CN116898868B

CN116898868B - Application of MiR-1909-5p in preparation of product for treating vascular endothelial cell iron death and/or aortic dissection

Info

Publication number: CN116898868B
Application number: CN202310567646.7A
Authority: CN
Inventors: 付秀秀; 于涛; 王志斌; 彭新刚; 陶艳
Original assignee: Affiliated Hospital of University of Qingdao
Current assignee: Affiliated Hospital of University of Qingdao
Priority date: 2023-05-19
Filing date: 2023-05-19
Publication date: 2024-02-06
Anticipated expiration: 2043-05-19
Also published as: CN116898868A

Abstract

The invention discloses an application of MiR-1909-5p in preparing a product for treating vascular endothelial cell iron death and/or aortic dissection; the miR-1909-5P can negatively regulate the expression of GPX4, so that the miR-1909-5P inhibitor can reduce the death of HUVECs iron induced by nicotine and further slow down the AD progress by targeting GPX4, thereby realizing the treatment purpose of AD; thus, inhibition of miR-1909-5p becomes a new strategy for improving aortic function in patients with chronic smoking AD.

Description

Application of MiR-1909-5p in preparation of product for treating vascular endothelial cell iron death and/or aortic dissection

Technical Field

The invention relates to the technical field of biology, in particular to an application of MiR-1909-5p in preparing a product for treating vascular endothelial cell iron death and/or aortic dissection.

Background

AD (aortic dissection, AD) is a life threatening aortic disease. The incidence rate of the disease tends to rise. The symptoms and manifestations of AD are complex and diverse. Typical symptoms are catastrophic chest and back lacerations. When the endomembrane tear propagates to other parts of the cardiovascular system, complications such as acute coronary syndrome, aortic insufficiency, gastrointestinal ischemia and the like can also be caused.

Current diagnosis of AD relies mainly on imaging means represented by computed tomography angiography (computerized tomography angiography, CTA). As a "gold standard" for AD diagnosis, CTA has a large radiation dose, is prone to the formation of heart beat artifacts and is metabolized via the kidneys, which is of limited use in pregnant women, infants, allergies to contrast agents and renal insufficiency. Whereas magnetic resonance imaging (Magnetic resonance imaging, MRI) scan times are long and are not suitable for patients in which magnetic substances are present in the body. Compared with other imaging methods, the Echocardiography (ECG) has the advantages of simple operation, rapidness, strong adaptability, good repeatability and the like, and can dynamically image and confirm an intima break at multiple angles in real time, observe aortic root and pericardium or pleural effusion hematocrit, and qualitatively and quantitatively evaluate aortic valve regurgitation. In addition ECG has unique advantages in post-operative follow-up for detection of thrombosis, pseudoaneurysms and retrograde tears. It is therefore the most common means of diagnosis of AD. However, ECG is limited in detection of AD in people suffering from obesity and emphysema. And the ECG is insensitive to the detection of the aortic dissection, and the diagnosis detection rate is low. In terms of treatment, AD is primarily treated with surgical open surgery and endovascular repair. However, even with surgical intervention, the mortality rate of AD patients is still high. Early mortality in 2 weeks from onset of type B AD in endoluminal repair is 10.2%, while mortality in open surgery type B AD patients is 17.5% higher. Mortality in surgically treated AD patients of type a is also up to 26%. Therefore, none of the above diagnostic strategies can effectively interfere with the pathological course of AD.

In view of this, the present invention has been made.

Disclosure of Invention

The invention aims to provide an application of MiR-1909-5P in preparing a product for treating vascular endothelial cell iron death and/or aortic dissection, wherein miR-1909-5P can negatively regulate GPX4 expression, and then miR-1909-5P inhibitor can reduce nicotine-induced HUVECs iron death by targeting GPX4, further slows down AD progression, and achieves the purpose of treating AD.

In order to achieve the above object of the present invention, the following technical solutions are specifically adopted:

in a first aspect, the invention provides the use of MiR-1909-5p in the manufacture of a product for the treatment of vascular endothelial iron death and/or aortic dissection.

Preferably, the use of an inhibitor of MiR-1909-5p for the preparation of a product for inhibiting vascular endothelial iron death.

Preferably, the MiR-1909-5p inhibitor comprises MiR-1909-5p inhibitor and/or miR-1909-5p antagomir.

Preferably, the nucleotide sequence of MiR-1909-5p inhibitor is shown as SEQ ID NO:1 is shown in the specification; the miR-1909-5p antagomir has a sense strand nucleotide sequence shown in SEQ ID NO:2, the nucleotide sequence of the antisense strand is shown as SEQ ID NO: 3.

Preferably, the products include pharmaceuticals and foods.

In a second aspect, the invention provides a medicament for inhibiting vascular endothelial cell iron death, which comprises a therapeutically effective amount of the MiR-1909-5p inhibitor and pharmaceutically acceptable excipients.

In a third aspect, the invention provides the use of an inhibitor of MiR-1909-5p in the preparation of a product for the treatment of aortic dissection.

Preferably, the nucleotide sequence of the MiR-1909-5p inhibitor is shown in SEQ ID NO: 1.

Preferably, the sense strand nucleotide sequence of the miR-1909-5p inhibitor is shown in SEQ ID NO:2, the nucleotide sequence of the antisense strand is shown as SEQ ID NO: 3.

Preferably, the products include pharmaceuticals and foods.

In a fourth aspect, the invention provides a medicament for treating aortic dissection, which comprises a therapeutically effective amount of the MiR-1909-5p inhibitor and pharmaceutically acceptable auxiliary materials.

Compared with the prior art, the invention has the beneficial effects that at least:

the miR-1909-5P can negatively regulate the expression of GPX4, so that the miR-1909-5P inhibitor can reduce the death of HUVECs iron induced by nicotine and further slow down the AD progress by targeting GPX4, thereby realizing the treatment purpose of AD; thus, inhibition of miR-1909-5p becomes a new strategy for improving aortic function in patients with chronic smoking AD.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the embodiments or the prior art will be briefly described below. Like elements or portions are generally identified by like reference numerals throughout the several figures. In the drawings, elements or portions thereof are not necessarily drawn to scale.

FIG. 1 shows the results of a study showing significant iron aortic intima death in AD patients with long-term smoking and in nicotine-treated AD mice in the examples of the invention;

figure 2 is a graph showing the results of an in vitro study of nicotine causing iron death in endothelial cells in accordance with an embodiment of the present invention;

FIG. 3 is a graph showing the results of a study of MiR-1909-5p targeted modulation of endothelial cell GPX4 in an example of the invention;

FIG. 4 is a graph showing the results of studies of nicotine-induced iron death of endothelial cells by overexpression of miR-1909-5p in an example of the invention;

FIG. 5 is a graph showing the results of a study of knockdown of miR-1909-5p against nicotine-induced iron death in endothelial cells in an example of the invention;

FIGS. 6, 7 and 8 are graphs showing the therapeutic effect of knockdown miR-1909-5p in smoking AD mice in the examples of this invention.

Detailed Description

Embodiments of the technical scheme of the present invention will be described in detail below with reference to the embodiments. The following examples are only for more clearly illustrating the technical aspects of the present invention, and thus are merely examples, and are not intended to limit the scope of the present invention.

It is noted that unless otherwise indicated, technical or scientific terms used herein should be given the ordinary meaning as understood by one of ordinary skill in the art to which this invention pertains.

The embodiment of the invention provides an application of MiR-1909-5p in preparing a product for treating vascular endothelial cell iron death and/or aortic dissection.

The miR-1909-5P can negatively regulate the expression of GPX4, and furthermore, the miR-1909-5P inhibitor can reduce the death of HUVECs iron induced by nicotine and further slow down the AD progress by targeting GPX4, so that the purpose of treating AD is realized.

In some embodiments, the use of an inhibitor of MiR-1909-5p in the preparation of a product for inhibiting vascular endothelial cell iron death.

In some embodiments, the MiR-1909-5p inhibitor comprises MiR-1909-5p inhibitor and/or miR-1909-5p antagomir.

In some embodiments, the nucleotide sequence of MiR-1909-5p inhibitor is as set forth in SEQ ID NO:1, in particular CAGGGCAGGCACCGGCACUCA. The miR-1909-5pantagomir has a sense strand nucleotide sequence shown in SEQ ID NO:2, specifically GCAGUCAAAUGCUCUACCACUGAGCUAUACCCCCC;

the nucleotide sequence of the antisense strand is shown in SEQ ID NO:3, in particular GGGUAUAGCUCAGUGGUAGAGCAUUUGACUGCUU.

The invention is not limited to the types of the products, and can be medicines or foods.

In another embodiment, the invention provides a medicament for inhibiting vascular endothelial cell iron death, which comprises a therapeutically effective amount of the MiR-1909-5p inhibitor and pharmaceutically acceptable auxiliary materials.

In yet another embodiment, the invention provides the use of an inhibitor of MiR-1909-5p in the preparation of a product for treating aortic dissection.

In some embodiments, the nucleotide sequence of MiR-1909-5p inhibitor is as set forth in SEQ ID NO: 1. The miR-1909-5p antagomir has a sense strand nucleotide sequence shown in SEQ ID NO:2 is shown in the figure; the nucleotide sequence of the antisense strand is shown in SEQ ID NO: 3.

In yet another embodiment, the invention provides a medicament for treating aortic dissection comprising a therapeutically effective amount of the MiR-1909-5p inhibitor and pharmaceutically acceptable excipients.

The technical scheme of the invention is further described in detail through specific examples.

Examples

This example is a study of MiR-1909-5p for the regulation of vascular endothelial iron death and aortic dissection:

1. experimental method

1.1 clinical samples

Aortic tissue from 10 AD patients with a long-term history of smoking (smoking index ∈300, smoking index=number of cigarettes per day x number of years of smoking) from 4 months 2021 to 3 months 2022, aortic resections conducted in affiliated hospitals at the university of Qingdao, were collected as disease groups. Paraneoplastic normal arteries of 11 patients with no long-term smoking history (no smoking history or smoking cessation >3 months) and no AD were collected as healthy controls. The harvested vascular tissue was peeled clean and washed 1-2 times with pre-chilled 1 XPBS buffer. After fixation of a reserved portion of tissue with 4% paraformaldehyde and paraffin embedding for pathology staining, the remaining tissue will be rapidly stored in liquid nitrogen for molecular detection. The collection of clinical organizations was approved by the ethical committee of affiliated hospitals at the Qingdao university, and patients or their legal guardians signed informed consent.

1.2 construction of AD mouse model and treatment study

(1) 44C 57BL/6J male mice over 3 weeks old were purchased from Jinan Pengyue laboratory animals breeding limited and bred on the animal laboratory platform of the Qingdao university transformation medical institute. The animal house adopts an automatic illumination control system, and is given regular 12h illumination every day, so that sufficient and fresh diet is provided for free acquisition, and weighing is carried out every 2 days.

(2) Newly purchased mice were randomized into 4 groups after 1 week of standard diet to acclimate to the environment, each group consisting of 11 groups of saline, AD model, AD+miR-1909-5p antagomir NC and AD+miR-1909-5p antagomir. AD was induced simultaneously in the latter 3 groups of mice. The specific method comprises the following steps: angiotensin II (Ang II, 6mg/kg/12 h) and beta-aminopropionitrile (BAPN, 0.33g/kg/24 h) were injected intraperitoneally in combination with nicotine (30. Mu.g/kg/d), and SALINE mice were injected intraperitoneally in combination with physiological saline (200. Mu.l/d). Meanwhile, two nucleic acid-treated mice were injected with a mixture of methoxypropionaldehyde PEG and miR-1909-5p antagomir NC or miR-1909-5p antagomir (2 times per week, 0.625 mg/kg), and the saline group mice were injected with an equivalent amount of physiological saline (200. Mu.l/d) by intravenous injection. MiR-1909-5 pantagopir NC and miR-1909-5p antagopir are provided by Shanghai Ji Ma pharmaceutical technologies Inc. (miR-1909-5 p antagopir sense strand is shown as SEQ ID NO: 2; miR-1909-5p antagopir antisense strand is shown as RU SEQ ID NO: 3. MiR-1909-5p antagopir NC sequence: ACGCAGCAGAGCGUCGCCACG).

(3) The dead mice were immediately aortic observed and photographed during this period. The surviving mice were subjected to ultrasound imaging for the aorta 14 days later. Mice were sacrificed at 15d, the aorta was dissected and collected for molecular detection and histological analysis. Animal experiments were approved by the ethical committee of animals affiliated to hospitals at the university of Qingdao. The number of mice death and survival of each group recorded during the experiment is shown in table 1;

TABLE 1 survival of mice in animal experiments

1.3 cell transfection

(1) miR-1909-5p micrometers, miR-1909-5p inhibitor and negative control oligonucleotides thereof are all purchased from Shanghai Ji Ma pharmaceutical technologies Co. After centrifugation of the oligonucleotide powder at 3000-4000RPM/min for 1min at room temperature, DEPC water was added to dissolve into 20. Mu.M working solution. When the cell confluency of the 6-well plate or the 12-well plate reached 60% -70%, the serum-free medium was mixed with Lipofectamine 3000 or oligonucleotides according to the manufacturer's instructions and allowed to stand for 15min. The oligonucleotide base sequences used are shown in Table 2;

TABLE 2 RNA sequences for cell transfection

(2) Uniformly mixing the rest Lipofectamine 3000 premix with the oligonucleotide premix in equal volume, uniformly mixing with the FBS-containing culture medium, and standing for 5min.

(3) The medium was aspirated and the mixture after 5min of standing was added to the wells to be transfected. After 6h of transfection, the medium containing the transfection reagent was aspirated and fresh medium was added.

1.4RNA extraction

(1) For cell samples, 6-well plates are exemplified. The treated cells were rinsed twice with 1 XPBS, TRIzol (1 ml/well) was added and lysed on ice for 15min. Repeatedly blowing the cells by a pipetting gun, and transferring the cell lysate to a 1.5ml EP tube; for tissue samples, soybean grain size tissue pieces were cut to 1.5ml EP tubes to which 1ml TRIzol and several grinding beads were added. Tissue was abraded to homogenate using a high throughput tissue abrasion instrument.

(2) Adding chloroform (200 μl/tube) into EP tube, shaking up and down, and standing on ice for 2-3min;

(3) The EP tube was centrifuged in a high-speed low-temperature centrifuge (4 ℃,12000RPM/min,15 min). RNA delamination was seen. Sucking the upper RNA (400. Mu.l/tube) into a new EP tube, adding equal amount of isopropanol (400. Mu.l/tube), slowly reversing and shaking for several times, and standing on ice for 15min;

(4) The EP tube was centrifuged (4 ℃,12000RPM/min,10 min) in a high-speed low-temperature centrifuge, the supernatant was aspirated off, and the pellet was washed with 75% ethanol. Centrifuging (4 deg.C, 12000RPM/min,10 min) at high speed and low temperature with a centrifuge, such as discarding supernatant, precipitating, and washing precipitate;

(5) The residual solution was removed by pipetting, and the RNA pellet was dried at room temperature. Adding proper amount of DEPC water (more RNA: 20. Mu.l; less RNA: 10. Mu.l) after drying, and dissolving on ice for 30min;

(6) The RNA concentration was measured by a light absorbing microplate reader.

1.5 reverse transcription of RNA

(1) MiRNA first strand cDNA Synthesis

A miRNA first strand cDNA synthesis kit was used. The specific components and the operation method of the kit are shown in Table 3;

TABLE 3 preparation of reverse transcription System by tailing method

Reverse transcription reaction conditions: 37 ℃ for 60min;85 ℃ for 5min;4 ℃ and infinity.

(2) Reverse transcription of mRNA

a. Removal of genomic DNA

The reaction mixtures as shown in Table 4 were prepared in RNase-free centrifuge tubes under the following reaction conditions: 42 ℃ for 2min;4 ℃ and infinity.

TABLE 4 reaction System for removal of genomic DNA

b. Preparation of reverse transcription reaction System

5X HiScript III qRT SuperMix (4. Mu.l/tube) was added to the mixture after the completion of the above reaction, and the reaction was carried out under the following conditions: 37 ℃ for 15min;85 ℃,5s;4 ℃ and infinity. The template cDNA was diluted.

1.6qRT-PCR

The gene primer and the sequence thereof used for qRT-PCR are shown in Table 5,

TABLE 5 primer sequences for qRT-PCR

The 20. Mu.l reaction system prepared is shown in Table 6,

TABLE 6 reaction System for qRT-PCR preparation

Reaction conditions: 95 ℃ for 30s;95 ℃ for 5s;60 ℃ for 30s. Amplification times: 40 cycles.

1.7WB

(1) Protein extraction

a. For cells, the formulated protein extract lysate (high efficiency RIPA: cocktail=100:1) was added and lysed on ice for 15min. For tissue, protein extraction lysate and milling beads were added and the high throughput tissue mill was thoroughly milled to homogeneity.

b. Centrifuging the lysate by a low-temperature high-speed centrifuge, and sucking the supernatant to a new EP tube.

(2) Protein concentration determination by BCA method

BCA assay kit measures protein concentration and determines loading. Adding 5×loading, and cooking.

(3) Electrophoresis

Protein samples were added sequentially to prepare SDS-PAGE gels. Setting an electrophoresis program and starting the electrophoresis apparatus.

(4) Transfer film

Methanol activates the PVDF membrane. The sandwich clamp is immersed in the transfer liquid. The sponge, the filter paper, the PVDF film and the glue are placed in the clamp, and then the clamp is clamped and inserted into the film transferring groove. Covering a film transferring groove cover, setting a film transferring program, and starting a film transferring instrument.

(5) Blocking and antibody incubation

5% milk was blocked for 1-2h at room temperature, primary antibody incubated overnight at 4℃and secondary antibody incubated for 1h at room temperature.

(6) Development and protein banding

And starting a developing program, adjusting exposure time according to the initial developing effect, and storing the picture.

1.8 immunohistochemical staining (IHC)

(1) Dewaxing to water: sequentially immersing paraffin sections into xylene-absolute ethyl alcohol-85% ethyl alcohol-75% ethyl alcohol-double distilled water for 5min each;

(2) Antigen retrieval: boiling the slices in a microwave oven at 95 ℃ for 15min, naturally cooling, and washing with 1X PBS;

(3) Inactivation of endogenous catalase: slice drop 3% H ₂ O ₂ Incubating for 30min at 37 ℃ in dark;

(4) Serum blocking: the sections were blocked for 20min at room temperature after 3% BSA was added dropwise, and washed with 1 XPBS;

(5) Anti-blocking: dropwise adding primary antibody working solution into the slices, and then incubating the slices at 4 ℃ overnight in a wet box;

(6) The next day the secondary antibody working solution was incubated for 1h at room temperature. Absorbing and discarding the secondary antibody and washing with PBST;

(7) DAB color reaction: washing the slices with tap water after dripping DAB working solution to stop color development;

(8) Lining dyeing: slicing, spin-drying, dripping hematoxylin, counterstaining for 6-10s, and washing with tap water;

(9) Dehydrating, transparency and sealing.

1.9 immunohistochemical fluorescence (IHF)

(1) Dewaxing and rehydrating: sequentially immersing paraffin sections into xylene-absolute ethyl alcohol-85% ethyl alcohol-75% ethyl alcohol-double distilled water for 5min each;

(2) Antigen retrieval: repairing antigen by microwave oven with medium fire for 8 min-stopping fire for 8 min-medium and low fire for 7min;

(3) Dropwise adding 5% BSA blocking solution into the slices, and blocking for 1h at room temperature;

(4) Incubating primary antibodies: dropwise adding primary antibody working solution into the slices, and then incubating the slices at room temperature for 1-2h or at 4 ℃ overnight in a refrigerator;

(5) Incubating a secondary antibody: incubating the fluorescent secondary antibody working solution for 1h at room temperature in a dark place;

(6) DAPI counterstain nuclei: DAPI dye solution, incubation at room temperature and in dark place, and washing with 1 XPBS;

(7) And (5) performing lens sealing microscopy: and (3) sealing the sheet by using a sealing sheet liquid containing a fluorescence quenching agent, and scanning by using a laser confocal microscope.

1.10 fluorescence in situ hybridization experiments (FISH)

a. Dewaxing and rehydrating: sequentially immersing paraffin sections into xylene-absolute ethyl alcohol-85% ethyl alcohol-75% ethyl alcohol-double distilled water for 5min each;

b. hypotonic: immersing the slices into KCl hypotonic solution preheated to 37 ℃ and incubating in a water bath at 37 ℃ for 40min;

c. baking slices: opening the oven to set the temperature to 56 ℃ and baking the slices for 20min;

d. the slices were sequentially placed into the following reagents for treatment: 2 XSSC for 2min, and composite digestive juice for 8min;2 XSSC for 2min; formaldehyde solution for 10min; concentration gradient ethanol is respectively 2min (70% -80% -absolute ethanol);

e. probe buffer (25 μl/piece) was added dropwise in the dark, and the coverslip was covered:

f. opening the water bath kettle to set the temperature to 75 ℃, and putting the slices into the water bath kettle to denature for 7min under the condition;

g. the oven temperature is adjusted to 40 ℃, and slices are placed in the constant temperature oven for hybridization overnight;

h. the following day sections were immersed in the following reagents: 0.4 XSSC, 2 XSSC and 75% ethanol for 3min each;

i. the slice is dried in a fume hood and then is dripped with DAPI dye liquor;

j. after 20min of nuclear staining, the fluorescent microscope is used for observation.

1.11 hematoxylin-eosin staining (HE staining)

(2) Dip dyeing: hematoxylin is used for differentiating after 10min of dip-dyeing by 1% hydrochloric acid alcohol. Then dip-dyeing for 5min;

(3) Dehydrating: putting the slices into concentration gradient ethanol for dehydration;

(4) And (3) transparency: the sections were taken in 2 portions into xylene (5 min/time):

(5) Sealing piece: the residual dimethylbenzene is sucked by the water-absorbing paper, and the neutral resin sealing piece is added in a suspending manner and dried.

1.12Masson staining

(1) Dewaxing to water: paraffin sections were routinely dewaxed to distilled water;

(2) Dip dyeing: sections were stained with Weigert's iron hematoxylin stain and differentiated with 1% hydrochloric acid alcohol. The ponceau acid fuchsin, 1% phosphomolybdic acid solution and aniline blue solution are treated by 1% glacial acetic acid after being dip-dyed;

(3) Dehydrating, transparency and sealing.

1.13Verhoeff-Van Gieson staining

The dewaxed sections were dip-stained in Verhoeff staining solution for 30min and then differentiated with Verhoeff staining solution. The sections were stained with Van Gieson stain (10 s). Slicing, dehydrating, transparency and sealing.

1.14 Reactive Oxygen Species (ROS) content detection

(1) Loading a probe: after incubation with DCFH-DA working solution at 37℃the cells were rinsed with serum-free medium.

(2) The fluorescence microscope observes the intracellular fluorescence, and Image J quantifies the fluorescence intensity.

1.15 detection of reduced Glutathione (GSH) content

(1) Collecting cells: after the adherent cells were digested with pancreatin, the cell suspension was collected, centrifuged and the cells were washed, and 120 μl of reagent was added per sample to resuspend the cells and sonicated. Centrifuging, collecting supernatant, and placing on ice for testing.

(2) Taking supernatant of each sample, and measuring protein concentration by using a BCA method;

(3) Preheating the second reagent in a water bath kettle at 37 ℃ for 30min;

(4) The reagent was diluted 10-fold and then a concentration gradient standard was prepared. Adding standard substances or double distilled water, a second reagent and a third reagent of each concentration into a 1.5ml EP tube in sequence, and adding the mixture into a 96-well plate to measure absorbance at 412 nm;

(5) Drawing a standard curve: drawing a standard curve by taking the absorbance of each standard hole minus the absorbance of the blank hole as the abscissa concentration as the ordinate;

(6) Measuring the absorbance of the sample: sequentially adding a sample, a second reagent and a third reagent into a 1.5ml EP tube, adding the mixture into a 96-well plate, and detecting absorbance A2 at 412nm, wherein DeltaA=A2-A1;

(7) GSH content calculation: substituting DeltaA into a standard curve formula to obtain the sample concentration y. And finally substituting into a GSH calculation formula to calculate the GSH content.

1.16 Malondialdehyde (MDA) content detection

(1) Collecting cells: pancreatin digests adherent cells, collects cell suspensions, and centrifiges and aspirates the supernatant. The cells were resuspended by adding extract to each sample tube. Cells are broken by ultrasonic waves, and supernatant is collected by centrifugation and placed on ice to be tested.

(3) Measuring the absorbance of the sample: 200 μl sample, double distilled water, 200 μl reagent III, and 600 μl MDA detection working solution were sequentially added into 1.5ml EP tube, mixed well, and the tube mixtures were placed in a metal bath (95deg.C, 90 min), cooled in an ice bath, and centrifuged (room temperature, 10000g,10 min). The supernatant was pipetted into 96-well plates (100. Mu.l/well, 3 replicates per sample) and absorbance at 450nm, 532nm, 600nm was measured;

(4) MDA content calculation: according to the protein concentration: MDA content (nmol/mg prot) =5× (12.9× (Δa532- Δa600) -2.58×Δa450)/Cpr (Δa450=a450 sample-a450 blank, Δa532=a532 sample-a532 blank, Δa600=a600 sample-a600 blank).

1.17 double luciferase reporter Gene experiments

The reagents used in this experiment are shown in Table 7 (200T for example),

table 7 component Table of double luciferase reporter Gene detection kit

The components are taken out of the refrigerator and melted to room temperature,

(1) Preparation of reagents

a.Luciferase Reaction Reagent

Luciferase Reaction Buffer is poured into Luciferase Reaction Substrate, vortex vibration is carried out for full dissolution, and the mixture is packaged into a 5ml centrifuge tube (tin foil is wrapped outside);

b.Luciferase Reaction ReagentⅡ

luciferase Reaction Buffer II and Luciferase Reaction Substrate II (50X) are diluted according to a dilution ratio of 50:1 and are packaged into 5ml centrifuge tubes (tin foil is wrapped outside);

c.1×Cell Lysis Buffer

5X Cell Lysis Buffer with autoclaved double distilled water at 4: dilution ratio dilution of 1;

(2) Lysing cells

Absorbing and removing the culture medium, washing the cells for 2 times by using 1X PBS, adding 1X Cell Lysis Buffer to lyse for 10min, collecting cell lysate, and centrifuging to obtain supernatant for later use;

(3) Detection of absorbance

Luciferase Reaction Reagent, which was thawed to room temperature, was pipetted into a 96-well plate (100. Mu.l/well), and then cell lysate (20. Mu.l/well) was added to detect the activity of the firefly luciferase reporter. Then, luciferase Reaction Reagent II, which was dissolved to room temperature, was pipetted into the reaction well (100. Mu.l/well) to measure the activity of the firefly luciferase reporter.

The sequence of the transfected plasmid used in the experiment is shown in Table 8;

table 8 double luciferase reporter Gene transfection plasmid sequence

2. Statistical analysis

All raw data collected were processed using GraphPad Prism 8.3.0 software. Count data is expressed in terms of examples or percentages. The metrology data is expressed as mean ± Standard Deviation (SD). The comparison between two independent samples used a unpaired t test. The comparison between the groups adopts single-factor analysis of variance. P <0.05 is statistically significant.

3. Experimental results

3.1 study of death of aortic endomembrane in AD patients with long-term smoking and nicotine-treated AD mice

To explore the unique role of iron death in aortic injury in smoking AD patients, first the presence of iron death in the aorta of smoking AD patients was examined. The results show that the iron death inhibitor GPX4 was significantly down-regulated in the aorta of smoking AD patients, while iron death drives ptgs2 up-regulated (fig. 1 a). The above results initially demonstrate that iron death is involved in smoking-related AD development. Next, GPX4 in the aorta of patients with smoking AD was detected using IHC (B in fig. 1). GPX4 was significantly down-regulated in the dissected aortic tissue compared to normal arterial tissue, and GPX4 was significantly enriched in normal arterial intima. IHF results showed that GPX4 fluorescence was stronger in healthy groups compared to disease groups, and GPX4 was also abundantly expressed in healthy arterial intima (C in fig. 1). In the nicotine treated AD mouse model, a similar iron death phenomenon was also observed in its aortic intima (D-F in fig. 1). Interestingly, this finding revealed for the first time that aortic intimal iron death could promote AD progression. Glutathione peroxidase (GPX 4) is a classical endogenous anti-iron death selenoprotein that can utilize glutathione to convert lipid hydroperoxides (L-OOH) to reduced lipid alcohols (L-OH). Thus, GPX4 was chosen as the target protein for the study. GPX4 mRNA levels in VSMCs, HUVECs, RAW264.7 and THP-1 cells were then detected. The data show that the transcript level of GPX4 is highest in HUVECs (G in fig. 1);

in fig. 1, (a) immunoblots (left) and quantification of GPX4 and ptgs2 (n=4) of clinically healthy arteries and the aorta of smoking AD patients. (B) Cross-sectional Immunohistochemical (IHC) staining of clinically healthy arteries and aorta of smoking AD patients, scale bar = 50 μm; image J quantified GPX4 positive staining (n=3). (C) Clinical healthy artery and AD patients with smoking were stained for representative immunohistochemical fluorescence (IHF) of aortic cross sections, scale bar = 50 μm, image J quantified GPX4 positive staining (n = 3). (D) GPX4 immunoblotting and quantification of aorta (n=4) in healthy mice and nicotine-treated AD mice. (E-F) cross section IHC and IHF staining of the aorta of healthy mice and nicotine-treated AD mice. Image J quantifies GPX4 positive (n=3), scale bar=200 μm,50 μm; red = GPX4, green = CD31, blue = DAPI. (G) QRT-PCR detects mRNA levels of GPX4 in VSMCs, HUVECs, RAW264.7 and THP-1 cells (n=3). ns represents no significant difference, P <0.05, P <0.01 and P <0.001. The results show that: iron death can occur in the aortic intima.

3.2 study of iron death in endothelial cells by nicotine

To simulate the pathological damage to blood vessels by smoke inhalation, HUVECs were treated with nicotine. As a result, it was found that nicotine both in time and concentration gradients caused significant down-regulation of GPX4 (a-D in fig. 2). The treatment conditions for HUVECs were selected as 10-3M nicotine treatment for 24h, taking into account both the time of nicotine action on HUVECs and the growth density of HUVECs. Whereas iron death inhibitor Ferrosistatin-1 (Fer-1) increased GPX4 (E-F in FIG. 2) in HUVECs with reduced nicotine;

in fig. 2, (a-B) immunoblots detect expression of GPX4 (n=3) 24h after nicotine treatment of HUVECs with 10-6-10-2M. (C-D) immunoblotting and quantification of GPX4 after treatment of HUVECs with 10-3M nicotine with a time gradient of 0h, 24h, 48h, 72h (n=3). (E-F) immunoblotting detection of GPX4 expression after 24h of HUVECs co-treatment of 10-3M nicotine with or without Ferrostatin-1, an iron death inhibitor (100 μm), F-plot is quantification of E-plot (n=3). ns represents no significant difference, P <0.05, P <0.01 and P <0.001.

The results indicate that nicotine can induce HUVECs iron death. Meanwhile, a model of the endomembrane iron death cell caused by smoking is established, and convenience is provided for further in-vitro mechanism research.

3.3 study of GPX4 for MiR-1909-5p Targeted modulation of endothelial cells

To find upstream mirnas that regulate GPX4, mirnas upstream of GPX4 were predicted using three large mirnas online website (miRDB, mirtaalk, targetscan), and 9 mirnas were obtained from intersection (a in fig. 3). Of these 9 candidate miRNAs, miR-1909-5p (B in fig. 3) was selected that was relatively conserved across species, has not been studied in cardiovascular events, and is strongly correlated with oxidative stress. Subsequently, miR-1909-5-p micrometers and inhibitor were synthesized and their high transfection efficiency was verified in HUVECs (FIG. 3C). Meanwhile, after transfection of miR-1909-5p micrometers and inhibitor, the mRNA and protein levels of GPX4 were also down-regulated and up-regulated, respectively (D-F in FIG. 3). These results indicate that miR-1909-5p may act as an upstream target gene for GPX4, regulating its transcription and translation. Wild-type (WT) and mutant (Mut) plasmids of GPX43' -UTR were synthesized based on the site predicted binding sites of miR-1909-5p and GPX43' -UTR, and binding of miR-1909-5p to GPX43' -UTR was detected by double-luciferase reporter gene assay (G in FIG. 3). The results showed that the luminescence intensity of the co-transfected miR-1909-5p miics and WT plasmid groups was significantly lower than that of the co-transfected miR-1909-5p NC and WT plasmid groups. The luminous intensity between the co-transfected miR-1909-5pmimic and Mut plasmid group and the co-transfected miR-1909-5 pNC and Mut plasmid group has no statistical significance. This is a direct evidence for the targeted regulation of GPX4 by miR-1909-5 p. mRNA levels of miR-1909-5p also showed an opposite trend to that of GPX4 after 24H of concentration gradient nicotine treatment of HUVECs (H in FIG. 3). This also indirectly suggests that miR-1909-5p can down-regulate GPX4. To study the expression and localization of miR-1909-5p in tissues, qRT-PCR and FISH-binding IHF experiments were performed in animal and clinical tissue samples. The results showed that the mRNA level of miR-1909-5p was higher in the aorta of the nicotine-treated AD mice compared to the aorta of healthy mice, and that the fluorescence of miR-1909-5p was stronger and enriched in the endoaortic membrane (I in FIG. 3). Consistent results were also observed in the clinical samples (J in fig. 3).

In fig. 3, (a) three miRNAs online website miRDB, miRWalk and Targetscan predict upstream miRNAs wien plots for GPX4. (B) Results of gene sequence conservation comparison of miR-1909-5p among different species. (C) QRT-PCR detection of transfection efficiency (n=3) 24h after HUVECs transfection of miR-1909-5p mimic and inhibitor. (D) QRT-PCR detection of mRNA levels of GPX4 24h after HUVECs transfection of miR-1909-5p mimic and inhibitor (n=3). (E-F) immunoblotting (top) and quantification of GPX4 24h after HUVECs transfection of miR-1909-5p mimic and inhibitor (bottom, n=3). (G) The upper panel shows the construction pattern of GPX43' -UTR wild-type and mutant plasmids, and the lower panel shows the direct binding of miR-1909-5p to GPX4 (n=3) detected by the dual-fluorescein reporter gene assay. (H) QRT-PCR assay concentration gradient nicotine (10-7-10-3M) mRNA levels of miR-1909-5p (left) and GPX4 (right) (n=3) 24h after HUVECs treatment. (I) QRT-PCR (left) and FISH in combination with IHF (right) detected expression of miR-1909-5p (n=3), scale bar=50 μm, red=mir-1909-5 p, green=cd31, blue=dapi in the aorta of healthy mice and nicotine-treated AD mice. (J) QRT-PCR (left) and FISH in combination with IHF (right) to detect miR-1909-5p (n=3) of clinically healthy arteries and aorta of smoking AD patients, scale bar=50 μm, red=mir-1909-5 p, green=cd31, blue=dapi. n=3, ns represents no significant difference, P <0.05, P <0.01 and P <0.001.

Taken together, miR-1909-5p can bind GPX4 and down regulate its expression in endothelial cells.

3.4 study of miR-1909-5p overexpression to promote Nicotine-induced iron death in endothelial cells

To investigate the regulatory effect of miR-1909-5p on iron death of endothelial cells under pathological conditions, miR-1909-5p mimcs or its negative control NC were transfected into HUVECs and co-treated with nicotine for 24h. The results show that transfection of miR-1909-5p micrometers made the down-regulation of GPX4 by nicotine more pronounced (a-B in fig. 4). The ROS assay showed that over-expression of miR-1909-5p further increased nicotine-stimulated ROS content (C-D in FIG. 4). After the above treatment, the MDA and ROS have the same trend (E in FIG. 5). Downregulation of the anti-iron death marker GSH was more pronounced following transfection of the miR-1909-5p mimetic, further confirming the pro-iron death effect of over-expression of miR-1909-5p (F in fig. 4).

In fig. 4, (a) immunoblotting detects expression of GPX4. The histogram (B) is the quantization chart (n=3) of a in fig. 1. (C) Immunofluorescence micrograph of ROS, scale bar = 50 μm. The histogram (D) is the quantization chart (n=3) of C in fig. 1. (E-F) yield of MDA and GSH (n=3). ns represents no significant difference, P <0.05, P <0.01 and P <0.001.

The results indicate that overexpression of miR-1909-5p aggravates nicotine-induced iron death in endothelial cells.

3.5 study of MiR-1909-5p knockdown to inhibit Nicotine-induced iron death in endothelial cells

To verify whether inhibition of miR-1909-5p would reduce nicotine-induced iron death, HUVECs were transfected with miR-1909-5p inhibitor or inhibitor NC and then incubated with nicotine for 24h. WB experiments showed that knocking down miR-1909-5p inhibited down-regulation of GPX4 in nicotine-treated HUVECs (FIG. 5A-B). At the same time, transfection of miR-1909-5p inhibitor reduced the elevated ROS and MDA in HUVECs (C-E in FIG. 5). In addition, transfection of miR-1909-5p inhibitor increased GSH in HUVECs with reduced nicotine (F in fig. 5).

In fig. 5, (a) immunoblotting detects expression of GPX4. The histogram (B) is the quantization chart (n=3) of a in fig. 1. (C) Immunofluorescence micrograph of ROS, scale bar = 50 μm. The histogram (D) is the quantization chart (n=3) of C in fig. 1. (E-F) yield of MDA and GSH (n=3). n=3, ns represents no significant difference, P <0.05, P <0.01 and P <0.001.

The result shows that knocking down miR-1909-5p can inhibit the death of endothelial cell iron induced by nicotine.

3.6 study of knock-down of miR-1909-5p to reduce AD by inhibiting aortic intimal iron death in nicotine-treated AD mice

To further investigate whether knocking down miR-1909-5p can alleviate smoking-related AD by inhibiting iron death, nicotine-treated AD mouse models were constructed. First, mice were intraperitoneally injected with AngII and BAPN in combination with subcutaneous nicotine. Meanwhile, the mouse tail is intravenous injected with miR-1909-5p antagomir and negative control antagomir NC. Mice were euthanized after 14 days to harvest the aorta. Survival curves showed that inhibition of miR-1909-5p significantly reduced mortality in mice (a in fig. 6). Knock-down of miR-1909-5p also reduced AD lesions and decreased the incidence of AD in mice (B-C in fig. 6). The aortic ultrasonography of mice showed that the aortic diameter of AD mice was significantly smaller after miR-1909-5p antagomir treatment (D in FIG. 6). The aortic diameter measurements were generally consistent with those described above (E in fig. 6). In addition, H & E staining showed that after inhibition of miR-1909-5p, the aortic thickness of AD mice was reduced and the aortic layers were more regularly arranged (F in FIG. 6). Masson staining showed that knocking down miR-1909-5p reduced collagen fibers that were ruptured in the aorta of AD mice (G in FIG. 6). EVG staining further demonstrated that miR-1909-5p antagomir can maintain the integrity of elastic fibers in AD mice (H in FIG. 7). The results indicate that downregulation of miR-1909-5p slows the progression of smoking-related AD. Iron death was then also detected for each treatment group. The data indicate that miR-1909-5p in the endoaortic membrane is down-regulated (I in FIG. 7) and GPX4 is up-regulated (J-K in FIG. 8) following miR-1909-5 pantagopir treatment. MDA detection results further prove that the knocking down of miR-1909-5p can inhibit death of ferric initiative (L in FIG. 8).

In fig. 6, 7 and 8, (a) survival curves of mice in each treatment group. (B) aortic overview photographs of mice of each treatment group. (C) incidence of AD in mice of each treatment group. (D-E) ultrasound (D) and generally (E) the aortic diameter of the mice was measured (n=5). (F-G) H & E staining (F) and Masson (G) staining of aortic cross sections of mice, scale bar = 200 μm. (H) EVG staining of the cross section of the aorta of the mice (left) and number of elastic fiber breaks (right, n=5). Scale bar = 200 μm. (I) FISH fluorescence plot of miR-1909-5p in aortic cross section of each treatment group, scale bar = 50 μm, red = miR-1909-5p, green = CD31, blue = DAPI. (J) Immunoblots (left) and quantification (right, n=3) of the aorta of the mice of the different treatment groups. (K-L) IHC (K) and MDA content of GPX4 (L, n=3) in the aorta of mice of each treatment group, scale bar=200 μm. ns represents no significant difference, P <0.05, P <0.01 and P <0.001.

The results show that the inhibiting miR-1909-5p relieves the smoking-related AD, and the protection effect is realized by inhibiting iron death of an aortic intima.

Finally, it should be noted that: the above embodiments are only for illustrating the technical solution of the present invention, and not for limiting the same; although the invention has been described in detail with reference to the foregoing embodiments, it will be understood by those of ordinary skill in the art that: the technical scheme described in the foregoing embodiments can be modified or some or all of the technical features thereof can be replaced by equivalents; such modifications and substitutions do not depart from the spirit of the invention, and are intended to be included within the scope of the appended claims and description.

Claims

Use of an inhibitor of MiR-1909-5p for the preparation of a medicament for improving aortic function in a patient suffering from long-term smoking, wherein the nucleotide sequence of the inhibitor of MiR-1909-5p is as set forth in SEQ ID NO: 1.
2. The use according to claim 1, wherein the sense strand nucleotide sequence of the MiR-1909-5p inhibitor is set forth in SEQ ID NO:2, the nucleotide sequence of the antisense strand is shown as SEQ ID NO: 3.