CN113308462A

CN113308462A - Probe for nucleic acid intramolecular amplification and detection method thereof

Info

Publication number: CN113308462A
Application number: CN202010121899.8A
Authority: CN
Inventors: 孟祥贤; 蓝琳; 刘孟坛; 刘志强
Original assignee: Hunan University
Current assignee: Hunan University
Priority date: 2020-02-27
Filing date: 2020-02-27
Publication date: 2021-08-27
Anticipated expiration: 2040-02-27
Also published as: CN113308462B

Abstract

The probe for nucleic acid intramolecular amplification of the present invention at least contains five regions (5 ') a-b-a-c-a (3 '), including two identical regions a, one at the 5 ' end and one in the middle; the b region is connected with two a regions, wherein one a region is connected with the 5 ' end of the b region at the 5 ' end, the other a region is connected with the 5 ' end of the c region, the c region is connected with the 5 ' end of the a region, the a region is the complementary nucleotide sequence of the a region and is at the 3 ' end of the probe; the probe is used as a template and a primer to carry out nucleic acid intramolecular amplification under the action of polymerase. The invention designs the template and the primer in one molecule, and realizes the nucleic acid intramolecular amplification by the same template, thereby effectively avoiding the problem of false positive. The present invention also includes a method for detecting a target nucleic acid using the probe and the probe precursor. The method can detect the difference of single base, has strong anti-interference capability and wide market prospect.

Description

Probe for nucleic acid intramolecular amplification and detection method thereof

Technical Field

The invention belongs to a nucleic acid amplification method in the technical field of molecular biology, and particularly relates to a probe for nucleic acid intramolecular amplification and a detection method.

Background

Today, molecular diagnostic and detection techniques centered on nucleic acid amplification have become a focus of both academia and industry. Currently, a series of nucleic acid amplification techniques are developed successively. These techniques can be divided into two types according to whether precise temperature control is required, the first type is temperature-variable amplification, which mainly includes temperature-controlled amplification of Polymerase Chain Reaction (PCR) and Ligase Chain Reaction (LCR). In these amplification methods, the number of newly synthesized sequences is increased by repeated thermal cycling, but special, relatively expensive thermal cycling equipment is required. The second type accumulates specific sequences under isothermal conditions, such as Strand Displacement Amplification (SDA), Rolling Circle Amplification (RCA), transcription dependent amplification system (TAS), nucleic acid sequence dependent amplification (NASBA), helicase gene dependent amplification (HDA), single primer isothermal amplification technique (SPIA), autonomous sequence replication (3SR), loop-mediated isothermal amplification technique (LAMP), CRISPR strand displacement amplification technique (CRISDA), and the like. According to the temperature-changing and constant-temperature-based amplification technology, the template is subjected to exponential or non-exponential amplification under the mediation of the primers, so that the purpose of specific sequence amplification is achieved. They basically consist of two phases: (1) and (4) target signal conversion process. Converting the target signal into a template signal through various primers (such as PCR primers, LAMP primers, RCA connecting fragments and the like); (2) and (3) an amplification process. The template is subjected to exponential or non-exponential amplification under the mediation of the primer, so that the purpose of specific sequence amplification is realized. Each of these amplification techniques has its own innovation, effectively achieving the goal of repeatedly amplifying a specific sequence. The existing amplification technology has the capability of amplifying a single target molecule by millions times for sensitive detection, but the more serious problems faced at present are: the risk of false positives during nucleic acid amplification. The main cause of false positives is in the second stage of nucleic acid amplification, the amplification process. There are two main reasons for this: (1) an amplification reaction is a reaction between a template molecule and a primer molecule. The amplification yield is positively correlated with the amount of the added primer. In an amplification system, more primer molecules than template are often added. Excess free primer molecules may react to form dimers, giving false positives. (2) The templates used for amplification are different. The method is characterized in that the method takes continuously newly generated products as templates to carry out exponential or linear replication. During replication, especially during the initial stages of amplification, a mismatch can cascade and give false positives.

Disclosure of Invention

The invention aims to solve the technical problem of overcoming the defects in the existing nucleic acid amplification technology, and provides a probe for nucleic acid intramolecular amplification and a detection method, which effectively reduce the false positive problem caused by the existing nucleic acid amplification.

The technical scheme adopted by the invention for solving the technical problems is as follows:

the invention of the nucleic acid molecules in the amplification of the probe, the probe nucleotide sequence contains at least (5 ') a-b-a-c-a (3 ') five regions, containing two identical a region, one in the 5 ' end, one in the middle; and the b region is connected with the two a regions, wherein one a region is connected with the 5 ' end of the b region at the 5 ' end, the other a region is connected with the 5 ' end of the c region, the c region is connected with the 5 ' end of the a region, and the a region is the complementary nucleotide sequence of the a region and is at the 3 ' end of the probe. (1) The probe is a free nucleotide with a concave 3 'end and a free nucleotide with the same nucleotide sequence as the stem nucleotide sequence at the 5' end. The probe is in a stem-loop structure, wherein a region a sequence at the 3 'end is complementary and matched with a region a sequence in the middle of the probe to form a stem, a region c sequence forms a loop, and the region a and the region b at the 5' end have no complementary and matched nucleotides and are in a free state to form the tail part of the probe; (2) the probe is used as a template and a primer to carry out nucleic acid intramolecular amplification under the action of polymerase.

The probe is used as a template and a primer to carry out nucleic acid intramolecular amplification under the action of polymerase; the method comprises the following specific steps:

(1) under the action of polymerase, the probe takes a region a and a region b which are not subjected to complementary pairing at the 5 ' end of the probe as a template, and takes the 3 ' end of a region a at the 3 ' end as a synthesis starting point to synthesize a self complementary strand;

(2) the polymerization product obtained in the step (1) is subjected to dynamic dissociation at the reaction temperature and self-annealing to form a probe structure again, namely the 3 'end is concave, the 5' end contains free nucleotides with the same nucleotides as the stem a region, and the loop of the newly generated probe structure is added with a section of specific nucleotide sequence b-a than the loop of the initial hairpin structure;

(3) and (2) repeating the steps (1) and (2), and continuously expanding the ring part of the hairpin structure to obtain a nucleic acid amplification product so as to realize nucleic acid amplification.

There are various methods for synthesizing the probe of the present invention. The probe can be synthesized directly by a company, can be formed by connecting nucleic acid connecting fragments in the presence of a target nucleic acid, and can also be formed by extending a probe precursor in the presence of the target nucleic acid. There are many probe precursors and probe-forming nucleic acid linker fragments.

The probe precursor is one of the means for forming a probe, and the nucleotide sequence of the probe precursor contains at least four regions (5 ') a-b-a-c (3') comprising two identical regions a, one of which is connected at the 5 'end to the 5' end of region b, the other of which is connected at the 5 'end to region c, region b is connected to both of regions a, and region c is at the 3' end. (1) Region a is a nucleotide sequence complementary to the 3' -terminal region of the product of the precursor extension synthesis, region b is a nucleotide sequence linking the two regions a, and region c is a nucleotide sequence complementary to the target nucleic acid; (2) in the presence of the target nucleic acid, the precursor c region is extended to form a region a, and the formed c + a is dynamically dissociated from the target nucleic acid at the reaction temperature; (3) the a region formed by extending the precursor and the original a region sequence of the precursor are subjected to folding complementary pairing to form a probe, namely a 3 'end recess, and 5' contains free nucleotides with the same nucleotide sequence as the stem nucleotide sequence.

The probe precursor for the amplification in the nucleic acid molecule at least comprises four regions (5 ') a-b-a-c (3'), namely the precursor is not limited to the four regions, and can also comprise a plurality of nucleotide sequences in signal detection modes.

The probe for amplifying in the nucleic acid molecule at least comprises five regions (5 ') a-b-a-c-a (3'), namely the probe is not limited to the five regions, and can also comprise a plurality of nucleotide sequences with signal detection modes.

The method for detecting a target nucleic acid by using a probe and a probe precursor of the present invention comprises the steps of:

(1) annealing the 3 'c region of the probe precursor (5') a-b-a-c (3 ') to the region c region near the 5' end of the target nucleic acid;

(2) the polymerase takes the 3' end of the c region of the annealed precursor as a synthesis starting point and takes the a region of the target nucleic acid which is not subjected to complementary pairing as a template to carry out synthesis reaction;

(3) the precursor extension product generated in the step (2) can be annealed by itself at the reaction temperature and is dynamically dissociated from the target nucleic acid to form a probe, namely a 3 'end is sunken, and 5' of the probe contains free nucleotides with the same nucleotide sequence as the stem nucleotide sequence;

(4) synthesizing a self complementary strand of the probe formed in the step (3) by taking the a region and the b region which are not subjected to complementary pairing at the 5 ' end of the probe as templates and taking the 3 ' end of the a-region at the 3 ' end as a synthesis starting point under the action of polymerase;

(5) and (3) dynamically dissociating the polymerization product obtained in the step (4) at the reaction temperature and annealing the polymerization product by self to form a probe structure again, namely the 3 'end is concave, the 5' end contains free nucleotides with the same nucleotides as the stem a region, and the loop of the newly generated probe structure is added with a section of specific nucleotide sequence (b-a) compared with the loop of the initial hairpin structure.

(6) The steps (4) and (5) are repeatedly circulated, the ring part of the hairpin structure is continuously enlarged, a nucleic acid amplification product is obtained, and nucleic acid amplification is realized;

(7) the presence of the target nucleic acid can be determined by detecting the amplification product with the added nucleic acid reagent.

The probe precursor of the invention generates a probe through reaction in the presence of target nucleic acid, a template and a primer are in the same molecule on one hand, and the probe generates intramolecular polymerization reaction by taking the 5 'end of the probe as the template and the 3' end as the primer under the action of polymerase, and on the other hand, the nucleic acid replication is based on the same template on each time, thereby avoiding the false positive problem caused by the difference between a primer dimer and an amplification template in the traditional nucleic acid amplification reaction process.

The target nucleic acid nucleotide sequence in the present invention may be DNA or RNA.

When the nucleotide sequence is a DNA molecule, the polymerase is a polymerase having strand displacement activity but no exonuclease activity. Such as one of Bst DNA polymerase, Bsm DNA polymerase, Bsu DNA polymerase, Klenow fragment 3 '-5' exo-polymerase, DNA polymerase I, reverse transcriptase, phi29DNA polymerase, or other similarly functioning polymerases.

When the nucleotide sequence is an RNA molecule, the polymerase is a reverse transcriptase or a polymerase having reverse transcription activity.

Furthermore, in the method for detecting a target nucleic acid by using a probe or a probe precursor, a nucleic acid melting reagent can be added to the system to promote dynamic dissociation of the nucleic acid, so that the double-stranded nucleotide is changed into a single-stranded nucleotide. Such as betaine, formamide, dimethyl sulfoxide, proline, etc.

In a method for detecting a target nucleic acid using a probe or a probe precursor, an amplification product is detected based on the addition of a nucleic acid reagent. Nucleic acid reagents include fluorescence detection reagents, colorimetric detection reagents, electrochemical detection reagents, chemiluminescent detection reagents, and the like.

The fluorescence detection reagent comprises a reagent capable of intercalating DNA to emit light, such as Eva Green, ethidium bromide, SYBR Green I, SYBR Green II, GoodView and the like, and also comprises a fluorescence resonance energy transfer method labeled with a fluorescent group and a quenching group, a molecular beacon, a nucleic acid aptamer or a nucleic acid aptamer and the like.

The fluorescence detection can be performed using an instrument that can maintain a constant temperature and fluorescence scan, such as an Shimadzu 2700 fluorescence spectrometer; the reaction can also be carried out at constant temperature using existing PCR instruments, such as a Berle CFX96 fluorescent quantitative PCR instrument.

The colorimetric detection reagent comprises reagents which can change colors, such as calcein color, nano gold color, ABTS color and the like.

The electrochemical detection reagent comprises oligonucleotide detection by using an electrochemical means, such as a horseradish peroxidase electrochemical system, a terpyridyl ruthenium electrochemical system and the like.

The chemiluminescence detection reagent comprises a ruthenium bipyridyl + TPA system, an acridine lipid-hydrogen peroxide system and the like.

The term "dissociation" as used herein refers to the process by which double-stranded nucleotides become single-stranded nucleotides.

The term "self-folding complementary pairing" as used in the present specification means that the oligonucleotide itself contains a complementary pairing nucleotide sequence, and base complementary pairing occurs by itself.

The term "hairpin" structure, also referred to as "stem-loop" structure, as used herein, refers to an oligonucleotide molecule that can form a secondary structure comprising a double-stranded region (stem) formed by two regions within the oligonucleotide molecule, and further comprising at least one "loop" structure, i.e., a non-complementary nucleotide molecule (single-stranded region).

The term "3 'recess" as used herein refers to both ends of the hairpin structure, the 3' end and the 5 'end, wherein the 3' terminal nucleotide sequence is involved in forming a stem without free nucleotides, and the 5 'end has free nucleotides, the entire hairpin being in the form of a 3' terminal recess.

The term "free nucleotides" as used herein refers to single-stranded nucleotides for which complementary pairing does not occur.

The probe precursor or the nucleic acid-ligated fragment of the present invention can be prepared into a kit.

A kit comprising a probe precursor or nucleic acid linker that generates a probe in the presence of a target nucleic acid and self-replicates to produce a detection signal. The kit can detect single base difference, has strong anti-interference capability and can effectively avoid the problem of false positive.

The invention has the following advantages:

(1) under the action of polymerase, the probe takes a region a and a region b which are not subjected to complementary pairing at the 5 'end of the probe as a template, and takes a region a at the 3' end as a primer, so that intramolecular polymerization reaction is performed, no primer dimer is generated, and the specificity is higher;

(2) the probe takes the self as a template and the primer to carry out intramolecular polymerization reaction, and the single-chain copying mode always copies by using the same template in the copying process, so that the copying accuracy is better;

(3) only one probe precursor (or a nucleic acid connecting fragment capable of forming a probe) is needed in the detection process, 4 primers in the LAMP method in the prior art are not needed, the experimental design is simple, and the investment cost is low.

In conclusion, the invention provides a novel probe for nucleic acid intramolecular amplification, a probe precursor, a nucleic acid connecting fragment and an amplification method, which can detect single base difference, have strong anti-interference capability and can effectively avoid the problem of false positive. The method can be applied to all fields needing nucleic acid amplification, has wide market prospect and larger economic and social benefits, and is suitable for large-scale popularization and application.

Drawings

FIG. 1 is a schematic diagram of the intramolecular amplification of nucleic acids according to the present invention;

FIG. 2 is a graph showing fluorescence signals obtained by detecting the fluorescence signals obtained in example 1 of the present invention;

FIG. 3 is a graph showing the detection results of example 1 according to the present invention;

FIG. 4 is an AFM graph showing the results of detection in example 1 of the present invention;

FIG. 5 is a graph showing fluorescence signals of the results of betaine detection in example 2 of the present invention;

FIG. 6 is a graph showing fluorescence signals obtained by the colorimetric detection in example 3 of the present invention;

FIG. 7 is a graph showing fluorescence signals obtained by fluorescence detection in example 4 of the present invention;

FIG. 8 is a graph showing fluorescence signals obtained by fluorescence detection in example 5 of the present invention;

FIG. 9 is a graph showing fluorescence signals obtained by fluorescence detection in example 6 of the present invention;

FIG. 10 is a graph showing fluorescence signals obtained by the fluorescence method in example 7 of the present invention;

Detailed Description

The present invention will be described in further detail with reference to the following detailed description and the accompanying drawings.

The basic reaction solution in the examples refers to a reaction solution for an amplification reaction, wherein the substances and concentrations are as follows: 200mmol/L tris (hydroxymethyl) aminomethane (pH 8.8),100mmol/L potassium chloride, 100mmol/L ammonium sulfate, 20mmol/L magnesium sulfate _,1% (v/v) Tween 20, 1xEva Green dye, 4mmol/L magnesium chloride, 0.4mmol/L dNTPs,8U Bst DNA polymerase, 1.4mol/L betaine.

Example 1 verification of feasibility of method and correctness of its principle

In this example, probe sequences containing five regions (5 ') a-b-a-c-a (3') described in the summary of the invention were designed and directly synthesized by the company, and nucleic acid intramolecular amplification reaction was performed (fig. 1), and the feasibility of the method and the accuracy of the principle were verified by three methods, i.e., a fluorescence signal verification method, an electrophoresis result verification method, and an atomic force microscope result verification method. The probe sequence synthesized in this example was (AGAGGTAGTACTAGTACTCAAGAGGTAGTACTAGTAAGTTGCCTTCAGAACTCTACTACTACTAGT ACTACCTCT, SEQ ID NO. 1). Meanwhile, a control sequence 1 and a control sequence 2 of the probe are synthesized, wherein the control sequence 1 (the sequence is AGAGGTAGTACTAGTACTCAAGAGGTAGTACTAGTAAGTTGCCTTCAGAACTCTACTACTACTTCAAC TAGGACT, namely SEQ ID NO.2), and compared with the probe sequence (5 ') a-b-a-c-a (3 '), the control sequence 1 is that the nucleotide sequence a at the 3 ' end is changed into other nucleotide sequences; control sequence 2 (sequence TCTGCAAGTAGCTGTAGTCAAGAGGTAGTACTAGTAAGTTGCCTTCAGAACTCTACTACTACTAGTAC TACCTCT, SEQ ID NO.3), control sequence 2 was a 5 ' end a replaced with another nucleotide sequence compared to probe sequence (5 ') a-b-a-c-a (3 '). The specific process is as follows:

first, carry out the amplification of nucleic acid in molecule

1) Preparing 23uL of basic reaction solution;

2) taking 2uL of 400nmol/L probe or the reference sequence 1 and the reference sequence 2, respectively adding into the basic reaction solution prepared in the step 1), so that the volume of the final reaction solution is 25uL, and uniformly mixing the reaction solutions;

3) the isothermal amplification reaction was carried out at 65 ℃ for 2 hours using a thermostatic device (e.g., a water bath, a PCR apparatus, etc.).

4) Inactivating at 85 ℃, and stopping the amplification reaction to obtain an amplification product.

Detecting the amplified product with fluorescent signal. The fluorescence intensity of the fluorescent probe sample is detected by using Shimadzu 2700 fluorescence spectrometer, and the result shows (as shown in FIG. 2), and it can be seen from the figure that the fluorescent signal of the probe sample synthesized by the design of this example is significant, while the increase of the fluorescent signal is not significant for the control sequence 1 (i.e. the control probe 1 in the figure) and the control sequence 2 (i.e. the control probe 2 in the figure). This example shows that the synthesized probe sample has a large amount of nucleic acid and the sample is efficiently amplified. And the stem part without the 3 'recess and the 5' tail end without the control sequence 1 and the control sequence 2 with the same nucleotide as the stem part can not effectively react by amplification, thereby verifying the principle of the experiment.

Detecting the amplified product through electrophoresis. 6% modified polyacrylamide gel is prepared, the voltage is 100V, the electrophoresis time is 80 minutes, silver staining is carried out, and the detection result is shown in figure 3. In the figure, the lane is a sample band with a band 1 as a control sequence 1, a band 3 as a probe sample band, a band 4 as a sample band with a control sequence 2, and a band 2 as a 2000bp DNA Marker band from left to right, and it can be seen that the probe sample is amplified under the action of polymerase to generate a plurality of products, the fragment size is varied from 60nt to several thousand nt, and the products are arranged in a diffuse manner in the lane. And the control sequence 1 and the control sequence 2 have no obvious band, which indicates that the probe sample is effectively amplified, and the control sequence 1 and the control sequence 2 are not amplified, thereby verifying the principle of the experiment.

And detecting the amplified product by an atomic force microscope. 1ul of the amplification product of the probe sample was dropped on a mica plate and observed, and the amplification product was directly observed by an atomic force microscope, and the results are shown in FIG. 4. As can be seen from the figure, a large number of nucleic acid fragments differing in length appear, and in the field of view shown, the number of nucleic acid fragments longer is up to 1000nt or more. Experiments show that the probe effectively performs intramolecular nucleic acid amplification by taking the probe as a template and a primer to form a long amplification product, thereby verifying the principle of the experiments.

Example 2

Influence of nucleic acid melting reagent on nucleic acid intramolecular amplification reaction System since nucleic acid melting reagent has an action of promoting dynamic dissociation of nucleic acid, double-stranded nucleotide was changed into single-stranded nucleotide, first, in order to verify whether betaine has a promoting action on the present invention, betaine was added at different concentrations in this example, respectively, to verify, and intramolecular nucleic acid amplification was performed using a probe (sequence: AGAGGTAGTACTAGTACTCAAGAGGTAGTACTAGTAAGTTGCCTTCAGAACTCTACTACTACTAGTAC TACCTCT, SEQ ID NO. 1). The method comprises the following specific steps:

1) a23 uL reaction solution was prepared, and the other components were the same as those in the basic reaction solution except that betaine was not added. To the prepared reaction solution, a probe was added at 400 nmol/L.

2) Adding 2ul of betaine into the reaction solution prepared in the step 1), respectively preparing reaction solutions with final betaine concentrations of 0mol/L, 0.66mol/L,1mol/L,1.4mol/L,1.8mol/L and 2.2mol/L, and uniformly mixing;

The fluorescence intensity was measured by Shimadzu 2700 fluorescence spectrometer and the results are shown in FIG. 5, which shows that: the addition of betaine with different concentrations has certain influence on the reaction, and the addition of 0.6-1.4mol/L betaine can obviously accelerate the reaction speed as can be seen from the amplification result.

Similarly, nucleic acid melting reagents such as formamide, dimethyl sulfoxide, proline, etc. have been found to significantly increase the reaction rate.

Example 3

In this example, a probe is formed from a probe precursor, and a colorimetric method of nucleic acid intramolecular amplification is used to detect whether a sample to be tested contains a specific DNA target nucleic acid (taking DNA virus bocavirus as an example).

This example utilizes the bocavirus probe precursor (SEQ ID NO.4, sequence: GCCGGCAGACTTTACTTTTTTTTTTTTTTGCCGGCAGACTCCAATATGTCTGCCGGC), bocavirus sample 1 (sequence: GCCGGCAGACATATTGGATTCCAAGATGGCGTCTGTACAACC, SEQ ID NO.5), bocavirus control sequence sample 2(AGCTGCAGATGAGTTGGATTGGAAGAACCCGTGTGTTGTACA, SEQ ID NO. 6). Blank control sample 3 (water instead of detection nucleic acid sequence) tests the ability to detect DNA target nucleic acids by colorimetric method.

The method comprises the following specific steps:

1) preparing 23uL of basic reaction liquid, wherein 2.5umol/L of calcein green, 1.5mmol/L of manganese chloride and 400nmol/L of bocavir probe precursor are added;

2) respectively adding 2ul of 400nmol/L bocavir target (bocavir sample 1), control sequence sample (bocavir control sequence sample 2) and negative sample (blank control sample 3) into the reaction solution obtained in the step 1), and uniformly mixing;

3) the reaction is carried out at 65 ℃ for 2 hours by using a constant temperature facility (such as a water bath, a PCR instrument and the like).

The results are shown in FIG. 6. In sample No.1, which was the first sample to which the bocavirus target was added, a significant green fluorescence appeared, whereas the control sequence sample (bocavirus control sequence sample 2) and the negative sample (blank control sample 3) showed no significant fluorescence signal. Detecting the presence of the DNA virus bocavirus in a sample to be detected by a colorimetric method and a nucleic acid intramolecular amplification method.

Example 4

The probe is formed by the probe precursor, and whether the sample to be detected contains the specific DNA target (taking the DNA virus bocavirus as an example) is detected by a fluorescence resonance energy transfer method of nucleic acid intramolecular amplification.

The experiment utilizes a bocavirus probe precursor (sequence: GCCGGCAGACTTTACTTAAGCTGCGGATGCTTGCCGGCAGACTCCAATATGTCTGCCGGC, SEQ ID NO.4), a bocavirus sample 1 (sequence: GCCGGCAGACATATTGGATTCCAAGATGGCGTCTGTACAACC, SEQ ID NO.5), a bocavirus control sequence sample 2(AGCTGCAGATGAGTTGGATTGGAAGAACCCGTGTGTTGTACA, SEQ ID NO.6), a fluorescence resonance energy transfer probe 1 (sequence: CGGATGCTTGCCGGCAGA-FAM, SEQ ID NO.7, partially complementary to the sequence of the amplified probe b region), and a fluorescence resonance energy transfer probe 2 (sequence: BHQ1-TCTGCCGGCAA, SEQ ID NO.8, partially complementary to the fluorescence resonance energy transfer probe 1) to examine the ability of detecting DNA target nucleic acid by fluorescence resonance energy transfer. The method comprises the following specific steps:

1) preparing 23uL basic reaction liquid, and adding 400nmol/L bocavir probe precursor, 800nmol/L fluorescence resonance energy transfer probe 1 and 800nmol/L fluorescence resonance energy transfer probe 2;

2) respectively adding 2ul of 400nmol/L bocavir target and a comparison sequence (bocavir comparison sequence sample 2) into the reaction solution obtained in the step 1), and uniformly mixing;

When no target nucleic acid exists, the fluorescence resonance energy transfer probes 1 and 2 are close to each other, the fluorescence is extinguished, when the target nucleic acid exists, the fluorescence resonance energy transfer probe 1 is specifically combined with an amplification product, the fluorescence of the fluorescence resonance energy transfer probe is released, and a fluorescence signal rises. The fluorescence intensity results of the fluorescence was measured by Shimadzu 2700 fluorescence spectrometer, and are shown in FIG. 7. As can be seen from the figure, the bocavirus sample (DNA virus) had a significant fluorescence signal intensity, whereas the control sequence sample (NTC) had no significant fluorescence signal intensity.

Example 5

The probe is formed by the probe precursor, and whether the sample to be detected contains the specific RNA target (let 7a is taken as an example) is detected by a fluorescence method of nucleic acid intramolecular amplification.

The experiment was performed using the let7a probe precursor (SEQ ID NO.9, sequence: TGAGGTAGTAGAGATTGCTAGTCGTTTGAGGTAGTAATACAACC), let7a (sequence: UGAGGUAGUAGGUUGUAUAGUU, SEQ ID NO.10), and the control miRNA122 (sequence: UGGAGUGUGACAAUGGUGUUUG, SEQ ID NO.11) to test the ability to detect RNA target nucleic acids by fluorescence. The method comprises the following specific steps:

1) preparing a reverse transcription system of 17uL, wherein the concentration of each substance is as follows: 250mmol/L tris (hydroxymethyl) aminomethane (pH 8.5), 40mmol/L magnesium chloride, 150mmol/L potassium chloride, 5mmol/L dithiothreitol, 0.5mmol/L dNTPs, 500nmol/L probe precursor, 10U AMV reverse transcriptase;

2) respectively adding 3uL of let7a with the final concentration of 400nmol/L and a control sequence miRNA122 into the reaction solution in the step 1) to enable the final reaction volume to be 20uL, and uniformly mixing the reaction solution;

3) placing on a PCR instrument, and setting the reaction temperature to 42 ℃ for 1h and 85 ℃ for 5 min;

4) taking 2ul of the reactant in the step 3), and adding 23ul of basic reaction solution;

5) the PCR was detected by a Berle CFX96TM real-time fluorescent quantitative PCR instrument, and fluorescence signals were collected once per minute and subjected to isothermal amplification reaction at 60 ℃ with amplification results shown in FIG. 8. The results show that: within 2 hours, there was a significant increase in fluorescence signal for let7a target, whereas there was no increase in fluorescence signal for the control sequence miRNA122 sample. Thus, the RNA target can be effectively detected by using the method.

Example 6

Verification of anti-interference capability by intramolecular nucleic acid amplification method of probe precursor

To verify whether the method has good anti-interference capability, 1ul of total RNA extracted from liver tissue of a mouse is added to verify the anti-interference capability of the method in step 1 of example 5, and the rest steps are the same as those in example 5. The results are shown in FIG. 9. Compared with the detection result of the figure 8 without the total RNA added with interference, the result is not obviously different. Indicating that the addition of 1ul of total RNA extracted from liver tissue did not interfere with the amplification reaction.

Example 7

The single base difference detection capability of the present invention (let 7a for example). The single base difference detection ability of the present invention was verified by a fluorescence method using nucleic acid intramolecular amplification by forming a probe by ligation of nucleic acid fragments (let 7a is an example).

The let7a and the let7c only have single base difference, and the detection capability of the invention on the single base difference is verified by detecting the let7a and the let7 c. The experiment aims at a let7a target, two nucleic acid connecting fragments are designed, namely a nucleic acid connecting fragment 1 (sequence: TGAGGTAGTAGAGATTGCTAGTCGTTTGAGGTAGTAAACTATAC, namely SEQ ID NO.13) and a nucleic acid connecting fragment 2 (sequence: AACCTACTACCTCA, namely SEQ ID NO.14), and the capability of detecting single base difference is verified by using the target of let7a (sequence: UGAGGUAGUAGGUUGUAUAGUU, namely SEQ ID NO.10) and the control sequence of let7c (sequence: UGAGGUAGUAGGUUGUAUGGUU, namely SEQ ID NO.12, which is different from let7a in single base). The method comprises the following steps:

1) preparing a 20uL connection reaction system, wherein the concentration of each substance is as follows: 100mmol/L Tris-HCl (pH7.6),10mmol/L MgCl2,10mmol/L DTT,0.1mmol/L ATP,300nmol/L nucleic acid ligation fragment 1, 300nmol/L nucleic acid ligation fragment 2, 5U ligase;

2) adding 400nmol/L of let7a and let7c into the reaction solution obtained in the step 1.1), reacting for 1h, and inactivating to obtain let7a reaction solution or let7c reaction solution;

3) respectively taking 2ul of let7a reaction solution or let7c reaction solution, and respectively adding 23ul of basic reaction solution;

4) the detection is carried out by using a Berle CFX96TM real-time fluorescent quantitative PCR instrument, a fluorescent signal is collected once per minute, the amplification result is shown in figure 10, and the result shows that: within 2 hours, the let7a target showed a significant increase in fluorescence signal, whereas the control sequence let7c sample showed no increase in fluorescence signal. As can be seen from the figure, the nucleic acid connecting fragment 1 and the nucleic acid connecting fragment 2 are connected to form a probe under the condition that the target nucleic acid let7a exists, the probe is subjected to intramolecular nucleic acid amplification, and the nucleic acid connecting fragment can not be connected to form the probe under the condition that the control sequence let7c exists, and no amplification reaction occurs. Thereby achieving specific detection of the target nucleic acid let7 a.

Sequence listing

<110> university of Hunan

<120> a probe for nucleic acid intramolecular amplification and a method for detecting the same

<141> 2020-02-27

<160> 14

<170> SIPOSequenceListing 1.0

<210> 1

<211> 75

<212> DNA

<213> Artificial Synthesis ()

<400> 1

agaggtagta ctagtactca agaggtagta ctagtaagtt gccttcagaa ctctactact 60

actagtacta cctct 75

<210> 2

<211> 75

<212> DNA

<213> Artificial Synthesis ()

<400> 2

agaggtagta ctagtactca agaggtagta ctagtaagtt gccttcagaa ctctactact 60

acttcaacta ggact 75

<210> 3

<211> 75

<212> DNA

<213> Artificial Synthesis ()

<400> 3

tctgcaagta gctgtagtca agaggtagta ctagtaagtt gccttcagaa ctctactact 60

actagtacta cctct 75

<210> 4

<211> 57

<212> DNA

<213> Artificial Synthesis ()

<400> 4

gccggcagac tttacttttt tttttttttg ccggcagact ccaatatgtc tgccggc 57

<210> 5

<211> 42

<212> DNA

<213> Artificial Synthesis ()

<400> 5

gccggcagac atattggatt ccaagatggc gtctgtacaa cc 42

<210> 6

<211> 42

<212> DNA

<213> Artificial Synthesis ()

<400> 6

agctgcagat gagttggatt ggaagaaccc gtgtgttgta ca 42

<210> 7

<211> 18

<212> DNA

<213> Artificial Synthesis ()

<400> 7

cggatgcttg ccggcaga 18

<210> 8

<211> 11

<212> DNA

<213> Artificial Synthesis ()

<400> 8

tctgccggca a 11

<210> 9

<211> 44

<212> DNA

<213> Artificial Synthesis ()

<400> 9

tgaggtagta gagattgcta gtcgtttgag gtagtaatac aacc 44

<210> 10

<211> 22

<212> RNA

<213> Artificial Synthesis ()

<400> 10

ugagguagua gguuguauag uu 22

<210> 11

<211> 22

<212> RNA

<213> Artificial Synthesis ()

<400> 11

uggaguguga caaugguguu ug 22

<210> 12

<211> 22

<212> RNA

<213> Artificial Synthesis ()

<400> 12

ugagguagua gguuguaugg uu 22

<210> 13

<211> 44

<212> DNA

<213> Artificial Synthesis ()

<400> 13

tgaggtagta gagattgcta gtcgtttgag gtagtaaact atac 44

<210> 14

<211> 14

<212> DNA

<213> Artificial Synthesis ()

<400> 14

aacctactac ctca 14

Claims

1. A probe for intramolecular amplification of a nucleic acid molecule, wherein the nucleotide sequence of the probe comprises at least five regions (5 ') a-b-a-c-a (3 '), comprising two identical regions a, one at the 5 ' end and one in the middle; the b region is connected with two a regions, wherein one a region is connected with the 5 ' end of the b region at the 5 ' end, the other a region is connected with the 5 ' end of the c region, the c region is connected with the 5 ' end of the a region, the a region is the complementary nucleotide sequence of the a region and is at the 3 ' end of the probe;

the probe is a free nucleotide with a 3 'end concave and a 5' end containing a nucleotide sequence identical with the nucleotide sequence of the stem part; wherein, the sequence of the region a at the 3 'end is complementary and matched with the sequence of the region a in the middle of the probe to form a stem part, the sequence of the region c forms a ring part, and the region a and the region b at the 5' end have no complementary and matched nucleotides and are in a free state to form the tail part of the probe.

2. The probe for nucleic acid intramolecular amplification according to claim 1, wherein the probe performs nucleic acid intramolecular amplification by using itself as a template and a primer under the action of a polymerase;

the method comprises the following specific steps:

3. A probe for intramolecular amplification of a nucleic acid according to claim 1 or 2, wherein, when the nucleotide sequence is a DNA molecule, the polymerase is a polymerase having strand displacement activity but no exonuclease activity; when the nucleotide sequence is an RNA molecule, the polymerase is a reverse transcriptase or a polymerase having reverse transcription activity.

4. The probe for nucleic acid intramolecular amplification according to any one of claims 1 to 3, wherein the probe is synthesized directly by a company, or is formed by ligation of nucleic acid linker fragments, or is formed by extension of a probe precursor.

5. The probe for intramolecular amplification according to claim 4, wherein the probe precursor has a nucleotide sequence comprising at least four regions (5 ') a-b-a-c (3') comprising two identical regions a, one region a being linked at the 5 'end to the 5' end of region b, the other region a being linked at the 5 'end to region c, region b being linked to regions a, and region c being at the 3' end;

region a is the nucleotide sequence complementary to the 3' terminal region of the product of the precursor extension synthesis, b is the nucleotide sequence linking the two regions a, and c is the nucleotide sequence complementary to the target nucleic acid;

in the presence of the target nucleic acid, the precursor C region is extended to form a region a, and the formed C + a is dynamically dissociated from the target nucleic acid at the reaction temperature;

the a region formed by extending the precursor and the original a region sequence of the precursor are subjected to folding complementary pairing to form a probe, namely a 3 'end recess, and 5' contains free nucleotides with the same nucleotide sequence as the stem nucleotide sequence.

6. A method for detecting a target nucleic acid using a probe and a probe precursor, comprising the steps of:

(1) annealing the 3 'end c region of the probe precursor (5') a-b-a-c (3 ') to the region near the 5' end of the target nucleic acid;

(2) the polymerase takes the 3' end of the c region of the annealed precursor as a synthesis starting point and takes a region of the target nucleic acid which is not subjected to complementary pairing as a template to carry out synthesis reaction;

(3) the precursor extension product generated in the step (2) can be annealed at the reaction temperature and is dynamically dissociated from the target nucleic acid to form a probe, namely a 3' end recess; and the 5' end contains free nucleotides of the same nucleotide sequence as the stem nucleotide sequence;

(4) the probe formed in the step (3) is used for carrying out nucleic acid intramolecular amplification by taking the probe as a template and a primer under the action of polymerase, so that the nucleic acid amplification is realized;

(5) the presence of the target nucleic acid can be determined by detecting the amplification product with the added nucleic acid reagent.

7. The method of claim 6, wherein the dynamic dissociation of the nucleic acid is promoted by adding a nucleic acid melting reagent to the reaction system.

8. The method according to claim 7, wherein the nucleic acid melting reagent is at least one of betaine, formamide, dimethyl sulfoxide and proline.

9. The method for detecting a target nucleic acid using a probe or a probe precursor according to claims 6 to 8, wherein the detection of the amplification product is based on the addition of a nucleic acid reagent.

10. A kit comprising a probe precursor or nucleic acid linker fragment, which probe is generated and self-amplified in the presence of a target nucleic acid to generate a detection signal.