CN101440397A - Gene chip for detecting differential expression of human mitochondria gene - Google Patents
Gene chip for detecting differential expression of human mitochondria gene Download PDFInfo
- Publication number
- CN101440397A CN101440397A CNA2008100701097A CN200810070109A CN101440397A CN 101440397 A CN101440397 A CN 101440397A CN A2008100701097 A CNA2008100701097 A CN A2008100701097A CN 200810070109 A CN200810070109 A CN 200810070109A CN 101440397 A CN101440397 A CN 101440397A
- Authority
- CN
- China
- Prior art keywords
- trna
- kinds
- gene
- differential expression
- nadh
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a gene chip for detecting the differential expression of human mitochondrial genes. The gene chip is to a glass substrate incubated with probes for detecting the transcriptional abundance of 9 tRNAs, 2 rRNAs and 13 mRNAs encoded by human mitochondrial genes, as well as 5 apoptosis-associated genes encoded by nuclear DNA(nDNA). The gene chip provided by the invention is capable of detecting simultaneously the differential expression of the whole human mitochondrial mtDNA and nDNA under two different conditions, and analyzing the inherent correlation; and the invention represents the minimization and specialization of gene chip technology, and accomplishes the detection on expression of human mitochondrial mtDNA and nDNA efficiently and conveniently.
Description
Technical field
The invention belongs to and detect the experimental tool that human mitochondria gene is expressed, specifically, relate under a kind of detection two states the human mitochondria gene (mtDNA) and (nDNA) experimental tool of differential expression.
Background technology
At present, chip of expression spectrum is present most widely used gene chip, be with tens at least, thousands of special probe stationary can be in order to detect the difference of the numerous genetic transcription abundance in the whole genome scope on a carrier at most.The mRNA that chip of expression spectrum can be analyzed the above different sourcess of 2 groups or 2 groups transcribes the difference of abundance, by ratio that calculates signal and the information that difference expression gene is obtained in statistical study.But people are developed the high-throughput of gene chip emphatically at present, and its expensive experimental expense is hung back people to it in scientific research.People only are confined to indivedual genes to the research of chondriogen expression simultaneously, lack to the integral body understanding of mtDNA differential expression under different states with to it to carry out the analysis of inner link.
Summary of the invention
The object of the invention is to provide a kind of whole expression of human body chondriogen otherness, and analyzes the gene chip of the internal connection between a plurality of genetic expressions.
A kind of gene chip that detects differential expression of human mitochondria gene, point is shaped on and detects 13 kinds of mRNA that comprise the human mitochondria gene coding on the glass substrate that aminosilane is modified, 5 kinds of apoptosis-related genes of 2 kinds of rRNA and 9 kinds of tRNA genes and nuclear DNA (nDNA) coding are transcribed the probe of abundance, and its key is:
Described 13 kinds of mRNA are, the NADH-CoQ reductase subunit unit 1 (ND1) of oxidation-respiration chain combined enzyme agent I, NADH-CoQ reductase subunit unit 2 (ND2), NADH-CoQ reductase subunit unit 3 (ND3), NADH-CoQ reductase subunit unit 4 (ND4), the 4L of NADH-CoQ reductase subunit unit (ND4L), NADH-CoQ reductase subunit unit 5 (ND5), NADH-CoQ reductase subunit unit 6 (ND6), the cytochrome b of complex body III (Cytb), the Terminal oxidase subunit I of composite I V (Cox I), Terminal oxidase subunit I I (Cox II), Terminal oxidase subunit I II (CoxIII), and the ATP enzyme subunit 6 (ATPase6) of mixture V and ATP enzyme subunit 8 (ATPase8 or ND6L);
Described 2 kinds of rRNA are 12S ribosome-RNA(rRNA) (12SrRNA), 16S ribosome-RNA(rRNA) (16SrRNA);
Described 9 kinds of tRNA are, the L-Ala transfer RNA (tRNA-Ala) of mtDNA light chain coding, day radon acid amides transfer RNA (tRNA-Asn), halfcystine transfer RNA (tRNA-Cys), glutamate transport RNA (tRNA-Glu), Serine transfer RNA (tRNA-Ser), arginine transport RNA (tRNA-Arg), aspartic acid transfer RNA (tRNA-Asp), glycine transport RNA (tRNA-Gly), the Histidine transfer RNA (tRNA-His) of heavy chain coding;
5 kinds of apoptosis-related genes of described nuclear DNA (nDNA) coding are Bad, Bax, Bcl-2, Bcl2-L1, P53.
Also be shaped on house-keeping gene Acting β, GAPDH as positive internal reference on the glass substrate that above-mentioned aminosilane is modified, the people writes the negative internal reference of probe that length is the 69mer oligonucleotide sequence, and selects Hex (hexa-chloro-6-carboxy fluorescein) for detecting sampling point fixed positive control.
The sequence that 13 kinds of mRNA that detect described human mitochondria gene coding respectively transcribe the oligonucleotide probe of abundance is:
ND1:ACGCCATAAAACTCTTCACCAAAGAGCCCCTAAAACCCGCCACATCTACCATCACCCTCTACATCACCG;
ND2:ACAATAGCCTCATCATCCCCACCATCATAGCCACCATCACCCTCCTACCTCTACTTCTACCTACGCC;
ND3:AGAAATTGCCCTCCTTTTACCCCTACCATGAGCCCTACAAACAACTAACCTGCCACTAATAGTTATGTC;
ND4:CCGGCGCAGTCATTCTCATAATCGCCCACGGGCTTACATCCTCATTACTATTCTGCCTAGCAAACTCAA;
ND4L:TATTGTGCCTATTGCCATACTAGTCTTTGCCGCCTGCGAAGCAGCGGTGGGCCTAGCCCTACTAGTCTC;
ND5:ACAGGTCAACCTCGCTTCCCCACCCTTACTAACATTAACGAAAATAACCCCACCCTACTAAACCCCATT;
DN6:GTCAGGGGTTGAGGTCTTGGTGAGTGTTTTAGTGGGGTTAGCGATGGAGGTAGGATTCGTCCTGTGGGT;
Cytb:CCTGCCTGATCCTCCAAATCACCACAGGACTATTCCTAGCCATGCACTACTCACCAGACGCCTCAACCG;
Cox?I:AGCATATTTCACCTCCGCTACCATAATCATCGCTATCCCCACCGGCGTCAAAGTATTTAGCTGACTCGC;
Cox?II:CGCCCTCCCATCCCTACGCATCCTTTACATAACAGACGAGGTCAACGATCCCTCCCTTACCATCAAATC;
CoxIII:TCAGCCCTCCTAATGACCTCCGGCCTAGCCATGTGATTTCACTTCCACTCCATAACGCTCCTCATACTA;
ATPase6:TGCAGGCCACCTACTCATGCACCTAATTGGAAGCGCCACCCTAGCAATATCAACCATTAACCTTCCCTC;
ND6L:TTACCCCCATACTCCTTACACTATTCCTCATCACCCAACTAAAAATATTAAACACAAACTACCACCTAC;
Detect respectively described 2 kinds of rRNA transcribe abundance the sequence of oligonucleotide probe be:
12SrRNA:CACTATGCTTAGCCCTAAACCTCAACAGTTAAATCAACAAAACTGCTCGCCAGAACACTACGAGCCACA;
16SrRNA:GGATCAGGACATCCCGATGGTGCAGCCGCTATTAAAGGTTCGTTTGTTCAACGATTAAAGTCCTACGTG;
Detect respectively described 9 kinds of tRNA transcribe abundance the sequence of oligonucleotide probe be:
tRNA-Al:AAAGGGCTTAGCTTAATTAAAGTGCTGATTTGCGTTCAGTTGATGCAGAGTGGGGTTTTGCAGTCCTTA;
tRNA-Asn:TAGATTGAAGCCAGTTGATTAGGGTGCTTAGCTGTTAACTAAGTGTTTGTGGGTTTAAGTCCCATTGGT;
tRNA-Cys:AGCTCCGAGGTGATTTTCATATTGAATTGCAAATTCGAAGAAGCAGCTTCAAACCTGCCGGGGCTT;
tRNA-Glu:GTTCTTGTAGTTGAAATACAACGATGGTTTTTCATATCATTGGTCGTGGTTGTAGTCCGTGCGAGAATA;
tRNA-Ser:TTGAAAAAGTCATGGAGGCCATGGGGTTGGCTTGAAACCAGCTTTGGGGGGTTCGATTCCTTCCTTTTTTGT;
tRNA-Arg:TGGTATATAGTTTAAACAAAACGAATGATTTCGACTCATTAAATTATGATAATCATATTTACCAA;
tRNA-Asp:AAGGTATTAGAAAAACCATTTCATAACTTTGTCAAAGTTAAATTATAGGCTAAATCCTATATATCTTA;
tRNA-Gly:ACTCTTTTAGTATAAATAGTACCGTTAACTTCCAATTAACTAGTTTTGACAACATTCAAAAAAGAGTA;
tRNA-His:GTAAATATAGTTTAACCAAAACATCAGATTGTGAATCTGACAACAGAGGCTTACGACCCCTTCTTTACC;
5 kinds of apoptosis-related genes Bad, Bax, Bcl-2, Bcl2-L1, P53 that detect described nuclear DNA (nDNA) coding respectively transcribe abundance the sequence of oligonucleotide probe be:
Bad:GGGGAAGCTCAGGGGCCTTTGGTGAAGATTTAGGTTAACTTCTCATTAATCCCACGAATCCTTACCGAG;
Bax:TTTTCCGAGTGGCAGCTGACATGTTTTCTGACGGCAACTTCAACTGGGGCCGGGTTGTCGCCCTTTTCT;
Bcl-2:CTGTTCCATGTCTTTGGACAACCATGACCTTGGACAATCATGAAATATGCATCTCACTGGATGCAAAGA;
Bcl2-L1:GTGAGCAGGTGTTTTGGACAATGGACTGGTTGAGCCCATCCCTATTATAAAAATGTCTCAGAGCAACCG;
P53:GAGCTGGAAGGGTCAACATCTTTTACATTCTGCAAGCACATCTGCATTTTCACCCCACCCTTCCCCTCC;
Above-mentioned every kind of gene probe all repeats a system three times on the slide that aminosilane is modified.
Beneficial effect: gene chip of the present invention can detect whole human body plastosome mtDNA and the differential expression situation of nDNA under two kinds of different states simultaneously, and analyzes its inner link; With biochip technology miniaturization, specialization, finish detection efficiently, easily to human body plastosome mtDNA and nDNA expression.
Description of drawings
Fig. 1 is a scintigram behind the chip point sample;
Fig. 2 is a scintigram behind the chip hybridization.
Embodiment
Embodiment 1
At first select 13 kinds of mRNA of mtDNA coding, 2 kinds of rRNA, 5 kinds of apoptosis-related genes of 9 kinds of tRNA and nuclear gene (nDNA) coding.Specifically comprise, NADH-CoQ reductase subunit unit 1 (ND1), NADH-CoQ reductase subunit unit 2 (ND2), NADH-CoQ reductase subunit unit 3 (ND3), NADH-CoQ reductase subunit unit 4 (ND4), the 4L of NADH-CoQ reductase subunit unit (ND4L), NADH-CoQ reductase subunit unit 5 (ND5), NADH-CoQ reductase subunit unit 6 (ND6), the cytochrome b of complex body III (Cytb), the Terminal oxidase subunit I of composite I V (Cox I), Terminal oxidase subunit I I (Cox II), Terminal oxidase subunit I II (CoxIII), and the ATP enzyme subunit 6 (ATPase6) of mixture V and ATP enzyme subunit 8 (ATPase8 or ND6L), L-Ala transfer RNA (tRNA-Ala), it radon acid amides transfer RNA (tRNA-Asn), halfcystine transfer RNA (tRNA-Cys), glutamate transport RNA (tRNA-Glu), Serine transfer RNA (tRNA-Ser), the arginine transport RNA (tRNA-Arg) of heavy chain coding, aspartic acid transfer RNA (tRNA-Asp), glycine transport RNA (tRNA-Gly), Histidine transfer RNA (tRNA-His), and the relevant nDNA encoding gene Bad of apoptosis that brings into play function at mitochondrial inner membrane, Bax, Bcl-2, Bcl2-L1, P53.Comprise 29 of target genes altogether.The probe that relates to 29 target genes then, principle of design is: the about 69mer of length, Tm value as far as possible near 42 ℃, choose in sequence near 3 ', self no hairpin structure, the sequence and do not contain the AAAA sequence as far as possible as far as possible.
The sequence that 13 kinds of mRNA that detect described human mitochondria gene coding respectively transcribe the oligonucleotide probe of abundance is:
ND1:ACGCCATAAAACTCTTCACCAAAGAGCCCCTAAAACCCGCCACATCTACCATCACCCTCTACATCACCG;
ND2:ACAATAGCCTCATCATCCCCACCATCATAGCCACCATCACCCTCCTACCTCTACTTCTACCTACGCC;
ND3:AGAAATTGCCCTCCTTTTACCCCTACCATGAGCCCTACAAACAACTAACCTGCCACTAATAGTTATGTC;
ND4:CCGGCGCAGTCATTCTCATAATCGCCCACGGGCTTACATCCTCATTACTATTCTGCCTAGCAAACTCAA;
ND4L:TATTGTGCCTATTGCCATACTAGTCTTTGCCGCCTGCGAAGCAGCGGTGGGCCTAGCCCTACTAGTCTC;
ND5:ACAGGTCAACCTCGCTTCCCCACCCTTACTAACATTAACGAAAATAACCCCACCCTACTAAACCCCATT;
DN6:GTCAGGGGTTGAGGTCTTGGTGAGTGTTTTAGTGGGGTTAGCGATGGAGGTAGGATTCGTCCTGTGGGT;
Cytb:CCTGCCTGATCCTCCAAATCACCACAGGACTATTCCTAGCCATGCACTACTCACCAGACGCCTCAACCG;
Cox?I:AGCATATTTCACCTCCGCTACCATAATCATCGCTATCCCCACCGGCGTCAAAGTATTTAGCTGACTCGC;
Cox?II:CGCCCTCCCATCCCTACGCATCCTTTACATAACAGACGAGGTCAACGATCCCTCCCTTACCATCAAATC;
CoxIII:TCAGCCCTCCTAATGACCTCCGGCCTAGCCATGTGATTTCACTTCCACTCCATAACGCTCCTCATACTA;
ATPase6:TGCAGGCCACCTACTCATGCACCTAATTGGAAGCGCCACCCTAGCAATATCAACCATTAACCTTCCCTC;
ND6L:TTACCCCCATACTCCTTACACTATTCCTCATCACCCAACTAAAAATATTAAACACAAACTACCACCTAC;
Detect respectively described 2 kinds of rRNA transcribe abundance the sequence of oligonucleotide probe be:
12SrRNA:CACTATGCTTAGCCCTAAACCTCAACAGTTAAATCAACAAAACTGCTCGCCAGAACACTACGAGCCACA;
16SrRNA:GGATCAGGACATCCCGATGGTGCAGCCGCTATTAAAGGTTCGTTTGTTCAACGATTAAAGTCCTACGTG;
Detect respectively described 9 kinds of tRNA transcribe abundance the sequence of oligonucleotide probe be:
tRNA-Al:AAAGGGCTTAGCTTAATTAAAGTGCTGATTTGCGTTCAGTTGATGCAGAGTGGGGTTTTGCAGTCCTTA;
tRNA-Asn:TAGATTGAAGCCAGTTGATTAGGGTGCTTAGCTGTTAACTAAGTGTTTGTGGGTTTAAGTCCCATTGGT;
tRNA-Cys:AGCTCCGAGGTGATTTTCATATTGAATTGCAAATTCGAAGAAGCAGCTTCAAACCTGCCGGGGCTT;
tRNA-Glu:GTTCTTGTAGTTGAAATACAACGATGGTTTTTCATATCATTGGTCGTGGTTGTAGTCCGTGCGAGAATA;
tRNA-Ser:TTGAAAAAGTCATGGAGGCCATGGGGTTGGCTTGAAACCAGCTTTGGGGGGTTCGATTCCTTCCTTTTTTGT;
tRNA-Arg:TGGTATATAGTTTAAACAAAACGAATGATTTCGACTCATTAAATTATGATAATCATATTTACCAA;
tRNA-Asp:AAGGTATTAGAAAAACCATTTCATAACTTTGTCAAAGTTAAATTATAGGCTAAATCCTATATATCTTA;
tRNA-Gly:ACTCTTTTAGTATAAATAGTACCGTTAACTTCCAATTAACTAGTTTTGACAACATTCAAAAAAGAGTA;
tRNA-His:GTAAATATAGTTTAACCAAAACATCAGATTGTGAATCTGACAACAGAGGCTTACGACCCCTTCTTTACC;
5 kinds of apoptosis-related genes Bad, Bax, Bcl-2, Bcl2-L1, P53 that detect described nuclear DNA (nDNA) coding respectively transcribe abundance the sequence of oligonucleotide probe be:
Bad:GGGGAAGCTCAGGGGCCTTTGGTGAAGATTTAGGTTAACTTCTCATTAATCCCACGAATCCTTACCGAG;
Bax:TTTTCCGAGTGGCAGCTGACATGTTTTCTGACGGCAACTTCAACTGGGGCCGGGTTGTCGCCCTTTTCT;
Bcl-2:CTGTTCCATGTCTTTGGACAACCATGACCTTGGACAATCATGAAATATGCATCTCACTGGATGCAAAGA;
Bcl2-L1:GTGAGCAGGTGTTTTGGACAATGGACTGGTTGAGCCCATCCCTATTATAAAAATGTCTCAGAGCAACCG;
P53:GAGCTGGAAGGGTCAACATCTTTTACATTCTGCAAGCACATCTGCATTTTCACCCCACCCTTCCCCTCC;
The oligonucleotide probe normal-temperature dissolution is in the sterilization distilled water, and making the probe molecule final concentration is 40 μ mol/L, and mixes at 1: 1 with the DMSO that contains 1,/20 ten thousand Cy3.The probe mixed solution is put on the glass substrate of modifying to aminosilane the diameter 150 μ m of sampling point, spacing 25 μ m according to design matrix in advance with the Genemachines chip point sample instrument of U.S. Genomic Solution company.Except that target gene, also comprise positive internal reference (Acting β, GAPDH), negative internal reference Negative (people is the oligonucleotide sequence of writing), blank (sampling point that does not contain oligonucleotide), chip wash-out check point fluorescein Hex on the chip, each probe is done 3 and is repeated a little, comprises 132 sampling points on the entire chip altogether.
Routine table 1 is the position of each probe on chip down:
The position of each probe on chip, the position of each probe on chip can be arranged arbitrarily, also can be different and the arrangement mode of table 1, belong within protection scope of the present invention equally.
Fig. 1 is for detecting the gene chip entire scan figure of differential expression of human mitochondria gene, each green round dot is the sampling point of different genes probe points on aminosilane modification slide on the chip, the probe that contains 40 μ mol/L concentration in the sampling liquid, and contain 1,/20 ten thousand Cy3, but so point sample situation of display chip after the scanning, as seen all gene sampling points distributions are regular, and point sample is even, no leak source.The diameter 150 μ m of sampling point, spacing 25 μ m.Contained 29 target genes and positive control, negative control are distributed in the dot matrix successively.
Fig. 2 is the scintigram after chip and the sample to be tested hybridization, and RNA difference mark red fluorescence and green fluorescence from two kinds of different samples according to different fluorescence ratios, can detect the relative different expression of mtDNA under the two states.
Claims (7)
1, a kind of gene chip that detects differential expression of human mitochondria gene, point is shaped on and detects 13 kinds of mRNA that comprise the human mitochondria gene coding on the glass substrate that aminosilane is modified, 5 kinds of apoptosis-related genes of 2 kinds of rRNA and 9 kinds of tRNA genes and nuclear DNA (nDNA) coding are transcribed the probe of abundance, it is characterized in that:
Described 13 kinds of mRNA are, the NADH-CoQ reductase subunit unit 1 (ND1) of oxidation-respiration chain combined enzyme agent I, NADH-CoQ reductase subunit unit 2 (ND2), NADH-CoQ reductase subunit unit 3 (ND3), NADH-CoQ reductase subunit unit 4 (ND4), the 4L of NADH-CoQ reductase subunit unit (ND4L), NADH-CoQ reductase subunit unit 5 (ND5), NADH-CoQ reductase subunit unit 6 (ND6), the cytochrome b of complex body III (Cytb), the Terminal oxidase subunit I of composite I V (Cox I), Terminal oxidase subunit I I (Cox II), Terminal oxidase subunit I II (Cox III), and the ATP enzyme subunit 6 (ATPase6) of mixture V and ATP enzyme subunit 8 (ATPase8 or ND6L);
Described 2 kinds of rRNA are 12S ribosome-RNA(rRNA) (12SrRNA), 16S ribosome-RNA(rRNA) (16SrRNA);
Described 9 kinds of tRNA are, the L-Ala transfer RNA (tRNA-Ala) of mtDNA light chain coding, day radon acid amides transfer RNA (tRNA-Asn), halfcystine transfer RNA (tRNA-Cys), glutamate transport RNA (tRNA-Glu), Serine transfer RNA (tRNA-Ser), arginine transport RNA (tRNA-Arg), aspartic acid transfer RNA (tRNA-Asp), glycine transport RNA (tRNA-Gly), the Histidine transfer RNA (tRNA-His) of heavy chain coding;
5 kinds of apoptosis-related genes of described nuclear DNA (nDNA) coding comprise Bad, Bax, Bcl-2, Bcl2-L1, P53.
2, the gene chip of detection differential expression of human mitochondria gene according to claim 1, it is characterized in that: also be shaped on house-keeping gene Acting β, GAPDH as positive internal reference on the glass substrate that described aminosilane is modified, the people writes the negative internal reference of probe that length is the 69mer oligonucleotide sequence, and selects Hex (hexa-chloro-6-carboxy fluorescein) for detecting sampling point fixed positive control.
3, the gene chip of detection differential expression of human mitochondria gene according to claim 1, the sequence that 13 kinds of mRNA that it is characterized in that detecting respectively described human mitochondria gene coding transcribe the oligonucleotide probe of abundance is:
ND1:ACGCCATAAAACTCTTCACCAAAGAGCCCCTAAAACCCGCCACATCTACCATCACCCTCTACATCACCG;
ND2:ACAATAGCCTCATCATCCCCACCATCATAGCCACCATCACCCTCCTACCTCTACTTCTACCTACGCC;
ND3:AGAAATTGCCCTCCTTTTACCCCTACCATGAGCCCTACAAACAACTAACCTGCCACTAATAGTTATGTC;
ND4:CCGGCGCAGTCATTCTCATAATCGCCCACGGGCTTACATCCTCATTACTATTCTGCCTAGCAAACTCAA;
ND4L:TATTGTGCCTATTGCCATACTAGTCTTTGCCGCCTGCGAAGCAGCGGTGGGCCTAGCCCTACTAGTCTC;
ND5:ACAGGTCAACCTCGCTTCCCCACCCTTACTAACATTAACGAAAATAACCCCACCCTACTAAACCCCATT;
DN6:GTCAGGGGTTGAGGTCTTGGTGAGTGTTTTAGTGGGGTTAGCGATGGAGGTAGGATTCGTCCTGTGGGT;
Cytb:CCTGCCTGATCCTCCAAATCACCACAGGACTATTCCTAGCCATGCACTACTCACCAGACGCCTCAACCG;
Cox?I:AGCATATTTCACCTCCGCTACCATAATCATCGCTATCCCCACCGGCGTCAAAGTATTTAGCTGACTCGC;
Cox?II:CGCCCTCCCATCCCTACGCATCCTTTACATAACAGACGAGGTCAACGATCCCTCCCTTACCATCAAATC;
Cox?III:TCAGCCCTCCTAATGACCTCCGGCCTAGCCATGTGATTTCACTTCCACTCCATAACGCTCCTCATACTA;
ATPase6:TGCAGGCCACCTACTCATGCACCTAATTGGAAGCGCCACCCTAGCAATATCAACCATTAACCTTCCCTC;
ND6L:TTACCCCCATACTCCTTACACTATTCCTCATCACCCAACTAAAAATATTAAACACAAACTACCACCTAC
。
4, the gene chip of detection differential expression of human mitochondria gene according to claim 1, it is characterized in that detecting respectively described 2 kinds of rRNA transcribe abundance the sequence of oligonucleotide probe be:
12SrRNA:CACTATGCTTAGCCCTAAACCTCAACAGTTAAATCAACAAAACTGCTCGCCAGAACACTACGAGCCACA;
16SrRNA:GGATCAGGACATCCCGATGGTGCAGCCGCTATTAAAGGTTCGTTTGTTCAACGATTAAAGTCCTACGTG。
5, the gene chip of detection differential expression of human mitochondria gene according to claim 1, it is characterized in that detecting respectively described 9 kinds of tRNA transcribe abundance the sequence of oligonucleotide probe be:
tRNA-Al:AAAGGGCTTAGCTTAATTAAAGTGCTGATTTGCGTTCAGTTGATGCAGAGTGGGGTTTTGCAGTCCTTA;
tRNA-Asn:TAGATTGAAGCCAGTTGATTAGGGTGCTTAGCTGTTAACTAAGTGTTTGTGGGTTTAAGTCCCATTGGT;
tRNA-Cys:AGCTCCGAGGTGATTTTCATATTGAATTGCAAATTCGAAGAAGCAGCTTCAAACCTGCCGGGGCTT;
tRNA-Glu:GTTCTTGTAGTTGAAATACAACGATGGTTTTTCATATCATTGGTCGTGGTTGTAGTCCGTGCGAGAATA;
tRNA-Ser:TTGAAAAAGTCATGGAGGCCATGGGGTTGGCTTGAAACCAGCTTTGGGGGGTTCGATTCCTTCCTTTTTTGT;
tRNA-Arg:TGGTATATAGTTTAAACAAAACGAATGATTTCGACTCATTAAATTATGATAATCATATTTACCAA;
tRNA-Asp:AAGGTATTAGAAAAACCATTTCATAACTTTGTCAAAGTTAAATTATAGGCTAAATCCTATATATCTTA;
tRNA-Gly:ACTCTTTTAGTATAAATAGTACCGTTAACTTCCAATTAACTAGTTTTGACAACATTCAAAAAAGAGTA;
6, the gene chip of detection differential expression of human mitochondria gene according to claim 1,5 kinds of apoptosis-related genes Bad, Bax, Bcl-2, Bcl2-L1, P53 that it is characterized in that detecting respectively described nuclear DNA (nDNA) coding transcribe abundance the sequence of oligonucleotide probe be:
Bad:GGGGAAGCTCAGGGGCCTTTGGTGAAGATTTAGGTTAACTTCTCATTAATCCCACGAATCCTTACCGAG;
Bax:TTTTCCGAGTGGCAGCTGACATGTTTTCTGACGGCAACTTCAACTGGGGCCGGGTTGTCGCCCTTTTCT;
Bcl-2:CTGTTCCATGTCTTTGGACAACCATGACCTTGGACAATCATGAAATATGCATCTCACTGGATGCAAAGA;
Bcl2-L1:GTGAGCAGGTGTTTTGGACAATGGACTGGTTGAGCCCATCCCTATTATAAAAATGTCTCAGAGCAACCG;
7, the gene chip of detection differential expression of human mitochondria gene according to claim 1 is characterized in that: described every kind of gene probe all repeats a system three times on the slide that aminosilane is modified.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CNA2008100701097A CN101440397A (en) | 2008-08-13 | 2008-08-13 | Gene chip for detecting differential expression of human mitochondria gene |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CNA2008100701097A CN101440397A (en) | 2008-08-13 | 2008-08-13 | Gene chip for detecting differential expression of human mitochondria gene |
Publications (1)
Publication Number | Publication Date |
---|---|
CN101440397A true CN101440397A (en) | 2009-05-27 |
Family
ID=40725007
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CNA2008100701097A Pending CN101440397A (en) | 2008-08-13 | 2008-08-13 | Gene chip for detecting differential expression of human mitochondria gene |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN101440397A (en) |
Cited By (6)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN103088125A (en) * | 2012-12-22 | 2013-05-08 | 安徽师范大学 | Method for sequencing partial DNA of mitochondria ND5 gene of brachionus rotifera and authenticating brachionus rotifera |
CN103290114A (en) * | 2013-05-12 | 2013-09-11 | 浙江大学 | Kit for detecting mutation of mitochondria T12201C related with epicophosis and application |
CN103320511A (en) * | 2013-05-31 | 2013-09-25 | 张更谦 | Medicolegal identification method of species |
CN105483124A (en) * | 2015-12-22 | 2016-04-13 | 福建国际旅行卫生保健中心 | Rapid identification chip of DNA of mosquitos and identification method of chip |
CN108152497A (en) * | 2017-11-29 | 2018-06-12 | 天津市湖滨盘古基因科学发展有限公司 | The atp synthase mutain of people a kind of and its application |
CN113278612A (en) * | 2021-05-24 | 2021-08-20 | 青岛大学附属医院 | TiRNA-Cys-GCA and application thereof in aortic dissection diseases |
-
2008
- 2008-08-13 CN CNA2008100701097A patent/CN101440397A/en active Pending
Cited By (9)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN103088125A (en) * | 2012-12-22 | 2013-05-08 | 安徽师范大学 | Method for sequencing partial DNA of mitochondria ND5 gene of brachionus rotifera and authenticating brachionus rotifera |
CN103290114A (en) * | 2013-05-12 | 2013-09-11 | 浙江大学 | Kit for detecting mutation of mitochondria T12201C related with epicophosis and application |
CN103320511A (en) * | 2013-05-31 | 2013-09-25 | 张更谦 | Medicolegal identification method of species |
CN103320511B (en) * | 2013-05-31 | 2015-07-01 | 张更谦 | Medicolegal identification method of species |
CN105483124A (en) * | 2015-12-22 | 2016-04-13 | 福建国际旅行卫生保健中心 | Rapid identification chip of DNA of mosquitos and identification method of chip |
CN105483124B (en) * | 2015-12-22 | 2018-08-28 | 福建国际旅行卫生保健中心 | Mosquito Rapid identification DNA chip and its identification method |
CN108152497A (en) * | 2017-11-29 | 2018-06-12 | 天津市湖滨盘古基因科学发展有限公司 | The atp synthase mutain of people a kind of and its application |
CN113278612A (en) * | 2021-05-24 | 2021-08-20 | 青岛大学附属医院 | TiRNA-Cys-GCA and application thereof in aortic dissection diseases |
CN113278612B (en) * | 2021-05-24 | 2022-06-17 | 青岛大学附属医院 | TiRNA-Cys-GCA and application thereof in aortic dissection diseases |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
AU2017200433B2 (en) | Multivariate diagnostic assays and methods for using same | |
Husale et al. | DNA nanomechanics allows direct digital detection of complementary DNA and microRNA targets | |
Chapin et al. | Rapid microRNA profiling on encoded gel microparticles | |
de Planell-Saguer et al. | Analytical aspects of microRNA in diagnostics: a review | |
Roy et al. | A microfluidic-assisted microarray for ultrasensitive detection of miRNA under an optical microscope | |
CN101440397A (en) | Gene chip for detecting differential expression of human mitochondria gene | |
Gilboa et al. | Single-molecule analysis of nucleic acid biomarkers–A review | |
Wu et al. | SERS-PCR assays of SARS-CoV-2 target genes using Au nanoparticles-internalized Au nanodimple substrates | |
Veselinyová et al. | Selected in situ hybridization methods: principles and application | |
US20140073520A1 (en) | Imaging chromosome structures by super-resolution fish with single-dye labeled oligonucleotides | |
CN104312914B (en) | A kind of protein molecule electronic device based on nano-pore structure | |
Liu et al. | Integrating single-cell RNA-seq and imaging with SCOPE-seq2 | |
Song et al. | Highly sensitive SERS assay of DENV gene via a cascade signal amplification strategy of localized catalytic hairpin assembly and hybridization chain reaction | |
Gilbride | Molecular methods for the detection of waterborne pathogens | |
Shepard | Polychromatic microarrays: simultaneous multicolor array hybridization of eight samples | |
Li et al. | Highly sensitive and label-free detection of DILI microRNA biomarker via target recycling and primer exchange reaction amplifications | |
Zhu et al. | Amperometric detection of DNA hybridization using a multi-point, addressable electrochemical device | |
CN106033087B (en) | The method system of built-in property standard curve detection substance molecular number | |
Joo et al. | Highly selective FRET-aided single-molecule counting of microRNAs labeled by splinted ligation | |
Ahmed | Microarray RNA transcriptional profiling: part I. Platforms, experimental design and standardization | |
US11091803B2 (en) | Nucleic acid quantification method | |
Zhou et al. | Sensitive monitoring of RNA transcription levels using a graphene oxide fluorescence switch | |
Viale et al. | Big results from small samples: evaluation of amplification protocols for gene expression profiling | |
CN104357549A (en) | Method for digitally and quantitatively detecting nucleic acid based on DNA (deoxyribonucleic acid) chip | |
CN1263843C (en) | PCR amplifieation tube in use for multistep reaction |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
WD01 | Invention patent application deemed withdrawn after publication |
Open date: 20090527 |