcttccgat tactcagtac tatccattct accgtcaatc 1320

tcaatttgtg attctctagg gtattttagg ctagttttgc aatctatatt aattcaggat 1380

ccagacacca aagaaatttt tactgcgatt agacagtcaa acaataaacc tacaatggca 1440

agcgttaccg atgattggtt gctgtatgat tccaattttt caatgaataa tttacaaatt 1500

ctaacacttc aagatttgct agatatcaag agatcatttc caaaaatttt attttacaca 1560

atggttattg tgacaaactc cggcaaacag gttgaagaag aattcaaaaa tcccaattat 1620

gataataggg aaggaatatc aaaagagcaa cctctagatt ctgagttatc attaactaac 1680

gacccgcaac aatatttccc gactgcatat aataacggtt acaacgacta tattgacgat 1740

gaagacgatg aagacgatgg tgacgatgct tctttatcag aacagtcagg cccacaaatg 1800

tacataccaa ctagaatgga atctaacgtt actacagcac atcgttctat tagaaccgta 1860

aacagtatcg gggaatgggc attcaataga cataattctg ttacaaaaat cgataaaagt 1920

aatagtaacg agttggataa ctctaaaaca ggtgaaagta cagttttatc aagtgaacct 1980

catccaatga cacaactgtc gaactctaat acgacttcct cgaattttag ccattctttg 2040

aagacaaaaa attctcacaa acctaattcc aagggtaaca atgaaagtaa ttccaaaaat 2100

gagttgaaaa agataaagag ttccatcaat gctatgagtg ccgtggaaag gtccaaaagt 2160

ttgcctttac ctacattact aaagtcttta agcggcatag ataaccctac tcatgccact 2220

aacaaggata gaaagcgttg gaaattccag atgaataggt ttaagaatca taaaaacagt 2280

ggttctgcag gtacggataa atctcagcgt tgtgccatca tgtaa 2325

<210> 2

<211> 1096

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 2

atgcaaaaat ccgttagagt gggcgactat tttgacaatg atgacaatgg tttgtggtcg 60

tggtacttaa caaacctcag attaggcgat tttgaagaac ttataggcaa tcaattaaaa 120

tacactctgt taaaaagatt tctgaatagt catttttatg gtgataacaa tatttcggcc 180

aggccaaaca agaagatttt gttagtttcc atcccagaga atgttcatga agatatctcc 240

atattggaaa tcttcctcaa agattacttt catctggaaa aattagaaca cattcaaatc 300

tcaaaattaa ctcactccca ctgctacaat catgaaaatc attacctatt gacggacaac 360

ctcaacaatt tccaagaccc taccttttta gaatttgcga gtacaagttg gcaagttcaa 420

aaaaattcca aggctttaaa caataacaat agaaattcaa taccaccacc cacaatatct 480

tcatcaaaag cttcaaacgg gaagctagaa tcaaacgttt cggatgatca gtggtcaaat 540

atctttatca gaacagtcag gcccacaaat gtacatacca actagaatgg aatctaacgt 600

tactacagca catcgttcta ttagaaccgt aaacagtatc ggggaatggg cattcaatag 660

acataattct gttacaaaaa tcgataaaag taatagtaac gagttggata actctaaaac 720

aggtgaaagt acagttttat caagtgaacc tcatccaatg acacaactgt cgaactctaa 780

tacgacttcc tcgaatttta gccattcttt gaagacaaaa aattctcaca aacctaattc 840

caagggtaac aatgaaagta attccaaaaa tgagttgaaa aagataaaga gttccatcaa 900

tgctatgagt gccgtggaaa ggtccaaaag tttgccttta cctacattac taaagtcttt 960

aagcggcata gataacccta ctcatgccac taacaaggat agaaagcgtt ggaaattcca 1020

gatgaatagg tttaagaatc ataaaaacag tggttctgca ggtacggata aatctcagcg 1080

ttgtgccatc atgtaa 1096

<210> 3

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 3

gggcgactat tttgacaatg 20

<210> 4

<211> 40

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 4

gtattctggg cctccatgtc tatttgacca ctgatcatcc 40

<210> 5

<211> 40

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 5

gaatgctggt cgctatactg tctttatcag aacagtcagg 40

<210> 6

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 6

gtacctgcag aaccactgtt 20

<210> 7

<211> 40

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 7

ggatgatcag tggtcaaata gacatggagg cccagaatac 40

<210> 8

<211> 40

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 8

cctgactgtt ctgataaaga cagtatagcg accagcattc 40

<210> 9

<211> 521

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 9

gggcgactat tttgacaatg atgacaatgg tttgtggtcg tggtacttaa caaacctcag 60

attaggcgat tttgaagaac ttataggcaa tcaattaaaa tacactctgt taaaaagatt 120

tctgaatagt catttttatg gtgataacaa tatttcggcc aggccaaaca agaagatttt 180

gttagtttcc atcccagaga atgttcatga agatatctcc atattggaaa tcttcctcaa 240

agattacttt catctggaaa aattagaaca cattcaaatc tcaaaattaa ctcactccca 300

ctgctacaat catgaaaatc attacctatt gacggacaac ctcaacaatt tccaagaccc 360

taccttttta gaatttgcga gtacaagttg gcaagttcaa aaaaattcca aggctttaaa 420

caataacaat agaaattcaa taccaccacc cacaatatct tcatcaaaag cttcaaacgg 480

gaagctagaa tcaaacgttt cggatgatca gtggtcaaat a 521

<210> 10

<211> 524

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 10

tctttatcag aacagtcagg cccacaaatg tacataccaa ctagaatgga atctaacgtt 60

actacagcac atcgttctat tagaaccgta aacagtatcg gggaatgggc attcaataga 120

cataattctg ttacaaaaat cgataaaagt aatagtaacg agttggataa ctctaaaaca 180

ggtgaaagta cagttttatc aagtgaacct catccaatga cacaactgtc gaactctaat 240

acgacttcct cgaattttag ccattctttg aagacaaaaa attctcacaa acctaattcc 300

aagggtaaca atgaaagtaa ttccaaaaat gagttgaaaa agataaagag ttccatcaat 360

gctatgagtg ccgtggaaag gtccaaaagt ttgcctttac ctacattact aaagtcttta 420

agcggcatag ataaccctac tcatgccact aacaaggata gaaagcgttg gaaattccag 480

atgaataggt ttaagaatca taaaaacagt ggttctgcag gtac 524

<210> 11

<211> 1357

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 11

gacatggagg cccagaatac cctccttgac agtcttgacg tgcgcagctc aggggcatga 60

tgtgactgtc gcccgtacat ttagcccata catccccatg tataatcatt tgcatccata 120

cattttgatg gccgcacggc gcgaagcaaa aattacggct cctcgctgca gacctgcgag 180

cagggaaacg ctcccctcac agacgcgttg aattgtcccc acgccgcgcc cctgtagaga 240

aatataaaag gttaggattt gccactgagg ttcttctttc atatacttcc ttttaaaatc 300

ttgctaggat acagttctca catcacatcc gaacataaac aaccatgggt aaggaaaaga 360

ctcacgtttc gaggccgcga ttaaattcca acatggatgc tgatttatat gggtataaat 420

gggctcgcga taatgtcggg caatcaggtg cgacaatcta tcgattgtat gggaagcccg 480

atgcgccaga gttgtttctg aaacatggca aaggtagcgt tgccaatgat gttacagatg 540

agatggtcag actaaactgg ctgacggaat ttatgcctct tccgaccatc aagcatttta 600

tccgtactcc tgatgatgca tggttactca ccactgcgat ccccggcaaa acagcattcc 660

aggtattaga agaatatcct gattcaggtg aaaatattgt tgatgcgctg gcagtgttcc 720

tgcgccggtt gcattcgatt cctgtttgta attgtccttt taacagcgat cgcgtatttc 780

gtctcgctca ggcgcaatca cgaatgaata acggtttggt tgatgcgagt gattttgatg 840

acgagcgtaa tggctggcct gttgaacaag tctggaaaga aatgcataag cttttgccat 900

tctcaccgga ttcagtcgtc actcatggtg atttctcact tgataacctt atttttgacg 960

aggggaaatt aataggttgt attgatgttg gacgagtcgg aatcgcagac cgataccagg 1020

atcttgccat cctatggaac tgcctcggtg agttttctcc ttcattacag aaacggcttt 1080

ttcaaaaata tggtattgat aatcctgata tgaataaatt gcagtttcat ttgatgctcg 1140

atgagttttt ctaatcagta ctgacaataa aaagattctt gttttcaaga acttgtcatt 1200

tgtatagttt ttttatattg tagttgttct attttaatca aatgttagcg tgatttatat 1260

tttttttcgc ctcgacatca tctgcccaga tgcgaagtta agtgcgcaga aagtaatatc 1320

atgcgtcaat cgtatgtgaa tgctggtcgc tatactg 1357

<210> 12

<211> 2402

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 12

gggcgactat tttgacaatg atgacaatgg tttgtggtcg tggtacttaa caaacctcag 60

attaggcgat tttgaagaac ttataggcaa tcaattaaaa tacactctgt taaaaagatt 120

tctgaatagt catttttatg gtgataacaa tatttcggcc aggccaaaca agaagatttt 180

gttagtttcc atcccagaga atgttcatga agatatctcc atattggaaa tcttcctcaa 240

agattacttt catctggaaa aattagaaca cattcaaatc tcaaaattaa ctcactccca 300

ctgctacaat catgaaaatc attacctatt gacggacaac ctcaacaatt tccaagaccc 360

taccttttta gaatttgcga gtacaagttg gcaagttcaa aaaaattcca aggctttaaa 420

caataacaat agaaattcaa taccaccacc cacaatatct tcatcaaaag cttcaaacgg 480

gaagctagaa tcaaacgttt cggatgatca gtggtcaaat agacatggag gcccagaata 540

ccctccttga cagtcttgac gtgcgcagct caggggcatg atgtgactgt cgcccgtaca 600

tttagcccat acatccccat gtataatcat ttgcatccat acattttgat ggccgcacgg 660

cgcgaagcaa aaattacggc tcctcgctgc agacctgcga gcagggaaac gctcccctca 720

cagacgcgtt gaattgtccc cacgccgcgc ccctgtagag aaatataaaa ggttaggatt 780

tgccactgag gttcttcttt catatacttc cttttaaaat cttgctagga tacagttctc 840

acatcacatc cgaacataaa caaccatggg taaggaaaag actcacgttt cgaggccgcg 900

attaaattcc aacatggatg ctgatttata tgggtataaa tgggctcgcg ataatgtcgg 960

gcaatcaggt gcgacaatct atcgattgta tgggaagccc gatgcgccag agttgtttct 1020

gaaacatggc aaaggtagcg ttgccaatga tgttacagat gagatggtca gactaaactg 1080

gctgacggaa tttatgcctc ttccgaccat caagcatttt atccgtactc ctgatgatgc 1140

atggttactc accactgcga tccccggcaa aacagcattc caggtattag aagaatatcc 1200

tgattcaggt gaaaatattg ttgatgcgct ggcagtgttc ctgcgccggt tgcattcgat 1260

tcctgtttgt aattgtcctt ttaacagcga tcgcgtattt cgtctcgctc aggcgcaatc 1320

acgaatgaat aacggtttgg ttgatgcgag tgattttgat gacgagcgta atggctggcc 1380

tgttgaacaa gtctggaaag aaatgcataa gcttttgcca ttctcaccgg attcagtcgt 1440

cactcatggt gatttctcac ttgataacct tatttttgac gaggggaaat taataggttg 1500

tattgatgtt ggacgagtcg gaatcgcaga ccgataccag gatcttgcca tcctatggaa 1560

ctgcctcggt gagttttctc cttcattaca gaaacggctt tttcaaaaat atggtattga 1620

taatcctgat atgaataaat tgcagtttca tttgatgctc gatgagtttt tctaatcagt 1680

actgacaata aaaagattct tgttttcaag aacttgtcat ttgtatagtt tttttatatt 1740

gtagttgttc tattttaatc aaatgttagc gtgatttata ttttttttcg cctcgacatc 1800

atctgcccag atgcgaagtt aagtgcgcag aaagtaatat catgcgtcaa tcgtatgtga 1860

atgctggtcg ctatactgtc tttatcagaa cagtcaggcc cacaaatgta cataccaact 1920

agaatggaat ctaacgttac tacagcacat cgttctatta gaaccgtaaa cagtatcggg 1980

gaatgggcat tcaatagaca taattctgtt acaaaaatcg ataaaagtaa tagtaacgag 2040

ttggataact ctaaaacagg tgaaagtaca gttttatcaa gtgaacctca tccaatgaca 2100

caactgtcga actctaatac gacttcctcg aattttagcc attctttgaa gacaaaaaat 2160

tctcacaaac ctaattccaa gggtaacaat gaaagtaatt ccaaaaatga gttgaaaaag 2220

ataaagagtt ccatcaatgc tatgagtgcc gtggaaaggt ccaaaagttt gcctttacct 2280

acattactaa agtctttaag cggcatagat aaccctactc atgccactaa caaggataga 2340

aagcgttgga aattccagat gaataggttt aagaatcata aaaacagtgg ttctgcaggt 2400

ac 2402

Claims (5)

1. The application of the recombinant saccharomyces cerevisiae gene engineering bacteria in preparing ethanol by immobilized fermentation is characterized in that the Gis4 gene of the recombinant saccharomyces cerevisiae is inactivated; the saccharomyces cerevisiae is saccharomyces cerevisiae (Saccharomyces cerevisiae) S288c;

the nucleotide sequence of the Gis4 gene after inactivation is shown as SEQ ID NO. 2.

2. The use according to claim 1, wherein the construction method of the recombinant saccharomyces cerevisiae genetically engineered bacteria comprises the following steps:

(1) Amplifying to obtain an upstream homologous arm and a downstream homologous arm of the Gis4 gene by taking genomic DNA of Saccharomyces cerevisiae as a template; taking plasmid PUG6 as a template, and amplifying to obtain a G418 fragment;

(2) Amplifying the upstream homology arm, the downstream homology arm and the G418 fragment of the Gis4 gene obtained in the step (1) to obtain a gene knockout fragment;

(3) And (3) converting the gene knockout fragment obtained in the step (2) into saccharomyces cerevisiae competence to obtain the recombinant saccharomyces cerevisiae genetically engineered bacterium.

3. The use according to claim 1, wherein the immobilized fermentation uses natural organic carriers, synthetic polymer carriers, artificial inorganic polymer materials and composite materials as immobilized medium

4. The use according to claim 1, wherein the fermentation temperature is 30-40 ℃.

5. The use according to claim 1, characterized in that the fermentation medium formulation for the fermentation is as follows: 55-110g/L glucose, 3-6g/L peptone, 0.5-1g/L ammonium sulfate, 3-6g/L monopotassium phosphate, 3-6g/L yeast extract, 0.5-1g/L magnesium sulfate, 0.05-1g/L ferrous sulfate heptahydrate, 0.05-1g/L zinc sulfate heptahydrate, and water as solvent.