CN113308462B - A probe for intramolecular amplification of nucleic acid and its detection method - Google Patents

Abstract

A probe for intramolecular amplification of nucleic acid and a detection method, the probe for intramolecular amplification of nucleic acid of the present invention contains at least five regions of (5') a-b-a-c-a* (3'), Contains two identical a-regions, one at the 5' end and one in the middle; the b-region is connected to two a-regions, one of which is connected at the 5'-end to the 5'-end of the b-region, and the other a-region and c-region The 5' end of the c region is connected to the 5' end of the a* region, and the a* region is the complementary nucleotide sequence of the a region and is at the 3' end of the probe; the probe is under the action of polymerase. Templates and primers for intramolecular amplification of nucleic acids. In the present invention, the template and the primer are designed in one molecule, and the nucleic acid intramolecular amplification is realized by the same template, which effectively avoids the problem of false positives. The present invention also includes a method for detecting target nucleic acid using probes and probe precursors. The method can detect single base differences, has strong anti-interference ability, and has broad market prospects.

Description

A probe for intramolecular amplification of nucleic acid and its detection method

technical field

The invention belongs to a nucleic acid amplification method in the technical field of molecular biology, and in particular relates to a probe for intramolecular amplification of nucleic acid and a detection method.

Background technique

Today, molecular diagnosis and detection technology with nucleic acid amplification as the core has become a hot spot in academia and industry. At present, a series of nucleic acid amplification technologies have been developed one after another. These technologies can be divided into two types according to whether precise temperature control is required. The first type is variable temperature amplification, mainly including polymerase chain reaction (PCR) and ligase chain reaction (LCR) temperature-controlled amplification. In these amplification methods, the number of newly synthesized sequences is increased by repeated thermal cycling, but requires special and relatively expensive thermal cycling equipment. The second type accumulates specific sequences under isothermal conditions, such as strand displacement amplification (SDA), rolling circle amplification (RCA), transcription-dependent amplification system (TAS), nucleic acid sequence-dependent amplification (NASBA), Helicase-dependent gene amplification (HDA), single-primer isothermal amplification (SPIA), autonomous sequence replication (3SR), loop-mediated isothermal amplification (LAMP), CRISPR strand displacement amplification (CRISDA), etc. . In the above-mentioned amplification technology based on variable temperature and constant temperature, the template performs exponential or non-exponential amplification under the mediation of primers to achieve the purpose of specific sequence amplification. They basically include two stages: (1) target signal conversion process. Through various primers (such as PCR primers, LAMP primers, RCA ligation fragments, etc.), the target signal is converted into a template signal; (2) Amplification process. Under the mediation of primers, the template performs exponential or non-exponential amplification to achieve the purpose of specific sequence amplification. Each of these amplification techniques has its own innovation, which effectively achieves the purpose of repeating amplification of specific sequences. At present, the existing amplification technology has the ability to amplify a single target molecule millions of times for sensitive detection. However, the more serious problem currently faced is: the risk of false positives in the process of nucleic acid amplification. The main cause of false positives is the second stage of nucleic acid amplification, the amplification process stage. There are two main reasons: (1) The amplification reaction is a reaction between a template molecule and a primer molecule. Since the amplification yield is positively correlated with the amount of primers added. In the amplification system, more primer molecules than the template are often added. Excess free primer molecules may react to form dimers, resulting in false positives. (2) The templates used for amplification are different. Exponential or linear replication is performed using the constantly newly generated product as a template. During the replication process, especially in the early stage of amplification, a mismatch may cascade and cause false positives.

SUMMARY OF THE INVENTION

The technical problem to be solved by the present invention is to solve the deficiencies in the existing nucleic acid amplification technology, and to provide a probe and detection method for intramolecular amplification of nucleic acid, which can effectively reduce the false positives caused by the existing nucleic acid amplification. question.

The technical scheme adopted by the present invention to solve its technical problems is:

In the probe for intramolecular amplification of nucleic acid of the present invention, the nucleotide sequence of the probe contains at least five regions (5')a-b-a-c-a*(3'), and contains two identical a regions, one at the 5' end and one at the 5' end. In the middle; the b region is connected to two a regions, one of the a regions is connected to the 5' end of the b region at the 5' end, the other a region is connected to the 5' end of the c region, and the c region is connected to the 5' end of the a* region. End-to-end, the a* region is the complementary nucleotide sequence of the a region and is at the 3' end of the probe. (1) The probe is a free nucleotide whose 3' end is recessed and whose 5' end contains the same nucleotide sequence as the stem nucleotide sequence. The probe has a stem-loop structure, in which the a* region sequence at the 3' end is complementary to the a region sequence in the middle of the probe to form a stem portion, the c region sequence forms a loop portion, and the a region and b region at the 5' end have no complementary pairing. (2) Under the action of polymerase, the probe uses itself as a template and primer to perform intramolecular amplification of nucleic acid.

Under the action of polymerase, the probe uses itself as a template and primer to carry out intramolecular amplification of nucleic acid; the specific steps are as follows:

(1) Under the action of polymerase, the probe uses the a region and the b region without complementary pairing at the 5' end as the template, and the 3' end of the a* region at the 3' end as the synthesis starting point to synthesize its own the complementary strand;

(2) The polymer product obtained in step (1) undergoes dynamic dissociation and self-annealing at the reaction temperature, forming a probe structure again, that is, the 3' end is recessed, and the 5' end contains the same nucleotide as the stem a region. Free nucleotides, at this time, the loop portion of the newly generated probe structure has a specific nucleotide sequence b*-a* more than the loop portion of the original hairpin structure;

(3) Steps (1) and (2) are repeatedly cycled, and the loop portion of the hairpin structure is continuously expanded to obtain a nucleic acid amplification product, thereby realizing nucleic acid amplification.

There are various methods for synthesizing the probes of the present invention. It can be directly synthesized by the company, and can be formed by connecting nucleic acid linking fragments in the presence of target nucleic acid, or by extending probe precursors in the presence of target nucleic acid. There are a variety of probe precursors and nucleic acid ligation fragments that form probes.

The probe precursor is one of the ways to form the probe. The nucleotide sequence of the probe precursor contains at least four regions (5') a-b-a-c (3'), which contains two identical a regions and one a region. The 5' end is connected to the 5' end of the b region, another a region is connected to the 5' end of the c region, the b region is connected to the two a regions, and the c region is connected to the 3' end. (1) The a region is the nucleotide sequence complementary to the 3' end region of the precursor extension synthesis product, the b region is the nucleotide sequence connecting the two a regions, and the c region is the nucleotide sequence that is complementary to the target nucleic acid. Sequence; (2) In the presence of target nucleic acid, the precursor c region is polymerized and extended to form a* region, and the formed c+a* is dynamically dissociated from the target nucleic acid at the reaction temperature; (3) The a* formed by the extension of the precursor The region and the original a region sequence of the precursor are folded and complementary to form a probe, that is, the 3' end is recessed, and the 5' contains free nucleotides of the same nucleotide sequence as the stem nucleotide sequence.

The probe precursor for intramolecular amplification of the nucleic acid of the present invention contains at least four regions (5') a-b-a-c (3'), that is to say, the precursor is not limited to these four regions, but can also contain multiple signal detection regions. Under this design, the nucleic acid intramolecular amplification product has multiple detection methods, the detection is simpler, and the operation is more convenient.

The probe amplified in the nucleic acid molecule of the present invention contains at least five regions of (5')a-b-a-c-a*(3'), that is to say, the probe is not limited to these five regions, and can also contain multiple signals The nucleotide sequence of the detection method, under this design, the nucleic acid intramolecular amplification product has multiple detection methods, the detection is simpler, and the operation is more convenient.

The method for detecting target nucleic acid using probes and probe precursors of the present invention comprises the following steps:

(1) The 3'-end c region of the probe precursor (5') a-b-a-c (3') is annealed to the c* region of the target nucleic acid near the 5' end;

(2) The polymerase uses the 3' end of the annealed precursor c region as the synthesis starting point, and uses the a region of the target nucleic acid without complementary pairing as the template to carry out the synthesis reaction;

(3) The precursor extension product generated in step (2) can self-anneal at the reaction temperature and dynamically dissociate from the target nucleic acid to form a probe, that is, the 3' end is recessed, and the 5' contains a nucleotide sequence related to the stem Free nucleotides of the same nucleotide sequence;

(4) The probe formed in step (3), under the action of polymerase, uses the a region and the b region without complementary pairing at the 5' end of itself as the template, and the 3' end of the a* region at the 3' end is used as the template. For the synthesis starting point, synthesize its own complementary strand;

(5) The polymer product obtained in step (4) undergoes dynamic dissociation and self-annealing at the reaction temperature, forming a probe structure again, that is, the 3' end is recessed, and the 5' end contains the same nucleotide as the stem a region. For free nucleotides, the loop portion of the newly generated probe structure has a specific nucleotide sequence (b*-a*) more than the loop portion of the original hairpin structure.

(6) Steps (4) and (5) are repeatedly circulated, and the loop portion of the hairpin structure is continuously expanded to obtain nucleic acid amplification products, thereby realizing nucleic acid amplification;

(7) The presence of the target nucleic acid can be determined by detecting the amplified product by the added nucleic acid reagent.

The probe precursor of the present invention generates a probe through a reaction in the presence of a target nucleic acid. On the one hand, the template and the primer of the probe are in the same molecule. Under the action of the polymerase, the 5' end of the probe is used as a template, Using the 3' end as a primer, an intramolecular polymerization reaction occurs. On the other hand, each nucleic acid replication is based on the same template, avoiding the false positive problem caused by different primer-dimers and amplification templates in the traditional nucleic acid amplification reaction process.

The target nucleic acid nucleotide sequence in the present invention may be DNA or RNA.

When the nucleotide sequence is a DNA molecule, the polymerase is a polymerase with strand displacement activity, but without exonuclease activity. Such as Bst DNA polymerase, Bsm DNA polymerase, Bsu DNA polymerase, Klenow fragment 3'-5'exo-polymerase, DNA polymerase I, reverse transcriptase, phi29 DNA polymerase, or other polymerases with similar functions a kind of.

When the nucleotide sequence is an RNA molecule, the polymerase is a reverse transcriptase or a polymerase having reverse transcription activity.

Further, in the method for detecting target nucleic acid using probes and probe precursors, a nucleic acid melting reagent can be added to the system to promote dynamic dissociation of nucleic acids, so that double-stranded nucleotides are changed into single-stranded nucleotides. Such as betaine, formamide, dimethyl sulfoxide, proline, etc.

In the method for detecting target nucleic acid using probes and probe precursors, amplification products are detected based on the addition of nucleic acid reagents. Nucleic acid reagents include fluorescent detection reagents, colorimetric detection reagents, electrochemical detection reagents, chemiluminescence detection reagents, and the like.

The fluorescent detection reagents include reagents that can intercalate DNA to emit light, such as Eva Green, ethidium bromide, SYBR Green I, SYBR Green II, GoodView, etc., and also include fluorescence resonance energy transfer methods labeled with fluorescent groups and quenching groups. , molecular beacons, nucleic acid aptamers or nucleic acid aptamers, etc.

The fluorescence detection can be performed by using an instrument that can maintain a constant temperature and fluorescence scanning, such as Shimadzu 2700 fluorescence spectrometer; or can use an existing PCR instrument to perform the reaction at a constant temperature, such as Biole CFX96 fluorescence quantitative PCR instrument.

The colorimetric detection reagents include calcein colorimetric, nano-gold colorimetric, ABTS colorimetric and other reagents that can change color.

The electrochemical detection reagents include detection of oligonucleotides by electrochemical means, such as horseradish peroxidase electrochemical system, ruthenium terpyridine electrochemical system, and the like.

The chemiluminescence detection reagents include ruthenium bipyridine+TPA system, acridine lipid-hydrogen peroxide system and the like.

The term "dissociation" as used in this specification refers to the process by which double-stranded nucleotides become single-stranded nucleotides.

The term "self-folding complementary pairing" used in the present specification refers to the oligonucleotide itself containing complementary paired nucleotide sequences, and self-complementary base pairing occurs.

The term "hairpin" structure, also referred to as "stem-loop" structure, as used herein, refers to an oligonucleotide molecule that forms a secondary structure comprising a double-stranded region (stem), the double-stranded The stranded region is formed by two regions within the oligonucleotide molecule, which also include at least one "loop" structure, ie, a non-complementary nucleotide molecule (single-stranded region).

The term "3' recess" as used in this specification refers to the two ends of the hairpin structure, the 3' end and the 5' end, wherein the 3' end nucleotide sequence participates in forming the stem without free nucleotides, and the 5' end With free nucleotides, the entire hairpin is recessed at the 3' end.

The term "free nucleotides" as used herein refers to single-stranded nucleotides that have not undergone complementary pairing.

The probe precursor or nucleic acid linking fragment of the present invention can be made into a kit.

A kit, which contains probe precursors or nucleic acid linking fragments, in the presence of target nucleic acid, generates probes, and self-replicates to generate detection signals. The kit can detect single base differences, has strong anti-interference ability, and can effectively avoid the problem of false positives.

The present invention has the following advantages:

(1) Under the action of the polymerase, the probe uses the a region and the b region without complementary pairing at its 5' end as a template, and uses the a* region at the 3' end as a primer, an intramolecular polymerization reaction occurs, and there is no primer. The risk of dimerization is higher, and the specificity is higher;

(2) The probe uses itself as the template and the primer to undergo intramolecular polymerization reaction. This single-stranded replication mode is always replicated with the same template during the replication process, and the replication accuracy is better;

(3) In the detection process, only one probe precursor (or a nucleic acid connecting fragment that can form a probe) is required, and the four primers described in the LAMP method in the prior art are not required, the experimental design is simple, and the input cost is low.

In summary, the present invention provides a new probe for intramolecular amplification of nucleic acid, probe precursor, nucleic acid ligation fragment, and amplification method, which can detect single-base differences, have strong anti-interference ability, and can effectively avoid false positives. Positive question. The method can be applied in all fields requiring nucleic acid amplification, has broad market prospects and great economic and social benefits, and is suitable for wide-scale popularization and application.

Description of drawings

1 is a schematic diagram of the nucleic acid intramolecular amplification of the present invention;

Fig. 2 is the fluorescence signal diagram of the detection result of Example 1 of the present invention;

Fig. 3 is the electrophoresis signal diagram of the detection result of Example 1 of the present invention;

Fig. 4 is the AFM diagram of the detection result of the embodiment of the present invention 1;

Fig. 5 is the fluorescence signal diagram of the test result of betaine in the embodiment of the present invention 2;

Fig. 6 is the fluorescence signal diagram of the colorimetric detection result of embodiment 3 of the present invention;

Fig. 7 is the fluorescence signal diagram of the fluorescence method detection result of Example 4 of the present invention;

Fig. 8 is the fluorescence signal diagram of the detection result of the fluorescence method in Example 5 of the present invention;

Fig. 9 is the fluorescence signal diagram of the fluorescence method detection result of Example 6 of the present invention;

Fig. 10 is the fluorescence signal diagram of the detection result of the fluorescence method in Example 7 of the present invention;

Detailed ways

The present invention will be further described in detail below with reference to specific embodiments and accompanying drawings.

The basic reaction solution in the embodiment refers to the reaction solution of the amplification reaction, wherein each substance and concentration are: 200mmol/L tris(hydroxymethyl)aminomethane (pH 8.8), 100mmol/L potassium chloride, 100mmol/L L ammonium sulfate, 20mmol/L magnesium sulfate _, 1% (v/v) Tween 20, 1xEva Green dye, 4mmol/L magnesium chloride, 0.4mmol/L dNTPs, 8U BstDNA polymerase, 1.4mol/L betaine.

Example 1. The feasibility of the verification method and the correctness of its principle

In this example, the probe sequence containing the five regions (5')a-b-a-c-a*(3') described in the content of the invention was designed and synthesized directly by the company, and the nucleic acid intramolecular amplification reaction was performed (Figure 1). Verification method, electrophoresis result verification method and atomic force microscope result verification method are used to verify the feasibility of the method and the correctness of the principle. The sequence of the probe synthesized in this example is (AGAGGTAGTACTAGTACTCAAGAGGTAGTACTAGTAAGTTGCCTTCAGAACTCTACTACTACTAGT ACTACCTCT, namely SEQ ID NO. 1). At the same time, the control sequence 1 and the control sequence 2 of the probe were also synthesized. Sequence 1 is that the a* nucleotide sequence at the 3' end is replaced by other nucleotide sequences; the control sequence 2 (the sequence is TCTGCAAGTAGCTGTAGTCAAGAGGTAGTACTAGTAAGTTGCCTTCAGAACTCTACTACTACTAGTAC TACCTCT, that is, SEQ ID NO. 3), and the probe sequence (5')a-b-a-c-a*(3') ) compared to the control sequence 2, the a at the 5' end was replaced with other nucleotide sequences. The specific process is as follows:

1. Intramolecular nucleic acid amplification

1) prepare 23uL of basic reaction solution;

2) Take 2ul of 400nmol/L probe or control sequence 1 and control sequence 2, add them to the basic reaction solution prepared in step 1), make the final reaction solution volume 25uL, and mix the reaction solution evenly;

3) Use constant temperature facilities (such as water bath, PCR instrument, etc.) to carry out constant temperature amplification reaction at 65°C, and the reaction time is 2 hours.

4) Inactivation at 85°C to terminate the amplification reaction to obtain an amplification product.

①Detect the amplified product by fluorescence signal. The fluorescence intensity was detected by using a Shimadzu 2700 fluorescence spectrometer, and the results were shown (as shown in Figure 2). As can be seen from the figure, the probe samples designed and synthesized in this example had significant fluorescence signals, while the control sequence 1 (that is, the control probe in the figure) Needle 1) and the control sequence 2 (ie, the control probe 2 in the figure), the fluorescence signals did not increase significantly. It shows that a large amount of nucleic acid is produced in the probe sample designed and synthesized in this example, and the sample is effectively amplified. The stem without the 3' depression and the control sequence 1 and the control sequence 2 without the same nucleotides as the stem at the 5' end cannot be amplified effectively, thus verifying the principle of the experiment.

②Detect the amplified product by electrophoresis. A 6% denaturing polyacrylamide gel was prepared, the voltage was 100V, the electrophoresis time was 80 minutes, and the detection results were shown in Figure 3. The swimming lanes in the figure are from left to right: band 1 is the control sequence 1 sample band, band 3 is the probe sample band, band 4 is the control sequence 2 sample band, band 2 is the 2000bp DNA Marker band , it can be seen that the probe sample is amplified under the action of polymerase to produce many products, and the fragment size ranges from 60 nt to several thousand nt, and the imaging is diffusely arranged in the lane. The control sequence 1 and control sequence 2 have no obvious bands, indicating that the probe sample has been effectively amplified, while the control sequence 1 and control sequence 2 have not been amplified, which verifies the principle of the experiment.

③ Detection of amplified products by atomic force microscope. The amplification product of 1 ul of the probe sample was added dropwise to the mica sheet for observation, and the amplification product was directly observed by atomic force microscope. The results are shown in FIG. 4 . It can be seen from the figure that a large number of nucleic acid fragments of different lengths appear, and in the displayed field of view, the relatively long nucleic acid fragments reach more than 1000 nt. Experiments show that the probe can effectively carry out intramolecular nucleic acid amplification with itself as a template and primer, and form a long amplification product, thus verifying the principle of the experiment.

Example 2

Influence of nucleic acid melting reagents on nucleic acid intramolecular amplification reaction system Since nucleic acid melting reagents have the effect of promoting the dynamic dissociation of nucleic acids, making double-stranded nucleotides into single-stranded nucleotides, first, in order to verify the effect of betaine on the present invention Whether there is a promoting effect, in this example, betaine of different concentrations was added to verify, and a probe (sequence: AGAGGTAGTACTAGTACTCAAGAGGTAGTACTAGTAAGTTGCCTTCAGAACTCTACTACTACTAGTAC TACCTCT, i.e. SEQID NO.1) was used to carry out intramolecular nucleic acid amplification. Specific steps are as follows:

1) To prepare 23uL of reaction solution, except that betaine is not added, other components are the same as the basic reaction solution. Add 400 nmol/L probe to the prepared reaction solution.

2) Take 2ul betaine and add it to the reaction solution configured in step 1), and configure the final concentrations of betaine to be 0mol/L, 0.66mol/L, 1mol/L, 1.4mol/L, 1.8mol/L, 2.2mol/L respectively. The reaction solution, mix well;

3) Use constant temperature facilities (such as water bath, PCR instrument, etc.) to carry out constant temperature amplification reaction at 65°C, and the reaction time is 2 hours.

4) Inactivation at 85°C to terminate the amplification reaction to obtain an amplification product.

The fluorescence intensity was detected by Shimadzu 2700 fluorescence spectrometer. The results are shown in Figure 5. The results show that the addition of different concentrations of betaine has a certain effect on the reaction. It can be seen from the amplification results that the addition of 0.6-1.4mol/L betaine Betaine can significantly speed up the reaction.

Similarly, we found that nucleic acid melting reagents such as formamide, dimethyl sulfoxide, and proline can significantly speed up the reaction.

Example 3

In this example, a probe is formed from a probe precursor, and a colorimetric method of nucleic acid intramolecular amplification is used to detect whether the sample to be tested contains a specific DNA target nucleic acid (taking the DNA virus Boca virus as an example).

This example uses the boca virus probe precursor (sequence: GCCGGCAGACTTTACTTTTTTTTTTTTTTGCCGGCAGACTCCAATATGTCTGCCGGC, namely SEQ ID NO. 4), boca virus sample 1 (sequence: GCCGGCAGACATATTGGATTCCAAGATGGCGTCTGTACAACC, namely SEQ ID NO. 5), boca virus control sequence sample 2 ( AGCTGCAGATGAGTTGGATTGGAAGAACCCGTGTGTTGTACA, ie SEQ ID NO. 6). Blank control sample 3 (with water instead of detecting nucleic acid sequences) was tested for the ability to detect DNA target nucleic acids by colorimetry.

Specific steps are as follows:

1) prepare 23uL of basic reaction solution, add 2.5umol/L calcein green, 1.5mmol/L manganese chloride, and 400nmol/L boca virus probe precursor;

2) Take 2ul 400nmol/L of Boca virus target (Boca virus sample 1), control sequence sample (Boca virus control sequence sample 2), and negative sample (blank control sample 3), respectively, and add the reaction in step 1). liquid, mix well;

3) Use constant temperature facilities (such as water bath, PCR instrument, etc.) to react at 65°C, and the reaction time is 2 hours.

4) Inactivation at 85°C to terminate the amplification reaction to obtain an amplification product.

The test results are shown in Figure 6. In the first sample of Boca virus target No. 1, obvious green fluorescence appeared, while the control sequence sample (Boca virus control sequence sample 2) and the negative sample (blank control sample 3) had no obvious fluorescence signal. The DNA virus Bocavirus was detected in the sample to be tested by colorimetric method using nucleic acid intramolecular amplification method.

Example 4

A probe is formed from a probe precursor, and the fluorescence resonance energy transfer method of intramolecular amplification of nucleic acid is used to detect whether the sample to be tested contains a specific DNA target (take the DNA virus Boca virus as an example).

In this experiment, boca virus probe precursor (sequence: GCCGGCAGACTTTACTTAAGCTGCGGATGCTTGCCGGCAGACTCCAATATGTCTGCCGGC, namely SEQ ID NO. 4), boca virus sample 1 (sequence: GCCGGCAGACATATTGGATTCCAAGATGGCGTCTGTACAACC, namely SEQ ID NO. 5), boca virus control sequence sample 2 (AGCTGCAGATGAGTTGGATTGGAAGAACCCGTGTGTTGTACAACC) , namely SEQ ID NO.6), fluorescence resonance energy transfer probe 1 (sequence: CGGATGCTTGCCGGCAGA-FAM, namely SEQ ID NO.7, partially complementary to the amplified probe b region sequence), fluorescence resonance energy transfer probe 2 ( Sequence: BHQ1-TCTGCCGGCAA, ie SEQ ID NO. 8, partially complementary to FRET probe 1) to examine the ability to detect DNA target nucleic acid by FRET. Specific steps are as follows:

1) Prepare 23uL of basic reaction solution, add 400nmol/L bocavirus probe precursor, 800nmol/L FRET probe 1, 800nmol/L FRET probe 2;

2) respectively take 2ul 400nmol/L Boca virus target and control sequence (Boca virus control sequence sample 2), respectively add it to the reaction solution of step 1), and mix well;

3) Use constant temperature facilities (such as water bath, PCR instrument, etc.) to carry out constant temperature amplification reaction at 65°C, and the reaction time is 2 hours.

4) Inactivation at 85°C to terminate the amplification reaction to obtain an amplification product.

In the absence of the target nucleic acid, the fluorescence resonance energy transfer probes 1 and 2 are close to each other, and the fluorescence is extinguished. The fluorescence is released and the fluorescence signal rises. The fluorescence intensity was detected by Shimadzu 2700 fluorescence spectrometer as shown in Figure 7. It can be seen from the figure that the Boca virus sample (DNA virus) has obvious fluorescence signal intensity, while the control sequence sample (NTC) has no obvious fluorescence signal intensity.

Example 5

A probe is formed from a probe precursor, and a fluorescent method of nucleic acid intramolecular amplification is used to detect whether the sample to be tested contains a specific RNA target (take let7a as an example).

In this experiment, let7a probe precursor (sequence: TGAGGTAGTAGAGATTGCTAGTCGTTTGAGGTAGTAATACAACC, namely SEQ ID NO. 9), let7a (sequence: UGAGGUAGUAGGUUGUAUAGUU, namely SEQ ID NO. 10), control sequence miRNA122 (sequence: UGGAGUGUGACAAUGGUGUUUG, namely SEQ ID NO. 11) , to test the ability to detect RNA target nucleic acids by fluorescence. Specific steps are as follows:

1) prepare the reverse transcription system of 17uL, wherein each substance concentration is: 250mmol/L tris (hydroxymethyl) aminomethane (pH 8.5), 40mmol/L magnesium chloride, 150mmol/L potassium chloride, 5mmol/L dithiothreose Alcohol, 0.5mmol/LdNTPs, 500nmol/L probe precursor, 10U AMV reverse transcriptase;

2) Take 3ul of let7a and the control sequence miRNA122 with a final concentration of 400nmol/L respectively, add them to the reaction solution of step 1) respectively, make the final reaction volume be 20uL, and mix the reaction solution evenly;

3) Put it on the PCR machine, and set the reaction temperature to be 42°C for 1 hour and 85°C for 5 minutes;

4) take step 3) reactant 2ul and add 23ul basic reaction solution;

5) Use Biole CFX96TM real-time fluorescence quantitative PCR instrument for detection, collect fluorescent signals every minute, and perform constant temperature amplification reaction at 60 °C. The amplification results are shown in Figure 8. The results showed that: within 2 hours, the let7a target had a significant increase in the fluorescence signal, while the control sequence miRNA122 sample had no obvious increase in the fluorescence signal. It shows that the method can effectively detect RNA targets.

Example 6

Validation of anti-interference ability of an intramolecular nucleic acid amplification method by probe precursor

In order to verify whether the method has good anti-interference ability, in step 1 of Example 5, 1 ul of total RNA extracted from mouse liver tissue was added to verify the anti-interference ability of the method of the present invention, and the remaining steps were the same as the examples. 5 is the same. The test results are shown in Figure 9. Compared with the detection results of Figure 8 without the addition of interfering total RNA, the results were not significantly different. It shows that adding 1ul of total RNA extracted from liver tissue does not interfere with the amplification reaction.

Example 7

The single-base difference detection capability of the present invention (taking let7a as an example). The nucleic acid ligation fragments are connected to form a probe, and the fluorescence method of nucleic acid intramolecular amplification is used to verify the single-base difference detection ability of the present invention (taking let7a as an example).

Let7a and let7c only have a single base difference, and by detecting let7a and let7c, the detection ability of the present invention for single base difference is verified. In this experiment, two nucleic acid connecting fragments were designed for the let7a target. let7a (sequence: UGAGGUAGUAGGUUGUAUAGUU, namely SEQ ID NO. 10) and control sequence let7c (sequence: UGAGGUAGUAGGUUGUAUGGUU, namely SEQ ID NO. 12, single base difference with let7a), verify the ability of the present invention to detect single base difference. The specific method includes the following steps:

1) prepare 20uL ligation reaction system, wherein each substance concentration is: 100mmol/L Tris-HCl (pH7.6), 10mmol/L MgCl , 10mmol/L DTT, 0.1mmol/L ATP, 300nmol/L nucleic acid connecting fragment 1, 300nmol/L nucleic acid ligation fragment 2,5U ligase;

2) adding 400 nmol/L of let7a and let7c to the reaction solution obtained in step 1.1) respectively, ligating for 1 h and inactivating to obtain a let7a reaction solution or a let7c reaction solution;

3) respectively get the let7a reaction solution or let7c reaction solution of 2ul, respectively add 23ul basic reaction solution to it;

4) Use Biole CFX96TM real-time fluorescence quantitative PCR instrument for detection, and collect fluorescent signals every minute. The amplification results are shown in Figure 10. The results show that within 2 hours, the let7a target has a significant increase in the fluorescence signal, while the control sequence let7c sample has no obvious increase. Fluorescence signal rises. It can be seen from the figure that in the presence of the target nucleic acid let7a, the nucleic acid connecting fragment 1 and the nucleic acid connecting fragment 2 are connected to form probes, and the probes undergo intramolecular nucleic acid amplification, while in the presence of the control sequence let7c, they are connected to the nucleic acid. Fragments cannot be ligated to form probes, and no amplification reaction occurs. Thereby, the specific detection of target nucleic acid let7a is realized.

sequence listing

<110> Hunan University

<120> A probe for intramolecular amplification of nucleic acid and its detection method

<141> 2020-02-27

<160> 14

<170> SIPOSequenceListing 1.0

<210> 1

<211> 75

<212> DNA

<213> Synthetic()

<400> 1

agaggtagta ctagtactca agaggtagta ctagtaagtt gccttcagaa ctctactact 60

actagtacta cctct 75

<210> 2

<211> 75

<212> DNA

<213> Synthetic()

<400> 2

agaggtagta ctagtactca agaggtagta ctagtaagtt gccttcagaa ctctactact 60

acttcaacta ggact 75

<210> 3

<211> 75

<212> DNA

<213> Synthetic()

<400> 3

tctgcaagta gctgtagtca agaggtagta ctagtaagtt gccttcagaa ctctactact 60

actagtacta cctct 75

<210> 4

<211> 57

<212> DNA

<213> Synthetic()

<400> 4

gccggcagac tttacttttt ttttttttttg ccggcagact ccaatatgtc tgccggc 57

<210> 5

<211> 42

<212> DNA

<213> Synthetic()

<400> 5

gccggcagac atattggatt ccaagatggc gtctgtacaa cc 42

<210> 6

<211> 42

<212> DNA

<213> Synthetic()

<400> 6

agctgcagat gagttggatt ggaagaaccc gtgtgttgta ca 42

<210> 7

<211> 18

<212> DNA

<213> Synthetic()

<400> 7

cggatgcttg ccggcaga 18

<210> 8

<211> 11

<212> DNA

<213> Synthetic()

<400> 8

tctgccggca a 11

<210> 9

<211> 44

<212> DNA

<213> Synthetic()

<400> 9

tgaggtagta gagattgcta gtcgtttgag gtagtaatac aacc 44

<210> 10

<211> 22

<212> RNA

<213> Synthetic()

<400> 10

ugagguagua gguuguauag uu 22

<210> 11

<211> 22

<212> RNA

<213> Synthetic()

<400> 11

uggaguguga caaugguguu ug 22

<210> 12

<211> 22

<212> RNA

<213> Synthetic()

<400> 12

ugagguagua gguuguaugg uu 22

<210> 13

<211> 44

<212> DNA

<213> Synthetic()

<400> 13

tgaggtagta gagattgcta gtcgtttgag gtagtaaact atac 44

<210> 14

<211> 14

<212> DNA

<213> Synthetic()

<400> 14

aacctactac ctca 14

Claims (11)

1. a probe amplified in a nucleic acid molecule is characterized in that the nucleotide sequence of the probe contains at least five regions of (5') a-b-a-c-a* (3'), containing two identical a regions, one in The 5' end, one in the middle; the b region is connected to two a regions, one of the a regions is connected to the 5' end of the b region at the 5' end, the other a region is connected to the 5' end of the c region, and the c region is connected to the a region The 5' end of the * region is connected, and the a* region is the complementary nucleotide sequence of the a region and is at the 3' end of the probe; The probe is a 3'-end depression, and the 5'-end contains free nucleotides with the same nucleotide sequence as the stem nucleotide sequence; wherein, the a* region sequence at the 3'-end and the a region in the middle of the probe The complementary pairing of the sequences forms the stem, the sequence of the c region forms the loop, and the a region and the b region at the 5' end have no complementary nucleotides, which are in a free state and form the tail of the probe. 2. the probe of nucleic acid intramolecular amplification according to claim 1, is characterized in that, under the effect of polymerase, probe carries out nucleic acid intramolecular amplification with itself as template and primer; Specific steps are as follows: (1) Under the action of polymerase, the probe uses the a region and the b region without complementary pairing at the 5' end as the template, and the 3' end of the a* region at the 3' end as the synthesis starting point to synthesize itself. the complementary strand; (2) The polymer product obtained in step (1) undergoes dynamic dissociation and self-annealing at the reaction temperature, forming a probe structure again, that is, the 3' end is recessed, and the 5' end contains the same nucleotide as the stem a region. Free nucleotides, at this time, the loop portion of the newly generated probe structure has a specific nucleotide sequence b*-a* more than the loop portion of the original hairpin structure; (3) Steps (1) and (2) are repeatedly cycled, and the loop portion of the hairpin structure is continuously expanded to obtain a nucleic acid amplification product, thereby realizing nucleic acid amplification. 3. The probe for intramolecular amplification of nucleic acid according to claim 1 or 2, wherein when the nucleotide sequence is a DNA molecule, the polymerase has strand displacement activity, but does not have an exonuclease Active polymerase; when the nucleotide sequence is an RNA molecule, the polymerase is a reverse transcriptase or a polymerase with reverse transcription activity. 4. The probe for intramolecular amplification of nucleic acid according to any one of claims 1 to 3, wherein the probe is directly synthesized by a company, or formed by connecting nucleic acid connecting fragments, or extending from a probe precursor. to make. 5. The probe for intramolecular amplification of nucleic acid as claimed in claim 4, wherein the probe precursor, its nucleotide sequence contains at least four regions of (5') a-b-a-c (3'), and it contains two The same a region, one a region is connected to the 5' end of the b region at the 5' end, the other a region is connected to the 5' end of the c region, the b region is connected to the two a regions, and the c region is connected to the 3' end ; Region a is the nucleotide sequence complementary to the 3' end region of the precursor extension synthesis product, region b is the nucleotide sequence connecting the two regions a, region c is the nucleotide sequence that is complementary to the target nucleic acid; When the target nucleic acid exists, the precursor C region polymerizes and extends to form the a* region, and the formed c+a* dissociates dynamically from the target nucleic acid at the reaction temperature; The a* region formed by the extension of the precursor is folded and complementary to the original a region sequence of the precursor to form a probe, that is, the 3' end is recessed, and the 5' contains the same nucleotide sequence as the stem nucleotide sequence. Nucleotides. 6 . The probe for intramolecular amplification of nucleic acid according to claim 1 , wherein the number of nucleotides in the b region is 0. 7 . 7. The method for detecting target nucleic acid by probe and probe precursor, wherein the probe is the probe according to claim 1, and the probe precursor is the probe according to claim 5 or 6. Probe precursor; the detection method comprises the following steps: (1) The 3' end c region of the probe precursor (5') a-b-a-c (3') is annealed to the region near the 5' end of the target nucleic acid; (2) The polymerase uses the 3' end of the annealed precursor c region as the synthesis starting point, and uses the region where the target nucleic acid does not have complementary pairing as the template to carry out the synthesis reaction; (3) The precursor extension product generated in step (2) can self-anneal at the reaction temperature and dynamically dissociate from the target nucleic acid to form a probe, that is, the 3' end is recessed; and the 5' end contains nucleotides related to the stem. Free nucleotides of nucleotide sequences with the same sequence; (4) The probe formed in step (3), under the action of polymerase, the probe uses itself as a template and primer to carry out intramolecular amplification of nucleic acid to realize nucleic acid amplification; (5) The added nucleic acid reagent detects the amplification product, and the existence of the target nucleic acid can be judged. 8 . The method for detecting target nucleic acid using probes and probe precursors according to claim 7 , wherein a nucleic acid melting reagent is added to the reaction system to promote dynamic dissociation of nucleic acids. 9 . 9. the detection method that utilizes probe, probe precursor to target nucleic acid as claimed in claim 8, is characterized in that, nucleic acid melting reagent is betaine, formamide, dimethyl sulfoxide, proline in at least one. 10 . The method for detecting target nucleic acid using probes and probe precursors according to claim 7 , wherein the amplification products are detected based on the addition of nucleic acid reagents. 11 . 11. A kit, wherein the probe precursor described in claim 5 or 6, or the nucleic acid ligation fragment of the probe described in claim 1, in the presence of target nucleic acid, generates a probe, and automatically Amplification produces a detection signal.

Images