CN113265474B

CN113265474B - Detection primer group and probe group for digital PCR (polymerase chain reaction) chimerism rate and application thereof

Info

Publication number: CN113265474B
Application number: CN202110810991.XA
Authority: CN
Inventors: 张秀莲; 郑仲征; 杜可明; 袁志阳; 肖培莉
Original assignee: Shanghai Dishuobeiken Gene Technology Co ltd; Shanghai Tissuebank Biotechnology Co ltd; Shanghai Tissuebank Medical Laboratory Co ltd; Shenzhen Tissuebank Precision Medicine Co ltd
Current assignee: Shanghai Dishuobeiken Gene Technology Co ltd; Shanghai Tissuebank Biotechnology Co ltd; Shanghai Tissuebank Medical Laboratory Co ltd; Shenzhen Tissuebank Precision Medicine Co ltd
Priority date: 2021-07-19
Filing date: 2021-07-19
Publication date: 2021-11-02
Anticipated expiration: 2041-07-19
Also published as: CN113265474A

Abstract

The invention provides a detection primer group and a probe group for digital PCR (polymerase chain reaction) chimerism rate and application thereof, which are characterized in that 14 Indel sites aiming at the high individual recognition rate of Asian population are screened out based on Indel site data and the Asian population, and a specific primer is designed aiming at each site, wherein the primer group comprises the following 14 primer pairs and 14 probe groups. The primer group and the detection method provided by the invention and the chimerism rate result obtained by the primer group and the detection method can be applied to a patient after hematopoietic stem cell transplantation, and have the characteristics of higher coverage rate, high sensitivity and wide linear range.

Description

Detection primer group and probe group for digital PCR (polymerase chain reaction) chimerism rate and application thereof

Technical Field

The invention relates to the field of detection by a digital PCR method, in particular to a primer group and a probe group for detecting the chimeric rate of digital PCR and application thereof.

Background

With the gradual maturity of the allogeneic hematopoietic stem cell transplantation technology, the number of related transplantation cases is rapidly increased, and the analysis of the chimeric state of the hematopoietic cells after transplantation is an important method for evaluating the implantation effect of donor cells and an important detection item for prompting postoperative recurrence. At present, two detection methods of STR and qPCR are mainly used for detecting the chimerism rate, wherein the STR is a gold standard for detecting the chimerism rate, but the STR is mainly applied to a first-generation sequencing platform, and common PCR amplification only has a primer set, has the influence of amplification efficiency and nonspecific amplification, and has lower sensitivity which is only 1% -5%; although qPCR includes a primer set and a probe set, it reduces non-specific amplification compared to STR, but it is affected by amplification efficiency, and there is a difference in amplification efficiency of different primers during amplification, and it needs to rely on CT value to reflect its original template amount, resulting in sensitivity of only 0.1%. Both detection methods can only verify recurrence, have no capacity of predicting recurrence and prompting recurrence risk in early stage, and have certain hysteresis for monitoring recurrence. The digital PCR has high accuracy and can be absolutely quantified; the sample demand is low; the detection sensitivity is high; high tolerance and the like, can reflect the early microscopic condition that the chimerism rate of a patient is below 0.1 percent, and realize the 'early prediction', 'early intervention', 'early rescue' of the transplantation relapse. The project applies the digital PCR to the detection of the embedding degree after transplantation so as to improve the detection sensitivity and accuracy of the embedding degree.

The digital PCR method for detecting the mosaic is the technical optimization of the prior STR-PCR and micro-mosaic method, 1.5 million patients are transplanted every year in China, the mosaic monitoring clinical significance is clear, the recurrence prediction is reliable, the market capacity is large, and the method belongs to the hundred million-level market. Moreover, due to the technical advantages of the digital PCR method compared with the STR-PCR method, under the conditions that the detection cost is not increased and the report progress is normal, from the research result, customers are willing to adopt a more sensitive and accurate digital PCR method, and the project development prospect is very wide.

Disclosure of Invention

The invention provides a primer group and a probe group for detecting the digital PCR chimerism rate and application thereof, which aim to solve at least one technical problem.

In order to solve the above problems, as an aspect of the present invention, there is provided a primer set for detecting digital PCR chimerism rate, wherein based on Indel site data, 14 Indel sites with high individual recognition rate for asian population are selected based on asian population, and a specific primer is designed for each site, including the following 14 primer pairs:

preferably, the forward and reverse primers are located at least 10bp before and after the del/indel position, respectively.

The invention also provides a detection probe set for the digital PCR chimerism rate, which is characterized in that 14 Indel sites aiming at the high individual recognition rate of Asian population are screened out based on the Indel site data and the Asian population, and a specific probe set is designed aiming at each site, wherein the detection probe set comprises the following 14 probe pairs:

The invention also provides application of the primer group for detecting the digital PCR chimerism rate and the probe group for detecting the digital PCR chimerism rate in preparing a chimerism detection reagent.

The primer group and the detection method provided by the invention and the chimerism rate result obtained by the primer group and the detection method can be applied to a patient after hematopoietic stem cell transplantation, and have the characteristics of higher coverage rate, high sensitivity and wide linear range.

Drawings

FIG. 1 is a graph showing the amplification efficiency of the primer N1-2 according to the present invention;

FIG. 2 is a graph showing the result of detection of the heterozygous genetic marker N1-2 according to the present invention;

FIGS. 3(a) and 3(b) are graphs showing the results of detection of blank standards for the genetic markers N1-2 (+), N1-2 (-);

FIG. 4(a), FIG. 4(b), FIG. 4(c), FIG. 4(d), FIG. 4(e) and FIG. 4(f) are graphs showing the results of detection of the standard (50%, 10%, 2%, 0.4%, 0.08% and 0.016%) of the genetic marker N1-2 (+) of the present invention.

Detailed Description

The following detailed description of embodiments of the invention, but the invention can be practiced in many different ways, as defined and covered by the claims.

The invention discloses a primer and probe combination based on digital PCR chimeric detection and a method for chimeric detection by using the primer and probe combination.

Based on Indel site data, 14 Indel sites with high individual recognition rate for Asian population are screened out based on the Asian population, and specific primer and probe combinations are further designed for each site. The primer group consists of 28 primers, and the probe group consists of 28 primers. The primer group and the detection method provided by the invention and the chimerism rate result obtained by the primer group and the detection method can be applied to a patient after hematopoietic stem cell transplantation, and have the characteristics of higher coverage rate, high sensitivity and wide linear range.

The primer group consists of 28 primers, the probe group consists of 28 primers, the forward and reverse primers are respectively located at least 10bp positions before and after the del/indel position, each pair of primers can stably amplify a del/indel product, the MGB probe group respectively designs a probe (+) and a probe (-) aiming at the del/indel position and can accurately react with the del/indel amplification product, the dual control of a detection site is realized by applying a method of combining the specific primers and the MGB probe, the specificity of the detection site and the accuracy of the result are ensured, the specificity is good, and the sensitivity is high.

Step 1, extracting DNA of a sample to be detected, diluting the DNA to about 40 ng/mu L by using RNase-Free ddH2O, mixing uniformly and centrifuging for later use.

And 2, the concentrations of the primer mother liquor and the probe mother liquor are both 100uM, the concentration of each primer in the working solution is 9uM, and the concentration of the probe is 9 uM. The working solution preparation scheme is as follows: 9ul and 6ul of each primer probe stock solution in each tube were taken, and finally 100 ul of M ltraPure ™ DNase/RNase-Free Distilled Water (Invitrogen, cat. No. 10977-015) was used for complementation.

Step 3, preparing a chip set of the acute digital PCR instrument, uniformly mixing reagents, centrifuging for a short time for standby, preparing 8 connecting pipes according to a digital PCR reaction table, numbering, and preparing a digital PCR reaction system according to the following table:

and 4, oscillating the 8-connection pipe for short-time centrifugation for later use.

And 5, adding 75ul of wrapping oil into corresponding hole positions in the digital chip, transferring 20ul of reaction liquid in the 8-way tube to a circular hole of the chip, and adding liquid-phase oil into the circular hole (so that the oil covers the surface of the reaction liquid and the bubbles are not added) while paying attention to the process that no bubbles are added.

And 6, covering a soft rubber cover on the machine, and finishing the sample adding in the step 10 within 10min as much as possible.

And 7, running a program on the sharp digital PCR instrument (the position of the chip needs to be correctly selected according to the actual placement condition):

step 8, off-line analysis

Opening the PCR analyzer, clicking "move out", putting the amplified chip together with the chip rack into the analyzer, clicking "move in" touch screen to select numbers 1-16, inputting the number in "plate name", selecting "mutation detection" in "experiment type", reserving FAM and HEX for the fluorescence channel of "target", clicking "add", and clicking "scan sample". At which time the instrument begins to analyze the chip results. The data were copied after the analysis was completed as follows: and inserting a USB flash disk into the USB interface, clicking 'settings' on the analysis interface, clicking 'data export', finding a file name, and clicking 'export'.

The first embodiment is as follows: design and Synthesis of primers

InDel site screening

The InDel locus is screened by adopting the following principle:

1. the length difference (the number of inserted or deleted bases) of the InDel allele fragments is more than 3bp and less than 30 bp;

2. located on 22 human autosomes;

3. the spacing between InDel sites on the same chromosome is more than 5 Mb;

4. minimum Allele Frequency (MAF) between 0.30 and 0.50 (based on the east asian population);

5. the total number of the sites is not less than 30, and the accumulated individual identification rate reaches more than 0.9999;

6. no linkage is formed on the same chromosome, and the distribution in the population conforms to Hardy-Weinberg genetic balance;

7. to avoid the InDel sites being associated with certain specific disease phenotypes, it is preferred that polymorphic sites be located in the intron regions.

By adopting the principle, primary screening is carried out on InDel sites with stronger polymorphism through websites shown by http:// www.ensemb1.org/index. html and http:// www.ncbi.nlm.nih.gov/projects/SNP, and finally 14 InDel sites are selected, wherein the sites are respectively as follows: n1-1(rs2308010), N1-2(rs34855933), N1-3(rs34855933), N2-1(rs3042783), N5-4(rs1610932), N21-1(rs16663), N9-1(rs2308112), N11-1(rs2307696), N13-1(rs3038530), N14-1(rs2067204), N16-2(rs2067204), N7-2(rs 1041618), N8-1(rs3081400) and N22-1(rs6481), wherein the number rs in brackets indicates the number of the site in dbSNP database.

EXAMPLE two primer and Probe specificity test

5 insertion homozygotes, deletion homozygotes and heterozygotes are respectively selected for carrying out digital PCR for detecting the specificity of the primer and the probe.

1. Digital PCR amplification system

A 20uL digital PCR amplification system was used: 10uL 2 × dPCR Mix reaction; luL 9uM primer; luL 6uM probe; 8uL 40ng/uL DNA.

2. Digital PCR reaction conditions

The following fluorescent PCR reaction conditions were used: pre-denaturation at 95 ℃ for 10min, then annealing and extension at 95 ℃ for 30 s-55 ℃ for 1min, and carrying out 39 cycles in total, denaturation at 98 ℃ for 10min, and extension at 20 ℃ for 2 min.

3. Opening the PCR analyzer, clicking "move out", putting the amplified chip together with the chip rack into the analyzer, clicking "move in" touch screen to select numbers 1-16, inputting the number in "plate name", selecting "mutation detection" in "experiment type", reserving FAM and HEX for the fluorescence channel of "target", clicking "add", and clicking "scan sample". At which time the instrument begins to analyze the chip results. The data were copied after the analysis was completed as follows: and inserting a USB flash disk into the USB interface, clicking 'settings' on the analysis interface, clicking 'data export', finding a file name, and clicking 'export'.

4. Specificity determination

The state of each genetic marker insertion/deletion is judged through a signal value, and if FAM, HEX, double negative and double positive groups are obvious, the specificity of the primer and the probe is good. Taking the Nl-2(+) insertion genetic marker as an example, FAM signal values are distributed between 4000-7000, HEX signal values are distributed between 3000-5000 and double negativity are below 2000, indicating that the specificity of the primer and the probe is good.

The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention, and various modifications and changes may be made by those skilled in the art. Any modification, equivalent replacement, or improvement made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

Claims

1. A detection primer group and a detection probe group for digital PCR chimerism rate are characterized in that 14 Indel sites aiming at high individual recognition rate of Asian population are screened out based on the Indel site data and the Asian population, and a specific primer is designed aiming at each site, wherein the detection primer group comprises the following primer pairs:

the primer pair 1 has an insertion sequence of TCAG, and comprises a primer rs2308010-F and a primer rs2308010-R, wherein the primer rs2308010-F is ACACAATTAAAACAAATGTACCATCCAG, and the primer rs2308010-R is ATCATCAAACTCAACTAGGGGATAA;

the primer pair 2 has an insertion sequence of CTGT and comprises a primer rs34855933-F and a primer rs34855933-R, wherein the primer of the primer rs34855933-F is CGCAGAGGTGGAGGATACAAATAG, and the primer of the primer rs34855933-R is AACAGAGTGAAGCTGCTGACAAC;

the primer pair 3 has an insertion sequence of CTCA, and comprises a primer rs4646006-F and a primer rs4646006-R, wherein the primer of the primer rs4646006-F is AATAATGAAGAGATCAGCAAAGGC, and the primer of the primer rs4646006-R is TTATATGCCTCTCACCTTGTCTCC;

the primer pair 4 has an insertion sequence of GAGTT and comprises a primer rs3042783-F and a primer rs3042783-R, wherein the primer rs3042783-F is AGATTTGTCACTGAGCGATTCTG, and the primer rs3042783-R is AGGCTTACCTTCTGTTGTGGTTAG;

the primer pair 5 has an insertion sequence of AGGTTC and comprises a primer rs1610932-F and a primer rs1610932-R, wherein the primer of the primer rs1610932-F is CATGGGGTCTTTATTTGTCTATGC, and the primer of the primer rs1610932-R is AGGAAGAGAGTGCTGCATAAGAG;

the primer pair 6 has an insertion sequence of TAAG, and comprises a primer rs1611048-F and a primer rs1611048-R, wherein the primer rs1611048-F is CAATATACAAGCACACATGAACAAGG, and the primer rs1611048-R is GTAATTCCACTCCAGTTCTCTAGG;

the primer pair 7 has an insertion sequence of CTTTC, and comprises a primer rs3081400-F and a primer rs3081400-R, wherein the primer of the primer rs3081400-F is TGTCTGACTTTGGTGCTAGTTTGTC, and the primer of the primer rs3081400-R is GATTACACTATAGCGAGCCCTGAATTATG;

the primer pair 8 has an insertion sequence of ACACC and comprises a primer rs2308112-F and a primer rs2308112-R, wherein the primer rs2308112-F is GCAGGCATCCACCGAAGAGG, and the primer rs2308112-R is CAGCATGTGCACTATAACCATCC;

the primer pair 9 has an insertion sequence of CGAC, and comprises a primer rs2307696-F and a primer rs2307696-R, wherein the primer rs2307696-F is CAACCCTCCACTCACAGCAAT, and the primer rs2307696-R is ACACCTGAGCCCACCTGACT;

the primer pair 10 has an insertion sequence of TCAA, and comprises a primer rs3038530-F and a primer rs3038530-R, wherein the primer of the primer rs3038530-F is TTTGAATAGGGCGTCTGTCTTTGG, and the primer of the primer rs3038530-R is GACTTCCTCTGGCCATTACTTAAGG;

the primer pair 11 has an insertion sequence of TATC and comprises a primer rs56024302-F and a primer rs56024302-R, wherein the primer rs56024302-F is TCCATTCCTGTACCAGACTAGC, and the primer rs56024302-R is AGCCTGGGCTTCAGACATAGG;

the primer pair 12 has an insertion sequence of TGGTCAAAGGCA and comprises a primer rs2067204-F and a primer rs2067204-R, the primer rs2067204-F is GGCAAGACACAGAGACAGTAAGG, and the primer rs2067204-R is GCAGGGTTAGTTTGCTGAATGG;

the primer pair 13 has an insertion sequence of AGTG and comprises a primer rs16663-F and a primer rs16663-R, wherein the primer rs16663-F is GCTAGAGGAACAGTCACATGG, and the primer rs16663-R is AGAAGACACAGCAACGTGATG;

the primer pair 14 has an insertion sequence of GTGGA and comprises a primer rs6481-F and a primer rs6481-R, wherein the primer of the primer rs6481 is GAGGGCGACTATAAACAGGATTCC, and the primer of the primer rs6481-R is ACAGTCATTCTCACTCATTTACCTATGG;

based on Indel site data, based on Asian population, screening 14 Indel sites aiming at high individual recognition rate of the Asian population, and designing a specific probe set aiming at each site, wherein the detection probe set comprises the following 14 probe pairs:

the probe pair 1 has an insertion sequence of TCAG, and comprises a probe rs 2308010-and a probe rs2308010+, wherein the probe of the probe rs 2308010-is TGGAATTACGACTGGACAG, and the probe of the probe rs2308010+ is TGGAATTAGTCAGGACTG;

the probe pair 2 has an insertion sequence of CTGT, and comprises a probe rs 34855933-and a probe rs34855933+, wherein the probe of the probe rs 34855933-is TGATGCCTCTTGATT, and the probe of the probe rs34855933+ is TGCCACTCTCTTGAT;

the probe pair 3 has an insertion sequence of CTCA, and comprises a probe rs 4646006-and a probe rs4646006+, the probe of the probe rs4646006 is TAAATGCCACACAGTG, and the probe of the probe rs4646006+ is ATGGCACACACCCAGTG;

the probe pair 4 has an insertion sequence of GAGTT, and comprises a probe rs 3042783-and a probe rs3042783+, wherein the probe of the probe rs 3042783-is TCTTGCTTCTCTAAGAGG, and the probe of the probe rs3042783+ is TCTTGCTTCTCTGAGTTA;

the probe pair 5 has an insertion sequence of AGGTTC, and comprises a probe rs 1610932-and a probe rs1610932+, wherein the probe of the probe rs 1610932-is TGCAACTCACCCGGATG, and the probe of the probe rs1610932+ is CAACTCACCAGCTTCTG;

the probe pair 6 has an insertion sequence of TAAG, and comprises a probe rs 1611048-and a probe rs1611048+, wherein the probe of the probe rs 1611048-is AGTAACTACACGGAAAG, and the probe of the probe rs1611048+ is AGTAACTACACGTAAGGA;

the probe pair 7 has an insertion sequence of CTTTC, and comprises a probe rs 3081400-and a probe rs3081400+, wherein the probe of the probe rs 3081400-is AATGGGACAACGGGC, and the probe of the probe rs3081400+ is TGGGACAACTTTCAG;

the probe pair 8 has an insertion sequence of ACACC, and comprises a probe rs 2308112-and a probe rs2308112+, wherein the probe of the probe rs 2308112-is AGAGAGTCCTCCTTGGTG, and the probe of the probe rs2308112+ is AGAGAGTCCACTCCTGCT;

the probe pair 9 has an insertion sequence of CGAC, and comprises a probe rs 2307696-and a probe rs2307696+, wherein the probe of the probe rs 2307696-is ACACAGCGCCCTGAGG, and the probe of the probe rs2307696+ is ACACAGCCACCGACCT;

the probe pair 10 has an insertion sequence of TCAA, and comprises a probe rs 3038530-and a probe rs3038530+, wherein the probe of the probe rs 3038530-is AGCCAAATCAGCTGAT, and the probe of the probe rs3038530+ is CTGAGCCACATAATCAAGC;

the probe pair 11 has an insertion sequence of TATC, and comprises a probe rs 56024302-and a probe rs56024302+, wherein the probe rs 56024302-is CCATCCATCACAGTGAC, and the probe rs56024302+ is CCATCCATCTACCAAAG;

the probe pair 12 has an insertion sequence of TGGTCAAAGGCA, and comprises a probe rs 2067204-and a probe rs2067204+, the probe rs 2067204-is AAGCATCACCACAGAGGT, and the probe rs2067204+ is CATGGTCACAGGCACA;

the probe pair 13 has an insertion sequence of AGTG, and comprises a probe rs 16663-and a probe rs16663+, wherein the probe of the probe rs 16663-is AGGACAGTTACGAGGG, and the probe of the probe rs16663+ is TTAGTGAGGAGCGACAG;

the probe pair 14 has an insertion sequence of GTGGA, and comprises a probe rs 6481-and a probe rs6481+, wherein the probe of the probe rs 6481-is TTGGTTAGCAGACCAGACC, and the probe of the probe rs6481+ is TTGGTTAGCAGACTGGAC.

2. Use of the detection primer set and the detection probe set for digital PCR chimerism ratio according to claim 1 for the preparation of a reagent for detecting a cell chimerism ratio.