CN113278612A - TiRNA-Cys-GCA and application thereof in aortic dissection diseases - Google Patents

TiRNA-Cys-GCA and application thereof in aortic dissection diseases Download PDF

Info

Publication number
CN113278612A
CN113278612A CN202110562074.4A CN202110562074A CN113278612A CN 113278612 A CN113278612 A CN 113278612A CN 202110562074 A CN202110562074 A CN 202110562074A CN 113278612 A CN113278612 A CN 113278612A
Authority
CN
China
Prior art keywords
cys
gca
tirna
expression
cells
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN202110562074.4A
Other languages
Chinese (zh)
Other versions
CN113278612B (en
Inventor
于涛
王志斌
杨艳艳
纵婷雨
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Affiliated Hospital of University of Qingdao
Original Assignee
Affiliated Hospital of University of Qingdao
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Affiliated Hospital of University of Qingdao filed Critical Affiliated Hospital of University of Qingdao
Priority to CN202110562074.4A priority Critical patent/CN113278612B/en
Publication of CN113278612A publication Critical patent/CN113278612A/en
Application granted granted Critical
Publication of CN113278612B publication Critical patent/CN113278612B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00—Drugs for disorders of the cardiovascular system
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/5005—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
    • G01N33/5008—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
    • G01N33/502—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics for testing non-proliferative effects
    • G01N33/5029—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics for testing non-proliferative effects on cell motility
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/5005—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
    • G01N33/5008—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
    • G01N33/5044—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics involving specific cell types
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/11—Antisense
    • C12N2310/113—Antisense targeting other non-coding nucleic acids, e.g. antagomirs
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/158—Expression markers
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/178—Oligonucleotides characterized by their use miRNA, siRNA or ncRNA

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • Immunology (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biotechnology (AREA)
  • Physics & Mathematics (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • Medicinal Chemistry (AREA)
  • Analytical Chemistry (AREA)
  • Hematology (AREA)
  • Cell Biology (AREA)
  • Urology & Nephrology (AREA)
  • General Engineering & Computer Science (AREA)
  • Pathology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • General Physics & Mathematics (AREA)
  • Public Health (AREA)
  • Toxicology (AREA)
  • Food Science & Technology (AREA)
  • Veterinary Medicine (AREA)
  • Biophysics (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Heart & Thoracic Surgery (AREA)
  • Cardiology (AREA)
  • Plant Pathology (AREA)

Abstract

The invention relates to a TiRNA-Cys-GCA and application thereof in aortic dissection diseases. According to the invention, high-throughput sequencing analysis of thoracic aortic dissection clinical samples is taken as a basis, the regulation and control effects of the TiRNA-Cys-GCA on TAD animal models and clinic are researched, the effects and molecular mechanism of the TiRNA-Cys-GCA on VSMC are deeply researched in combination with cell and molecular levels, a new theoretical basis is provided for further perfecting the regulation and control mechanism of TAD generation and development, and a new molecular target is provided for clinical diagnosis and TAD treatment.

Description

TiRNA-Cys-GCA and application thereof in aortic dissection diseases
Technical Field
The invention belongs to the field of early diagnosis and treatment of aortic dissection diseases, and relates to a TiRNA-Cys-GCA and application thereof in aortic dissection diseases.
Background
Cardiovascular diseases (CVD) are one of the most serious diseases threatening human beings in the world today, and according to the summary of China Cardiovascular disease report 2018, the death rate of the disease accounts for more than 40% of the death component ratio of resident diseases, and exceeds the first death rate of tumors and other diseases. Meanwhile, the prevalence rate and the death rate of cardiovascular diseases are still on the rising trend, and the number of patients with cardiovascular diseases is expected to rapidly increase in the next 10 years. Among them, Aortic Dissection (AD) is one of the most aggressive cardiovascular diseases. The aortic valve is characterized in that blood in an aortic cavity enters an aortic media from an aortic intimal tear part to separate the media, and expands along the major axis direction of an aorta to form a separation state of true and false aortic walls. Aortic dissection mainly has two classification methods at present. The first is DeBakey type classification, which is classified into type I, type II and type III, wherein type I and type II laces are in ascending aorta, type I affects thoracic aorta even abdominal aorta, type II affects ascending main or aortic arch, type III laces are in descending aorta, lesion affects thoracic aorta or abdominal aorta, and in severe cases, thoracic aorta and abdominal aorta can be affected simultaneously. The second is Stanford typing, classified as a type a dissection (lesions involving the ascending aorta or aortic arch), usually treated by sternotomy, particularly in emergency surgery; type B dissections (abdominal aorta with lesions affecting or distant from the descending aorta) do not affect the ascending aorta, and usually involve medically conservative treatment unless the condition is complicated. Thus, Stanford type a is the most life-threatening subtype with the highest mortality rate. AD is a critical severe disease with rapid onset, rapid progress, complex and various manifestations, fierce course of disease, high mortality and poor prognosis in clinic. The incidence of AD is reported to be about 4-5/10 million people per year and is rising year by year, with the onset showing a trend towards younger people.
AD has various clinical manifestations, and the current clinical main treatment mode is to close intimal lacerations through operations and reconstruct blood flow in a blood vessel blocking area caused by a false cavity. However, the operative treatment has large trauma and a lot of complications, the incidence and the death rate of AD cannot be reduced fundamentally, and the death rate after only Stanford A type AD operation is about 21.1% according to the report of foreign big data. So far, the molecular regulation mechanism in the process of AD diseases at home and abroad is still unclear, the prevention strategy is limited, how to predict and intervene the occurrence of AD early, reduce the death rate and search for potentially important regulation factors become a medical problem to be solved urgently by scientific research personnel and clinical workers.
The regulatory mechanisms of non-coding nucleic acids for cardiovascular disease are currently the focus of research in the cardiovascular field. Among them, the tiRNAs & tRFs are a new discovered small non-coding RNA derived from tRNAs (Transfer RNAs ), which are precisely regulated and cleaved under different physiological and pathological conditions, and are considered to have important biomedical functions and to have potential association with diseases such as development and metabolism.
Disclosure of Invention
Aiming at the defects of the prior art, the invention provides a TiRNA-Cys-GCA, and the sequence of the TiRNA-Cys-GCA is shown as SEQ ID number 1.
SEQ ID NO.1：
5’-GCAGTCAAATGCTCTACCACTGAGCTATACCCCC-3’。
On the other hand, the invention also provides a TiRNA-Cys-GCA inhibitor, the sequence of which is shown as SEQ ID number 2.
SEQ ID NO. 2：
5’-GGGGGUAUAGCUCAGUGGUAGAGCAUUUGACUGC-3’
In another aspect, the invention also provides the application of the TiRNA-Cys-GCA in the diagnosis and/or treatment of aortic dissection diseases.
Further, the application of the TiRNA-Cys-GCA in STAT4 expression regulation.
Further, the application of the TiRNA-Cys-GCA in the diagnosis and/or treatment of aortic dissection diseases through regulation and control of STAT 4.
Further, the application of the TiRNA-Cys-GCA as a biomarker in the diagnosis of aortic dissection diseases.
Further, the application of the TiRNA-Cys-GCA in the treatment of aortic dissection diseases.
Further, the use of tiRNA-Cys-GCA to affect cell proliferation and/or migration. Wherein the cell may be a VSMC.
Further, the application of the TiRNA-Cys-GCA in the expression regulation of the contractile phenotype protein. The VSMC of the differentiation phenotype highly expresses contractile proteins, wherein the contractile proteins comprise alpha-SMA, CNN1 and MHC, and the over-expression of the TiRNA-Cys-GCA can more obviously promote the expression level of the contractile phenotype protein alpha-SMA.
On the other hand, the kit for diagnosing aortic dissection diseases takes the TiRNA-Cys-GCA as a detection target. The method is an RT-qPCR method and comprises SYBR Green reagent, cDNA and primer. The kit mainly comprises SYBR Green reagent, cDNA obtained by reverse transcription of tirRNA-Cys-GCA and primers (SEQ ID number 3: GCAGTCAAATGCTCTACCACTG). And (3) placing the reagent system in a real-time fluorescence PCR instrument, setting the reaction to be 95 ℃ for 5min, 95 ℃ for 10sec and 60 ℃ for 30sec, and circulating for 40 times, thus detecting the TiRNA-Cys-GCA and the expression level.
Has the advantages that:
according to the invention, high throughput sequencing analysis of a Thoracic Aortic Dissection (TAD) clinical sample is taken as a basis, the regulation and control effects of the TiRNA-Cys-GCA on a TAD animal model and clinic are researched, and the effects and molecular mechanisms of the TiRNA-Cys-GCA on Vascular Smooth Muscle Cells (VSMC) are deeply researched in combination with cell and molecular levels, so that a new theoretical basis is provided for further perfecting the regulation and control mechanism of TAD generation and development, and a new molecular target is provided for clinical diagnosis and treatment of TAD.
Drawings
FIG. 1A is a graph of the expression analysis and its quantitative analysis of 5' TIRNA-Cys-GCA in human normal aortic and aortic dissection samples.
FIG. 1B quantitative graph of expression analysis of 5' TIRNA-Cys-GCA in human normal aorta and aortic dissection samples.
FIG. 1C 5' TIRNA-Cys-GCA aorta sample expression analysis of healthy mice and aortic dissection model mice.
FIG. 1D 5' TIRNA-Cys-GCA expression analysis in ox-LDL time-gradient treated vascular smooth muscle cells.
FIG. 2A is a graph of transfection efficiency for overexpression of 5' TIRNA-Cys-GCA.
FIG. 2B is a diagram of cell proliferation after 5' TiRNA-Cys-GCA overexpression in vascular smooth muscle cells was detected by CCK8 assay.
FIG. 2C is a graph and a quantitative analysis graph of cell proliferation after detecting 5' TiRNA-Cys-GCA overexpression of vascular smooth muscle cells by an EdU experiment.
FIG. 2D is a graph of scratch assay for cell migration after 5' TiRNA-Cys-GCA overexpression in vascular smooth muscle cells.
FIG. 2E is a graph of cell migration and quantitative analysis after detecting 5' TiRNA-Cys-GCA overexpression in vascular smooth muscle cells by Transwell assay.
FIG. 2F is a graph of western blotting for detecting the expression level and quantitative analysis of the contraction marker protein after 5' TiRNA-Cys-GCA is over-expressed in vascular smooth muscle cells.
FIG. 3A is a graph of transfection efficiency with knockdown of 5' TIRNA-Cys-GCA.
FIG. 3B is a diagram of CCK8 assay for cell proliferation after 5' TIRNA-Cys-GCA knockdown in vascular smooth muscle cells.
FIG. 3C is a graph and a quantitative analysis graph of cell proliferation after detecting 5' TiRNA-Cys-GCA knockdown of vascular smooth muscle cells by EdU assay.
FIG. 3D is a graph of scratch assay for detecting cell migration after 5' TIRNA-Cys-GCA is knocked down by vascular smooth muscle cells.
FIG. 3E is a graph of cell migration and quantitative analysis after detecting 5' TiRNA-Cys-GCA knockdown by vascular smooth muscle cells by the Transwell experiment.
FIG. 3F is a graph of western blotting for detecting the expression level and quantitative analysis of the contraction marker protein after the 5' TiRNA-Cys-GCA is knocked down by vascular smooth muscle cells.
FIG. 4A GO and KEGG enrichment analysis predicts the three target gene maps of 5' TIRNA-Cys-GCA predicted by pull-down experiments.
FIG. 4B pull-down experiment detects the interaction pattern between 5' TiRNA-Cys-GCA and STAT4 in vascular smooth muscle cells.
FIG. 4C is a dot-plot of binding sites between 5' TIRNA-Cys-GCA and STAT 4.
FIG. 4D RT-qPCR assay of the regulatory effect of 5' TIRNA-Cys-GCA on STAT 4.
FIG. 4E Western blotting graph and quantitative analysis graph for detecting STAT4 regulation and control effect of 5' TiRNA-Cys-GCA.
FIG. 4F is a graph of the binding and regulation effect of 5' TIRNA-Cys-GCA on STAT4 using dual luciferase reporter gene.
FIG. 5A is a graph of transfection efficiency and quantitation of knockdown STAT4 by western blotting assays.
FIG. 5B is a graph of expression and quantitation of STAT4 protein using western blotting for detection of 5' TIRNA-Cys-GCA overexpression and knockdown.
FIG. 5C is a graph of 5' TIRNA-Cys-GCA overexpression and knockdown using CCK-8 to detect proliferation of vascular smooth muscle cells.
FIG. 5D is a graph and a quantitative analysis of the proliferation of vascular smooth muscle cells at 0, 12, 24 and 36h using EdU staining for 5' TIRNA-Cys-GCA overexpression and knockdown.
FIG. 5E is a graph of 5' TIRNA-Cys-GCA overexpression and knockdown, using scratch assay, to examine vascular smooth muscle cell migration at 0, 12, 24, and 36 h.
FIG. 5F is a graph of 5' TIRNA-Cys-GCA overexpression and knockdown, and a graph of migration and quantitative analysis of vascular smooth muscle cells using a transwell assay.
FIG. 5G is a graph of overexpression and knock-down of 5' TiRNA-Cys-GCA, detection of expression levels of contraction marker proteins using western blotting and quantitative analysis.
FIG. 6A is a schematic diagram of aortic dissection mouse model constructed and tail vein injection of 5' TiRNA-Cys-GCA agomir.
Figure 6B measures mouse mortality and plots survival for each group of mice.
FIG. 6C graph of RT-qPCR detection of 5' TiRNA-Cys-GCA expression in aorta obtained from different groups of mice.
Figure 6D observes the general characteristics of isolated aorta of mice from different groups.
FIG. 6E H & E staining images of the thoracic aorta of different groups of mice.
FIG. 6F is a graph of the quantitative results of the membrane thickness/lumen diameter ratio.
Figure 6G immunohistochemical detection STAT4 expression level in aorta of mice of different groups.
Detailed Description
Experimental example 1: differential expression and cellular localization of 5' tiRNA-Cys-GCA in vivo and in vitro
Fluorescence in situ hybridization assay detected that 5' tiRNA-Cys-GCA was most likely located in VSMC (fig. 1A).
The cell positioning condition of 5 ' -TIRNA-Cys-GCA in a normal arteriole and thoracic aorta interlayer sample is detected by utilizing a fluorescence in situ hybridization experiment, the result is shown in figure 1A, and the result shows that the 5 ' -TIRNA-Cys-GCA and alpha-SMA (alpha smooth muscle actin) are co-positioned, and the alpha-SMA is an important protein marker of VSMC, so that the 5 ' -TIRNA-Cys-GCA is most probably positioned in the VSMC and probably has close relation with the VSMC and plays a certain role in regulating and controlling the functions of the VSMC.
RT-qPCR detection found that 5' tirRNA-Cys-GCA expression in human aortic dissection samples was significantly lower than in normal arteriole samples (FIG. 1B).
RT-qPCR is utilized to detect the expression condition of 5 ' TiRNA-Cys-GCA in normal small artery and human thoracic aorta interlayer samples, the result is shown in figure 1B, and the result shows that the expression of 5 ' TiRNA-Cys-GCA in human aorta interlayer samples is obviously lower than that of normal small artery samples, and the 5 ' TiRNA-Cys-GCA is prompted to possibly play a protective role in lesion samples.
RT-qPCR assays found 5' TiRNA-Cys-GCA expression in TAD model mice to be about 2.5-fold lower than control mice (FIG. 1C).
Detecting the expression condition of 5' tirRNA-Cys-GCA in a TAD model mouse by RT-qPCR, wherein the model construction method comprises the following steps: the mice in the control group were injected intraperitoneally with angiotensin II (AngII) 4.0mg/kg/8h in combination with beta-aminopropionitrile (BAPN) 0.33g/kg/d for 14 days, and with the same amount of physiological saline. The results are shown in FIG. 1C and demonstrate that 5' TiRNA-Cys-GCA expression levels in aortic samples from TAD model mice were approximately 2.5-fold lower than in control mice. The results show that the expression level of 5 'tirRNA-Cys-GCA in TAD tissues is reduced, and the 5' tirRNA-Cys-GCA can possibly become a biomarker of thoracic aortic dissection and has important value in disease diagnosis.
RT-qPCR assay found decreased expression of 5' TIRNA-Cys-GCA in ox-LDL (oxidatively modified low density lipoprotein) -treated cells (FIG. 1D).
According to literature search, we know that ox-LDL can promote phenotypic conversion of VSMC, therefore, the expression of 5 'tirRNA-Cys-GCA in VSMC which is induced by ox-LDL and has phenotypic conversion is detected by RT-qPCR, and the result is shown in figure 1D, and the result shows that the expression of 5' tirRNA-Cys-GCA shows a time-dependent descending trend after 0, 6, 12, 24 and 36 hours when VSMC under a normal growth state is treated by using certain concentration of ox-LDL (100 mu g/mL). In an in vitro experiment, ox-LDL is used as a pathological condition to simulate a pathological environment, and in order to detect that the expression quantity of 5 'TiRNA-Cys-GCA is less and less along with the time progress of the pathological condition, the 5' TiRNA-Cys-GCA is further suggested to play a protective role.
Experimental example 2: overexpression of 5' TiRNA-Cys-GCA inhibits proliferation, migration and phenotypic switching of VSMCs in vitro
RT-qPCR assay found elevated expression of 5 'TiRNA-Cys-GCA in 5' TiRNA-Cys-GCA mock (mimic) transfected cells (FIG. 2A).
The expression condition of the 5 ' TiRNA-Cys-GCA in the cells transfected with the 5 ' TiRNA-Cys-GCA mimics is detected by RT-qPCR, and the result is shown in FIG. 2A, which shows that the expression of the 5 ' TiRNA-Cys-GCA is increased, namely the 5 ' TiRNA-Cys-GCA mimics are successfully constructed and expressed in the cells, and further used for detecting the cell functions by the 5 ' TiRNA-Cys-GCA.
CCK-8 assay showed that the proliferation capacity of cells overexpressing 5' TiRNA-Cys-GCA mimic was inhibited (FIG. 2B).
The migration capacity of cells overexpressing 5 'tiRNA-Cys-GCA mimetics was examined using CCK-8 and the results are shown in fig. 2B, which demonstrates that VSMC proliferation capacity is inhibited after overexpression of 5' tiRNA-Cys-GCA.
EdU assay detection revealed that the proliferative capacity of cells overexpressing 5' TiRNA-Cys-GCA mimetics was inhibited (FIG. 2C).
The migration capacity of cells overexpressing 5 'tiRNA-Cys-GCA mimetics was examined using EdU experiments, and the results are shown in fig. 2C, which demonstrates that VSMC proliferation capacity is inhibited after overexpression of 5' tiRNA-Cys-GCA.
The cells that over-expressed the 5' TiRNA-Cys-GCA mimic were found to be inhibited in their migratory capacity by scratch assay (FIG. 2D).
The migration ability of 5 'tiRNA-Cys-GCA mimetic cells was examined by scratch assay and the results are shown in fig. 2D, which shows that the proliferation ability of VSMC was inhibited after 5' tiRNA-Cys-GCA overexpression.
The cell migration ability of the 5' TiRNA-Cys-GCA mimic over-expressed was shown to be inhibited by Transwell assay (FIG. 2E).
The migration ability of 5 'tiRNA-Cys-GCA mimetic over-expressed cells was examined using the Transwell assay, and the results are shown in fig. 2E, which demonstrates that the migration ability of VSMC was inhibited after 5' tiRNA-Cys-GCA over-expression.
Western blot experimental detection revealed that the expression of contractile phenotype proteins in the cells overexpressing the 5' TiRNA-Cys-GCA mimic was significantly increased (FIG. 2F).
Western blot experiments were used to examine the expression of contractile phenotype proteins in cells overexpressing 5 'TiRNA-Cys-GCA mimetics, and the results are shown in FIG. 2F, which demonstrates that expression of contractile phenotype proteins, particularly α -SMA, was significantly increased after overexpression of 5' -TiRNA-Cys-GCA, while troponin 1 (CNN 1) and smooth muscle myosin heavy chain (SMHC) were not significantly changed.
Experimental example 3: knock-down of 5' tiRNA-Cys-GCA promotes proliferation, migration and phenotypic switching of VSMCs in vitro
RT-qPCR assays found reduced expression of 5 ' TiRNA-Cys-GCA in cells transfected with 5 ' TiRNA-Cys-GCA inhibitors (also known as inhibitors, sequence specific and chemically modified to specifically target and knock out 5 ' TiRNA-Cys-GCA molecules) (FIG. 3A).
The expression of 5 'tirRNA-Cys-GCA in cells transfected with 5' tirRNA-Cys-GCA inhibitor was detected by RT-qPCR, and the results are shown in FIG. 3A, which shows that the expression of 5 'tirRNA-Cys-GCA is reduced, i.e., the expression of 5' tirRNA-Cys-GCA inhibitor in cells is successfully inhibited.
CCK-8 assay showed that cell proliferation was promoted following knockdown of 5' TIRNA-Cys-GCA (FIG. 3B).
The migration capacity of the cells after the 5 'tirRNA-Cys-GCA is knocked down is detected by using CCK-8, and the result is shown in figure 3B, which shows that the proliferation capacity of the VSMC is obviously promoted after the 5' tirRNA-Cys-GCA is knocked down.
The proliferation capacity of the cells was promoted after knock-down of 5' tiRNA-Cys-GCA as detected by EdU assay (fig. 3C).
The migration capacity of the cells after the 5 'tirRNA-Cys-GCA is knocked down is detected by using an EdU experiment, and the result is shown in figure 3C, which shows that the proliferation capacity of the VSMC is obviously promoted after the 5' tirRNA-Cys-GCA is knocked down.
The cell migration capacity was promoted following knock-down of 5' tiRNA-Cys-GCA as detected by the scratch test (fig. 3D).
The migration ability of the cells after the 5 'tirRNA-Cys-GCA knock-down was examined by scratch assay, and the results are shown in FIG. 3D, which demonstrates that the proliferation ability of VSMC was promoted after the 5' tirRNA-Cys-GCA knock-down.
The cell migration capacity was promoted after knockdown of 5' TiRNA-Cys-GCA as detected by the Transwell assay (FIG. 3E).
The migration ability of the cells after the 5 'tirRNA-Cys-GCA knock-down was examined by using a Transwell experiment, and the results are shown in FIG. 3E, which shows that the migration ability of VSMC was promoted after the 5' tirRNA-Cys-GCA knock-down.
Western blot assay detection revealed significant reduction in expression of contractile phenotype proteins in cells knocked-down for 5' TiRNA-Cys-GCA (FIG. 3F).
The expression of contractile phenotype proteins in cells knocked-down for 5 'tiRNA-Cys-GCA was examined using a Western blot experiment and the results are shown in fig. 3F, which demonstrates that expression of contractile phenotype proteins, particularly α -SMA, was significantly reduced after knock-down for 5' -tiRNA-Cys-GCA, whereas troponin 1 (CNN 1) and smooth muscle myosin heavy chain (SMHC) were not significantly changed.
Experimental example 4: direct 5' TiRNA-Cys-GCA binding and downregulation of STAT4
The bioassay predicted 153 downstream targets of 5' tiRNA-Cys-GCA (fig. 4A).
The results of the studies of 5' tiRNA-Cys-GCA on VSMC functional regulation using KEGG and GO are shown in fig. 4A, which illustrates that the confirmatory analysis predicts a total of 153 direct downstream targets.
Pull down assay found significant binding Pull down of STAT4, PCNP and CRISPLD 23 downstream by 5' TIRNA-Cys-GCA (FIG. 4B).
The downstream target of the above 5' tiRNA-Cys-GCA was screened using the Pull down assay, and the results are shown in fig. 4B, which demonstrates that only 9 were associated with cell proliferation or migration as shown by functional analysis of 153 predicted targets. Furthermore, only three predicted targets, STAT4, PCNP and CRISPLD2, were found to be significantly pulled down by 5' tiRNA-Cys-GCA binding.
The messenger predicted the predicted binding site between 5' tiRNA-Cys-GCA and STAT4 (fig. 4C).
The results of the analysis of the predicted binding sites between 5' tiRNA-Cys-GCA and STAT4 using miRanda and TargetScan software are shown in fig. 4C, where the structure score, free energy and Context + values are 145, -24.79 and-0.303, respectively. Further analysis of 5' tiRNA-Cys-GCA and STAT4 binding showed high conservation in humans, mice and rats.
RT-qPCR assay revealed that STAT4 expression was regulated by 5' TIRNA-Cys-GCA (FIG. 4D).
The expression condition of STAT4 in 5 ' TiRNA-Cys-GCA over-expressed and knocked-down cells is detected by RT-qPCR, the result is shown in figure 4D, and the result shows that STAT4 expression is reduced in the 5 ' TiRNA-Cys-GCA over-expressed cells, and STAT4 expression is increased in the 5 ' TiRNA-Cys-GCA knocked-down cells.
Western blot experiment detection shows that the expression of STAT4 is regulated and controlled by 5' tirRNA-Cys-GCA (FIG. 4E).
The expression condition of STAT4 in 5 ' TiRNA-Cys-GCA over-expressed and knocked-down cells is detected by using a Western blot experiment, the result is shown in FIG. 4E, and the result shows that STAT4 expression is reduced in the 5 ' TiRNA-Cys-GCA over-expressed cells, and STAT4 expression is increased in the 5 ' TiRNA-Cys-GCA knocked-down cells.
The dual luciferase reporter assay results confirmed the binding sites of 5' -TIRNA-Cys-GCA and STAT4 (FIG. 4F)
The binding sites of 5 ' -TiRNA-Cys-GCA and STAT4 are verified by using the dual luciferase reporter gene, and the results are shown in FIG. 4F, and the results show that the fluorescence intensity of the wild-type luciferase reporter plasmid for over-expressing 5 ' -TiRNA-Cys-GCA and transfected STAT4 is remarkably reduced, while the mutation group has no obvious change, namely the results of the binding sites of 5 ' -TiRNA-Cys-GCA and STAT4 are consistent with the results of the binding sites predicted by generation.
Experimental example 5: STAT4 regulates ox-LDL induced VSMC proliferation, migration and phenotype switching by 5' TIRNA-Cys-GCA
The expression of STAT4 in the knockdown STAT4 cells was found to be inhibited by Western blot assay (FIG. 5A).
The expression condition of STAT4 in the knockdown STAT4 cells is detected by using a Western blot experiment, the result is shown in FIG. 5A, and the result shows that the expression of STAT4 protein in the cells is obviously reduced by synthesizing siRNA (si-STAT 4) aiming at STAT4 and transfecting the siRNA into VSMC for 24h, namely si-STAT4 is successfully constructed.
Western blot assay found that STAT4 was regulated by 5' TiRNA-Cys-GCA in ox-LDL treated cells (FIG. 5B).
A Western blot experiment is utilized to detect the expression condition of STAT4 in 5 ' tirRNA-Cys-GCA cells through overexpression and knockdown in ox-LDL processing cells, the result is shown in figure 5B, and the result shows that STAT4 is increased in ox-LDL processing cells, further increased after knockdown of 5 ' tirRNA-Cys-GCA, and obviously inhibited after 5 ' tirRNA-Cys-GCA is overexpressed.
CCK-8 assay found that in ox-LDL treated cells, the proliferative capacity of the cells was enhanced after knockdown of STAT4 (FIG. 5C).
The result of the test of the migration ability of the cells after the STAT4 knock-down by CCK-8 is shown in FIG. 5C, and the result shows that the proliferation ability of the cells after the STAT4 knock-down is obviously promoted in the ox-LDL treated cells.
EdU assay tests found that the proliferative capacity of cells was promoted following knockdown of STAT4 in ox-LDL treated cells (FIG. 5D).
The migration capacity of the cells after STAT4 knockdown was examined by EdU assay, and the results are shown in FIG. 5D, which demonstrates that the proliferation capacity of the cells after STAT4 knockdown was significantly promoted in ox-LDL treated cells.
Scratch assay tests found that in ox-LDL treated cells, the ability of the cells to migrate was promoted following STAT4 knock-down (fig. 5E).
The migration capacity of the cells after STAT4 knockdown was examined by a scratch test, and the results are shown in FIG. 5E, which shows that the migration capacity of the cells after STAT4 knockdown was significantly promoted in ox-LDL treated cells.
The Transwell assay found that the migration capacity of cells was promoted following knockdown of STAT4 in ox-LDL treated cells (FIG. 5F).
The results of the Transwell experiment for detecting the migration ability of the cells after knocking down STAT4 in ox-LDL treated cells are shown in FIG. 5F, and the results show that the migration ability of the cells after knocking down STAT4 in ox-LDL treated cells is obviously promoted.
Western blot assay detection revealed significant reduction in expression of contractile phenotype proteins in cells knocked-down for 5' TiRNA-Cys-GCA (FIG. 5G).
Western blot experiment is used for detecting the expression condition of the contractile phenotype protein in the cells after STAT4 is knocked down in ox-LDL treated cells, and the result is shown in figure 5G, and the result shows that the expression of the contractile phenotype protein is obviously reduced after STAT4 is knocked down in ox-LDL treated cells, and particularly, alpha-SMA, CNN1 and SMHC are not obviously changed.
Experimental example 6: overexpression of 5' tirRNA-Cys-GCA reversed the progression in TAD mice
The mapping software plots a model map for constructing the aortic dissection mouse model (fig. 6A).
The construction process of aortic dissection mouse model was demonstrated using mapping software, and the results are shown in fig. 6A.
The imageJ software calculated the mortality of each group of mice (fig. 6B).
Mortality for each group of mice was calculated and plotted using imageJ software, and the results are shown in figure 6B.
RT-qPCR experimental detection shows that the expression of 5' TiRNA-Cys-GCA of TAD model mice is obviously lower than that of a control group (figure 6C).
RT-qPCR is used for detecting the expression condition of the 5 'tirRNA-Cys-GCA in each group of mice, and the result is shown in figure 6C, and the result shows that the expression of the 5' tirRNA-Cys-GCA of the TAD model mice is obviously lower than that of the control group. However, after injecting agomir (agomir is a double-stranded small RNA which is specially marked and chemically modified, regulates the biological function of a target gene by simulating endogenous 5 ' tirRNA-Cys-GCA, is a mimic of 5 ' tirRNA-Cys-GCA, is more suitable for an in vivo interference experiment of an animal, has higher stability in an in vivo experiment, can be administered by adopting various modes such as systemic injection or local injection, and is simple and convenient to operate), the expression of 5 ' tirRNA-Cys-GCA in a TAD model mouse is reversed.
Gross sample examination revealed significant dissection in the aortic dissection mouse model (fig. 6D).
Gross samples were used to detect dissections in aortic samples from each group of mice, and the results are shown in fig. 6D, which shows that TAD model mice were successfully constructed 14 days after intraperitoneal injection of angiotensin ii (angii) and β -aminopropionitrile (BAPN). Moreover, the interlayer cracking in the damage + agomir group was significantly improved.
The hematoxylin and eosin experiments tested that the media of the injured group was significantly thickened, but the media thickness was significantly reduced after the treatment with agomir (fig. 6E).
The mesenteric thickness of the aorta of each group of mice was measured by hematoxylin and eosin experiments, and the results are shown in fig. 6E, which shows that the tunica media of the blood vessels of the injured group are obviously thickened, but the tunica media thickness of the blood vessels is obviously reduced after the treatment of the agomir.
The mapping software quantified the aortic mesomembrane to luminal ratio for each group of mice (fig. 6F).
The ratio of the tunica media to the lumen of the aorta of each group of mice was calculated and generated using mapping software, and the results are shown in fig. 6F.
The immunohistochemical examination of STAT4 expression was significantly increased in TAD tissues, whereas STAT4 expression was inhibited after agomir treatment (fig. 6G).
The expression of STAT4 in the aorta of each group of mice was detected by immunohistochemical experiments, and the results are shown in FIG. 6G, which shows that STAT4 expression in TAD tissues is remarkably increased, and STAT4 expression is inhibited after the treatment of agomir.
Sequence listing
<110> affiliated Hospital of Qingdao university
<120> TiRNA-Cys-GCA and application thereof in aortic dissection diseases
<160> 3
<170> SIPOSequenceListing 1.0
<210> 1
<211> 34
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
gcagtcaaat gctctaccac tgagctatac cccc 34
<210> 2
<211> 34
<212> RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
ggggguauag cucaguggua gagcauuuga cugc 34
<210> 3
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
gcagtcaaat gctctaccac tg 22

Claims (9)

1. A TiRNA-Cys-GCA has a sequence shown as SEQ ID number 1.
2. The use of a tiRNA-Cys-GCA according to claim 1 in the diagnosis and/or treatment of aortic dissection disease.
3. The use of a tiRNA-Cys-GCA according to claim 1 for the modulation of STAT4 expression.
4. The use of a tiRNA-Cys-GCA according to claim 1 for the diagnosis and/or treatment of aortic dissection disease by modulation of STAT 4.
5. Use of a tiRNA-Cys-GCA according to claim 1 as a biomarker for the diagnosis of aortic dissection disease.
6. A TiRNA-Cys-GCA for use in affecting cell proliferation and/or migration according to claim 1, wherein the cell is VSMC.
7. Use of a tiRNA-Cys-GCA according to claim 1 for the regulation of expression of a contractile phenotype protein.
8. An aortic dissection disease diagnostic kit takes TiRNA-Cys-GCA as a detection target.
9. The kit of claim 8, comprising SYBR Green reagent, cDNA, primers.
CN202110562074.4A 2021-05-24 2021-05-24 TiRNA-Cys-GCA and application thereof in aortic dissection diseases Active CN113278612B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202110562074.4A CN113278612B (en) 2021-05-24 2021-05-24 TiRNA-Cys-GCA and application thereof in aortic dissection diseases

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202110562074.4A CN113278612B (en) 2021-05-24 2021-05-24 TiRNA-Cys-GCA and application thereof in aortic dissection diseases

Publications (2)

Publication Number Publication Date
CN113278612A true CN113278612A (en) 2021-08-20
CN113278612B CN113278612B (en) 2022-06-17

Family

ID=77280910

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202110562074.4A Active CN113278612B (en) 2021-05-24 2021-05-24 TiRNA-Cys-GCA and application thereof in aortic dissection diseases

Country Status (1)

Country Link
CN (1) CN113278612B (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN116898868A (en) * 2023-05-19 2023-10-20 青岛大学附属医院 Application of MiR-1909-5p in preparation of product for treating vascular endothelial cell iron death and/or aortic dissection

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101440397A (en) * 2008-08-13 2009-05-27 中国人民解放军第三军医大学第二附属医院 Gene chip for detecting differential expression of human mitochondria gene
CN110724738A (en) * 2019-09-29 2020-01-24 青岛大学附属医院 Application of lncXXYLT1-AS2, kit for diagnosing cardiovascular diseases and medicine for treating cardiovascular diseases

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101440397A (en) * 2008-08-13 2009-05-27 中国人民解放军第三军医大学第二附属医院 Gene chip for detecting differential expression of human mitochondria gene
CN110724738A (en) * 2019-09-29 2020-01-24 青岛大学附属医院 Application of lncXXYLT1-AS2, kit for diagnosing cardiovascular diseases and medicine for treating cardiovascular diseases

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
J. A. GREEN等: "tRNA-Derived Fragments (tRFs) Regulate Post-Transcriptional Gene Expression via AGO-Dependent Mechanism In IL-1β Stimulated Chondrocytes", 《OSTEOARTHRITIS CARTILAGE》 *
MRIDUSMITA SAIKIA等: "Genome-wide analysis of N1-methyl-adenosine modification in human tRNAs", 《RNA》 *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN116898868A (en) * 2023-05-19 2023-10-20 青岛大学附属医院 Application of MiR-1909-5p in preparation of product for treating vascular endothelial cell iron death and/or aortic dissection
CN116898868B (en) * 2023-05-19 2024-02-06 青岛大学附属医院 Application of MiR-1909-5p in preparation of product for treating vascular endothelial cell iron death and/or aortic dissection

Also Published As

Publication number Publication date
CN113278612B (en) 2022-06-17

Similar Documents

Publication Publication Date Title
Sun et al. Expression profile of microRNAs in hypertrophic cardiomyopathy and effects of microRNA-20 in inducing cardiomyocyte hypertrophy through regulating gene MFN2
Wang et al. TUG1 regulates pulmonary arterial smooth muscle cell proliferation in pulmonary arterial hypertension
Liu et al. Overexpression of miR-142-3p improves mitochondrial function in cardiac hypertrophy
CN109462996A (en) The method for diagnosing inflammatory bowel disease by RNASET2
US20190153446A1 (en) Mir-149-3p and method for treating metabolic disease using the same
CN113278612B (en) TiRNA-Cys-GCA and application thereof in aortic dissection diseases
CN114191554B (en) Application of TERT expression inhibiting agent in preparation of drugs for preventing or treating thoracic aortic aneurysm
CN114317722A (en) Application of lncRNA APAT molecule in atherosclerotic heart disease
CN110724738B (en) Application of lncXXYLT1-AS2, kit for diagnosing cardiovascular diseases and medicine for treating cardiovascular diseases
Cheng et al. Circulating cardiac MicroRNAs safeguard against dilated cardiomyopathy
Li et al. BMPR2 promoter methylation and its expression in valvular heart disease complicated with pulmonary artery hypertension
WO2019143828A9 (en) Biomarkers of cardiovascular status and uses therof
Marchetti et al. An integrated genomic-transcriptomic approach supports a role for the proto-oncogene BCL3 in atherosclerosis
CN109097358B (en) Application of lncRNA in prevention or treatment of hypertension
CN115429879B (en) Application of targeted inhibition GATA3 in promoting liver regeneration and improving liver injury
EP3110973A1 (en) Oxidative stress and cardiovascular disease events
CN109486817A (en) A kind of application of the long-chain non-coding RNA and combinations thereof in diagnoses and treatment cholangiocarcinoma
Yan et al. Cardiac ISL1-interacting protein, a cardioprotective factor, inhibits the transition from cardiac hypertrophy to heart failure
WO2013022927A2 (en) Treatment of uterine leiomyomata
US10704097B2 (en) Oxidative stress and cardiovascular disease events
Xie et al. MiR-33 may be a Biological Marker for Coronary Heart Disease.
CN111979328B (en) Biomarker for predicting liver cancer lung metastasis and application thereof
CN109486945A (en) A kind of miRNA detection kit and its application in diagnosis coronary lumen stenosis
CN117007816B (en) Application of target Nesfatin-1 in preventing or treating vascular calcification
CN115590962B (en) Application of circ3302 inhibitor in preparation of medicine for inhibiting progress of Kawasaki EndMT

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant