CN113265474A - Detection primer group and probe group for digital PCR (polymerase chain reaction) chimerism rate and application thereof - Google Patents
Detection primer group and probe group for digital PCR (polymerase chain reaction) chimerism rate and application thereof Download PDFInfo
- Publication number
- CN113265474A CN113265474A CN202110810991.XA CN202110810991A CN113265474A CN 113265474 A CN113265474 A CN 113265474A CN 202110810991 A CN202110810991 A CN 202110810991A CN 113265474 A CN113265474 A CN 113265474A
- Authority
- CN
- China
- Prior art keywords
- probe
- primer
- pair
- insertion sequence
- digital pcr
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
- 239000000523 sample Substances 0.000 title claims abstract description 134
- 238000001514 detection method Methods 0.000 title claims abstract description 33
- 238000007847 digital PCR Methods 0.000 title claims abstract description 30
- 206010068051 Chimerism Diseases 0.000 title claims abstract description 22
- 238000003752 polymerase chain reaction Methods 0.000 title abstract description 6
- 238000003780 insertion Methods 0.000 claims description 31
- 230000037431 insertion Effects 0.000 claims description 31
- 239000003153 chemical reaction reagent Substances 0.000 claims description 3
- 101150075675 tatC gene Proteins 0.000 claims 2
- YNJBWRMUSHSURL-UHFFFAOYSA-N trichloroacetic acid Chemical compound OC(=O)C(Cl)(Cl)Cl YNJBWRMUSHSURL-UHFFFAOYSA-N 0.000 claims 2
- 230000035945 sensitivity Effects 0.000 abstract description 8
- 238000011134 hematopoietic stem cell transplantation Methods 0.000 abstract description 4
- 238000000034 method Methods 0.000 description 11
- 230000003321 amplification Effects 0.000 description 10
- 238000003199 nucleic acid amplification method Methods 0.000 description 10
- 238000004458 analytical method Methods 0.000 description 6
- 230000002068 genetic effect Effects 0.000 description 6
- 238000006243 chemical reaction Methods 0.000 description 5
- 239000003550 marker Substances 0.000 description 4
- 238000002054 transplantation Methods 0.000 description 4
- 108700028369 Alleles Proteins 0.000 description 2
- 238000011529 RT qPCR Methods 0.000 description 2
- 239000012295 chemical reaction liquid Substances 0.000 description 2
- 210000000349 chromosome Anatomy 0.000 description 2
- 238000012217 deletion Methods 0.000 description 2
- 230000037430 deletion Effects 0.000 description 2
- 238000013461 design Methods 0.000 description 2
- 238000002474 experimental method Methods 0.000 description 2
- 238000002156 mixing Methods 0.000 description 2
- 238000012986 modification Methods 0.000 description 2
- 230000004048 modification Effects 0.000 description 2
- 238000012544 monitoring process Methods 0.000 description 2
- 239000012452 mother liquor Substances 0.000 description 2
- 230000035772 mutation Effects 0.000 description 2
- 238000012216 screening Methods 0.000 description 2
- 239000012224 working solution Substances 0.000 description 2
- 102000016911 Deoxyribonucleases Human genes 0.000 description 1
- 108010053770 Deoxyribonucleases Proteins 0.000 description 1
- 238000012408 PCR amplification Methods 0.000 description 1
- 230000001154 acute effect Effects 0.000 description 1
- 230000000735 allogeneic effect Effects 0.000 description 1
- 238000000137 annealing Methods 0.000 description 1
- 230000015572 biosynthetic process Effects 0.000 description 1
- 210000004027 cell Anatomy 0.000 description 1
- 238000005119 centrifugation Methods 0.000 description 1
- 238000004925 denaturation Methods 0.000 description 1
- 230000036425 denaturation Effects 0.000 description 1
- 238000011161 development Methods 0.000 description 1
- 238000007865 diluting Methods 0.000 description 1
- 201000010099 disease Diseases 0.000 description 1
- 208000037265 diseases, disorders, signs and symptoms Diseases 0.000 description 1
- 239000012153 distilled water Substances 0.000 description 1
- 239000012154 double-distilled water Substances 0.000 description 1
- 238000011304 droplet digital PCR Methods 0.000 description 1
- 230000009977 dual effect Effects 0.000 description 1
- 230000000694 effects Effects 0.000 description 1
- 239000012634 fragment Substances 0.000 description 1
- PCHJSUWPFVWCPO-UHFFFAOYSA-N gold Chemical group [Au] PCHJSUWPFVWCPO-UHFFFAOYSA-N 0.000 description 1
- 210000003958 hematopoietic stem cell Anatomy 0.000 description 1
- 238000002513 implantation Methods 0.000 description 1
- 239000007791 liquid phase Substances 0.000 description 1
- 239000000203 mixture Substances 0.000 description 1
- 238000005457 optimization Methods 0.000 description 1
- 230000002980 postoperative effect Effects 0.000 description 1
- 238000012257 pre-denaturation Methods 0.000 description 1
- 238000002360 preparation method Methods 0.000 description 1
- 238000011160 research Methods 0.000 description 1
- 238000012163 sequencing technique Methods 0.000 description 1
- 239000011550 stock solution Substances 0.000 description 1
- 238000003786 synthesis reaction Methods 0.000 description 1
- 238000012360 testing method Methods 0.000 description 1
- XLYOFNOQVPJJNP-UHFFFAOYSA-N water Chemical compound O XLYOFNOQVPJJNP-UHFFFAOYSA-N 0.000 description 1
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides a detection primer group and a probe group for digital PCR (polymerase chain reaction) chimerism rate and application thereof, which are characterized in that 14 Indel sites aiming at the high individual recognition rate of Asian population are screened out based on Indel site data and the Asian population, and a specific primer is designed aiming at each site, wherein the primer group comprises the following 14 primer pairs and 14 probe groups. The primer group and the detection method provided by the invention and the chimerism rate result obtained by the primer group and the detection method can be applied to a patient after hematopoietic stem cell transplantation, and have the characteristics of higher coverage rate, high sensitivity and wide linear range.
Description
Technical Field
The invention relates to the field of detection by a digital PCR method, in particular to a primer group and a probe group for detecting the chimeric rate of digital PCR and application thereof.
Background
With the gradual maturity of the allogeneic hematopoietic stem cell transplantation technology, the number of related transplantation cases is rapidly increased, and the analysis of the chimeric state of the hematopoietic cells after transplantation is an important method for evaluating the implantation effect of donor cells and an important detection item for prompting postoperative recurrence. At present, two detection methods of STR and qPCR are mainly used for detecting the chimerism rate, wherein the STR is a gold standard for detecting the chimerism rate, but the STR is mainly applied to a first-generation sequencing platform, and common PCR amplification only has a primer set, has the influence of amplification efficiency and nonspecific amplification, and has lower sensitivity which is only 1% -5%; although qPCR includes a primer set and a probe set, it reduces non-specific amplification compared to STR, but it is affected by amplification efficiency, and there is a difference in amplification efficiency of different primers during amplification, and it needs to rely on CT value to reflect its original template amount, resulting in sensitivity of only 0.1%. Both detection methods can only verify recurrence, have no capacity of predicting recurrence and prompting recurrence risk in early stage, and have certain hysteresis for monitoring recurrence. The digital PCR has high accuracy and can be absolutely quantified; the sample demand is low; the detection sensitivity is high; high tolerance and the like, can reflect the early microscopic condition that the chimerism rate of a patient is below 0.1 percent, and realize the 'early prediction', 'early intervention', 'early rescue' of the transplantation relapse. The project applies the digital PCR to the detection of the embedding degree after transplantation so as to improve the detection sensitivity and accuracy of the embedding degree.
The digital PCR method for detecting the mosaic is the technical optimization of the prior STR-PCR and micro-mosaic method, 1.5 million patients are transplanted every year in China, the mosaic monitoring clinical significance is clear, the recurrence prediction is reliable, the market capacity is large, and the method belongs to the hundred million-level market. Moreover, due to the technical advantages of the digital PCR method compared with the STR-PCR method, under the conditions that the detection cost is not increased and the report progress is normal, from the research result, customers are willing to adopt a more sensitive and accurate digital PCR method, and the project development prospect is very wide.
Disclosure of Invention
The invention provides a primer group and a probe group for detecting the digital PCR chimerism rate and application thereof, which aim to solve at least one technical problem.
In order to solve the above problems, as an aspect of the present invention, there is provided a primer set for detecting digital PCR chimerism rate, wherein based on Indel site data, 14 Indel sites with high individual recognition rate for asian population are selected based on asian population, and a specific primer is designed for each site, including the following 14 primer pairs:
preferably, the forward and reverse primers are located at least 10bp before and after the del/indel position, respectively.
The invention also provides a detection probe set for the digital PCR chimerism rate, which is characterized in that 14 Indel sites aiming at the high individual recognition rate of Asian population are screened out based on the Indel site data and the Asian population, and a specific probe set is designed aiming at each site, wherein the detection probe set comprises the following 14 probe pairs:
preferably, the forward and reverse primers are located at least 10bp before and after the del/indel position, respectively.
The invention also provides application of the primer group for detecting the digital PCR chimerism rate and the probe group for detecting the digital PCR chimerism rate in preparing a chimerism detection reagent.
The primer group and the detection method provided by the invention and the chimerism rate result obtained by the primer group and the detection method can be applied to a patient after hematopoietic stem cell transplantation, and have the characteristics of higher coverage rate, high sensitivity and wide linear range.
Drawings
FIG. 1 is a graph showing the amplification efficiency of the primer N1-2 according to the present invention;
FIG. 2 is a graph showing the result of detection of the heterozygous genetic marker N1-2 according to the present invention;
FIGS. 3(a) and 3(b) are graphs showing the results of detection of blank standards for the genetic markers N1-2 (+), N1-2 (-);
FIG. 4(a), FIG. 4(b), FIG. 4(c), FIG. 4(d), FIG. 4(e) and FIG. 4(f) are graphs showing the results of detection of the standard (50%, 10%, 2%, 0.4%, 0.08% and 0.016%) of the genetic marker N1-2 (+) of the present invention.
Detailed Description
The following detailed description of embodiments of the invention, but the invention can be practiced in many different ways, as defined and covered by the claims.
The invention discloses a primer and probe combination based on digital PCR chimeric detection and a method for chimeric detection by using the primer and probe combination.
Based on Indel site data, 14 Indel sites with high individual recognition rate for Asian population are screened out based on the Asian population, and specific primer and probe combinations are further designed for each site. The primer group consists of 28 primers, and the probe group consists of 28 primers. The primer group and the detection method provided by the invention and the chimerism rate result obtained by the primer group and the detection method can be applied to a patient after hematopoietic stem cell transplantation, and have the characteristics of higher coverage rate, high sensitivity and wide linear range.
The primer group consists of 28 primers, the probe group consists of 28 primers, the forward and reverse primers are respectively located at least 10bp positions before and after the del/indel position, each pair of primers can stably amplify a del/indel product, the MGB probe group respectively designs a probe (+) and a probe (-) aiming at the del/indel position and can accurately react with the del/indel amplification product, the dual control of a detection site is realized by applying a method of combining the specific primers and the MGB probe, the specificity of the detection site and the accuracy of the result are ensured, the specificity is good, and the sensitivity is high.
Step 1, extracting DNA of a sample to be detected, diluting the DNA to about 40 ng/mu L by using RNase-Free ddH2O, mixing uniformly and centrifuging for later use.
And 2, the concentrations of the primer mother liquor and the probe mother liquor are both 100uM, the concentration of each primer in the working solution is 9uM, and the concentration of the probe is 9 uM. The working solution preparation scheme is as follows: 9ul and 6ul of each primer probe stock solution in each tube were taken, and finally 100 ul of M ltraPure ™ DNase/RNase-Free Distilled Water (Invitrogen, cat. No. 10977-015) was used for complementation.
and 4, oscillating the 8-connection pipe for short-time centrifugation for later use.
And 5, adding 75ul of wrapping oil into corresponding hole positions in the digital chip, transferring 20ul of reaction liquid in the 8-way tube to a circular hole of the chip, and adding liquid-phase oil into the circular hole (so that the oil covers the surface of the reaction liquid and the bubbles are not added) while paying attention to the process that no bubbles are added.
And 6, covering a soft rubber cover on the machine, and finishing the sample adding in the step 10 within 10min as much as possible.
And 7, running a program on the sharp digital PCR instrument (the position of the chip needs to be correctly selected according to the actual placement condition):
step 8, off-line analysis
Opening the PCR analyzer, clicking "move out", putting the amplified chip together with the chip rack into the analyzer, clicking "move in" touch screen to select numbers 1-16, inputting the number in "plate name", selecting "mutation detection" in "experiment type", reserving FAM and HEX for the fluorescence channel of "target", clicking "add", and clicking "scan sample". At which time the instrument begins to analyze the chip results. The data were copied after the analysis was completed as follows: and inserting a USB flash disk into the USB interface, clicking 'settings' on the analysis interface, clicking 'data export', finding a file name, and clicking 'export'.
The first embodiment is as follows: design and Synthesis of primers
InDel site screening
The InDel locus is screened by adopting the following principle:
1. the length difference (the number of inserted or deleted bases) of the InDel allele fragments is more than 3bp and less than 30 bp;
2. located on 22 human autosomes;
3. the spacing between InDel sites on the same chromosome is more than 5 Mb;
4. minimum Allele Frequency (MAF) between 0.30 and 0.50 (based on the east asian population);
5. the total number of the sites is not less than 30, and the accumulated individual identification rate reaches more than 0.9999;
6. no linkage is formed on the same chromosome, and the distribution in the population conforms to Hardy-Weinberg genetic balance;
7. to avoid the InDel sites being associated with certain specific disease phenotypes, it is preferred that polymorphic sites be located in the intron regions.
By adopting the principle, primary screening is carried out on InDel sites with stronger polymorphism through websites shown by http:// www.ensemb1.org/index. html and http:// www.ncbi.nlm.nih.gov/projects/SNP, and finally 14 InDel sites are selected, wherein the sites are respectively as follows: n1-1(rs2308010), N1-2(rs34855933), N1-3(rs34855933), N2-1(rs3042783), N5-4(rs1610932), N21-1(rs16663), N9-1(rs2308112), N11-1(rs2307696), N13-1(rs3038530), N14-1(rs2067204), N16-2(rs2067204), N7-2(rs 1041618), N8-1(rs3081400) and N22-1(rs6481), wherein the number rs in brackets indicates the number of the site in dbSNP database.
EXAMPLE two primer and Probe specificity test
5 insertion homozygotes, deletion homozygotes and heterozygotes are respectively selected for carrying out digital PCR for detecting the specificity of the primer and the probe.
1. Digital PCR amplification system
A 20uL digital PCR amplification system was used: 10uL 2 × dPCR Mix reaction; luL 9uM primer; luL 6uM probe; 8uL 40ng/uL DNA.
2. Digital PCR reaction conditions
The following fluorescent PCR reaction conditions were used: pre-denaturation at 95 ℃ for 10min, then annealing and extension at 95 ℃ for 30 s-55 ℃ for 1min, and carrying out 39 cycles in total, denaturation at 98 ℃ for 10min, and extension at 20 ℃ for 2 min.
3. Opening the PCR analyzer, clicking "move out", putting the amplified chip together with the chip rack into the analyzer, clicking "move in" touch screen to select numbers 1-16, inputting the number in "plate name", selecting "mutation detection" in "experiment type", reserving FAM and HEX for the fluorescence channel of "target", clicking "add", and clicking "scan sample". At which time the instrument begins to analyze the chip results. The data were copied after the analysis was completed as follows: and inserting a USB flash disk into the USB interface, clicking 'settings' on the analysis interface, clicking 'data export', finding a file name, and clicking 'export'.
4. Specificity determination
The state of each genetic marker insertion/deletion is judged through a signal value, and if FAM, HEX, double negative and double positive groups are obvious, the specificity of the primer and the probe is good. Taking the Nl-2(+) insertion genetic marker as an example, FAM signal values are distributed between 4000-7000, HEX signal values are distributed between 3000-5000 and double negativity are below 2000, indicating that the specificity of the primer and the probe is good.
The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention, and various modifications and changes may be made by those skilled in the art. Any modification, equivalent replacement, or improvement made within the spirit and principle of the present invention should be included in the protection scope of the present invention.
Claims (5)
1. A detection primer group for digital PCR chimerism rate is characterized in that 14 Indel sites aiming at high individual recognition rate of Asian population are screened out based on Indel site data and the Asian population, and a specific primer is designed aiming at each site, and comprises the following primer pairs:
the primer pair 1 has an insertion sequence of TCAG, and comprises a primer rs2308010-F and a primer rs2308010-R, wherein the primer rs2308010-F is ACACAATTAAAACAAATGTACCATCCAG, and the primer rs2308010-R is ATCATCAAACTCAACTAGGGGATAA;
the primer pair 2 has an insertion sequence of CTGT and comprises a primer rs34855933-F and a primer rs34855933-R, wherein the primer of the primer rs34855933-F is CGCAGAGGTGGAGGATACAAATAG, and the primer of the primer rs34855933-R is AACAGAGTGAAGCTGCTGACAAC;
the primer pair 3 has an insertion sequence of CTCA, and comprises a primer rs4646006-F and a primer rs4646006-R, wherein the primer of the primer rs4646006-F is AATAATGAAGAGATCAGCAAAGGC, and the primer of the primer rs4646006-R is TTATATGCCTCTCACCTTGTCTCC;
the primer pair 4 has an insertion sequence of GAGTT and comprises a primer rs3042783-F and a primer rs3042783-R, wherein the primer rs3042783-F is AGATTTGTCACTGAGCGATTCTG, and the primer rs3042783-R is AGGCTTACCTTCTGTTGTGGTTAG;
the primer pair 5 has an insertion sequence of AGGTTC and comprises a primer rs1610932-F and a primer rs1610932-R, wherein the primer of the primer rs1610932-F is CATGGGGTCTTTATTTGTCTATGC, and the primer of the primer rs1610932-R is AGGAAGAGAGTGCTGCATAAGAG;
the primer pair 6 has an insertion sequence of TAAG, and comprises a primer rs1611048-F and a primer rs1611048-R, wherein the primer rs1611048-F is CAATATACAAGCACACATGAACAAGG, and the primer rs1611048-R is GTAATTCCACTCCAGTTCTCTAGG;
the primer pair 7 has an insertion sequence of CTTTC, and comprises a primer rs3081400-F and a primer rs3081400-R, wherein the primer of the primer rs3081400-F is TGTCTGACTTTGGTGCTAGTTTGTC, and the primer of the primer rs3081400-R is GATTACACTATAGCGAGCCCTGAATTATG;
the primer pair 8 has an insertion sequence of ACACC and comprises a primer rs2308112-F and a primer rs2308112-R, wherein the primer rs2308112-F is GCAGGCATCCACCGAAGAGG, and the primer rs2308112-R is CAGCATGTGCACTATAACCATCC;
the primer pair 9 has an insertion sequence of CGAC, and comprises a primer rs2307696-F and a primer rs2307696-R, wherein the primer rs2307696-F is CAACCCTCCACTCACAGCAAT, and the primer rs2307696-R is ACACCTGAGCCCACCTGACT;
the primer pair 10 has an insertion sequence of TCAA, and comprises a primer rs3038530-F and a primer rs3038530-R, wherein the primer of the primer rs3038530-F is TTTGAATAGGGCGTCTGTCTTTGG, and the primer of the primer rs3038530-R is GACTTCCTCTGGCCATTACTTAAGG;
the primer pair 11 has an insertion sequence of TATC and comprises a primer rs56024302-F and a primer rs56024302-R, wherein the primer rs56024302-F is TCCATTCCTGTACCAGACTAGC, and the primer rs56024302-R is AGCCTGGGCTTCAGACATAGG;
the primer pair 12 has an insertion sequence of TGGTCAAAGGCA and comprises a primer rs2067204-F and a primer rs2067204-R, the primer rs2067204-F is GGCAAGACACAGAGACAGTAAGG, and the primer rs2067204-R is GCAGGGTTAGTTTGCTGAATGG;
the primer pair 13 has an insertion sequence of AGTG and comprises a primer rs16663-F and a primer rs16663-R, wherein the primer rs16663-F is GCTAGAGGAACAGTCACATGG, and the primer rs16663-R is AGAAGACACAGCAACGTGATG;
the primer pair 14 has an insertion sequence of GTGGA and comprises a primer rs6481-F and a primer rs6481-R, wherein the primer of the primer rs6481 is GAGGGCGACTATAAACAGGATTCC, and the primer of the primer rs6481-R is ACAGTCATTCTCACTCATTTACCTATGG.
2. The primer set for detecting digital PCR chimerism according to claim 1, wherein the forward and reverse primers are located at least 10bp before and after the del/indel position, respectively.
3. A detection probe set for digital PCR chimerism rate is characterized in that based on Indel site data, 14 Indel sites with high individual recognition rate for Asian population are screened out based on the Asian population, and a specific probe set is designed for each site, wherein the detection probe set comprises the following 14 probe pairs:
the probe pair 1 has an insertion sequence of TCAG, and comprises a probe rs 2308010-and a probe rs2308010+, wherein the probe of the probe rs 2308010-is TGGAATTACGACTGGACAG, and the probe of the probe rs2308010+ is TGGAATTAGTCAGGACTG;
the probe pair 2 has an insertion sequence of CTGT, and comprises a probe rs 34855933-and a probe rs34855933+, wherein the probe of the probe rs 34855933-is TGATGCCTCTTGATT, and the probe of the probe rs34855933+ is TGCCACTCTCTTGAT;
the probe pair 3 has an insertion sequence of CTCA, and comprises a probe rs 4646006-and a probe rs4646006+, the probe of the probe rs4646006 is TAAATGCCACACAGTG, and the probe of the probe rs4646006+ is ATGGCACACACCCAGTG;
the probe pair 4 has an insertion sequence of GAGTT, and comprises a probe rs 3042783-and a probe rs3042783+, wherein the probe of the probe rs 3042783-is TCTTGCTTCTCTAAGAGG, and the probe of the probe rs3042783+ is TCTTGCTTCTCTGAGTTA;
the probe pair 5 has an insertion sequence of AGGTTC, and comprises a probe rs 1610932-and a probe rs1610932+, wherein the probe of the probe rs 1610932-is TGCAACTCACCCGGATG, and the probe of the probe rs1610932+ is CAACTCACCAGCTTCTG;
the probe pair 6 has an insertion sequence of TAAG, and comprises a probe rs 1611048-and a probe rs1611048+, wherein the probe of the probe rs 1611048-is AGTAACTACACGGAAAG, and the probe of the probe rs1611048+ is AGTAACTACACGTAAGGA;
the probe pair 7 has an insertion sequence of CTTTC, and comprises a probe rs 3081400-and a probe rs3081400+, wherein the probe of the probe rs 3081400-is AATGGGACAACGGGC, and the probe of the probe rs3081400+ is TGGGACAACTTTCAG;
the probe pair 8 has an insertion sequence of ACACC, and comprises a probe rs 2308112-and a probe rs2308112+, wherein the probe of the probe rs 2308112-is AGAGAGTCCTCCTTGGTG, and the probe of the probe rs2308112+ is AGAGAGTCCACTCCTGCT;
the probe pair 9 has an insertion sequence of CGAC, and comprises a probe rs 2307696-and a probe rs2307696+, wherein the probe of the probe rs 2307696-is ACACAGCGCCCTGAGG, and the probe of the probe rs2307696+ is ACACAGCCACCGACCT;
the probe pair 10 has an insertion sequence of TCAA, and comprises a probe rs 3038530-and a probe rs3038530+, wherein the probe of the probe rs 3038530-is AGCCAAATCAGCTGAT, and the probe of the probe rs3038530+ is CTGAGCCACATAATCAAGC;
the probe pair 11 has an insertion sequence of TATC, and comprises a probe rs 56024302-and a probe rs56024302+, wherein the probe rs 56024302-is CCATCCATCACAGTGAC, and the probe rs56024302+ is CCATCCATCTACCAAAG;
the probe pair 12 has an insertion sequence of TGGTCAAAGGCA, and comprises a probe rs 2067204-and a probe rs2067204+, the probe rs 2067204-is AAGCATCACCACAGAGGT, and the probe rs2067204+ is CATGGTCACAGGCACA;
the probe pair 13 has an insertion sequence of AGTG, and comprises a probe rs 16663-and a probe rs16663+, wherein the probe of the probe rs 16663-is AGGACAGTTACGAGGG, and the probe of the probe rs16663+ is TTAGTGAGGAGCGACAG;
the probe pair 14 has an insertion sequence of GTGGA, and comprises a probe rs 6481-and a probe rs6481+, wherein the probe of the probe rs 6481-is TTGGTTAGCAGACCAGACC, and the probe of the probe rs6481+ is TTGGTTAGCAGACTGGAC.
4. The set of probes for detecting digital PCR chimerism according to claim 3, wherein the forward and reverse primers are located at least 10bp before and after the del/indel position, respectively.
5. Use of the primer set for detecting digital PCR chimerism rate according to claim 1 or 2 and the probe set for detecting digital PCR chimerism rate according to claim 3 or 4 for preparing a chimerism detection reagent.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110810991.XA CN113265474B (en) | 2021-07-19 | 2021-07-19 | Detection primer group and probe group for digital PCR (polymerase chain reaction) chimerism rate and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110810991.XA CN113265474B (en) | 2021-07-19 | 2021-07-19 | Detection primer group and probe group for digital PCR (polymerase chain reaction) chimerism rate and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN113265474A true CN113265474A (en) | 2021-08-17 |
| CN113265474B CN113265474B (en) | 2021-11-02 |
Family
ID=77236721
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202110810991.XA Active CN113265474B (en) | 2021-07-19 | 2021-07-19 | Detection primer group and probe group for digital PCR (polymerase chain reaction) chimerism rate and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN113265474B (en) |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105861675A (en) * | 2016-04-27 | 2016-08-17 | 上海荻硕贝肯生物科技有限公司 | Primers, probe, kit and method for microchimerism detection and individual recognition |
| WO2016201507A1 (en) * | 2015-06-15 | 2016-12-22 | Murdoch Childrens Research Institute | Method of measuring chimerism |
| CN110423818A (en) * | 2019-08-07 | 2019-11-08 | 南京实践医学检验有限公司 | A kind of primer, probe, kit and method for HLA-LOSS detection and individual identification |
| CN113005223A (en) * | 2020-11-19 | 2021-06-22 | 杭州晶佰生物技术有限公司 | Primer for digital PCR detection aiming at RCR/RCL and detection method |
-
2021
- 2021-07-19 CN CN202110810991.XA patent/CN113265474B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2016201507A1 (en) * | 2015-06-15 | 2016-12-22 | Murdoch Childrens Research Institute | Method of measuring chimerism |
| CN105861675A (en) * | 2016-04-27 | 2016-08-17 | 上海荻硕贝肯生物科技有限公司 | Primers, probe, kit and method for microchimerism detection and individual recognition |
| CN110423818A (en) * | 2019-08-07 | 2019-11-08 | 南京实践医学检验有限公司 | A kind of primer, probe, kit and method for HLA-LOSS detection and individual identification |
| CN113005223A (en) * | 2020-11-19 | 2021-06-22 | 杭州晶佰生物技术有限公司 | Primer for digital PCR detection aiming at RCR/RCL and detection method |
Non-Patent Citations (3)
| Title |
|---|
| JENNIFER VALERO-GARCIA等: "Earlier relapse detection after allogeneic haematopoietic stem cell transplantation by chimerism assays: Digital PCR versus quantitative real-time PCR of insertion/deletion polymorphisms", 《PLOS ONE》 * |
| 于浩: "数字PCR监测造血干细胞移植嵌合体的初步研究及HLA--DPB1与rs9277534连锁关系分析", 《万方学位论文数据库》 * |
| 百茹峰等: "北京汉族群体30个常染色体InDel位点群体遗传学及法医学研究", 《遗传》 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN113265474B (en) | 2021-11-02 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Broccanello et al. | Comparison of three PCR-based assays for SNP genotyping in plants | |
| CN108998550B (en) | SNP molecular marker for rice genotyping and application thereof | |
| CN108103235B (en) | SNP molecular marker and primer for identifying cold resistance of apple rootstock and application of SNP molecular marker and primer | |
| CN110724758B (en) | Method for identifying purity of Jingnongke 728 corn hybrid based on SNP marker | |
| CN110872633B (en) | Method for identifying purity of Jingke 968 corn hybrid based on SNP marker | |
| Wu et al. | SNP development and diversity analysis for Ginkgo biloba based on transcriptome sequencing | |
| CN110777216B (en) | Method for identifying purity of Jingke waxy 2000 corn hybrid based on SNP marker | |
| CN109504749A (en) | The KASP detection primer of transgenic corns L239 and its filial generation homozygote and heterozygote | |
| WO2017185758A1 (en) | Primer, probe, kit, and method for microchimerism assay and individual recognition | |
| CN112695114B (en) | SNP molecular marker for detecting rice blast resistance Pik gene and application thereof | |
| CN105368957A (en) | Micro-droplet digital PCR (polymerase chain reaction) quantitative determination method of CHO (Chinese hamster ovary) cell gene copy number | |
| CN115094156A (en) | Development and application of KASP marker of rice high-temperature-resistant gene TT1 | |
| US9938575B2 (en) | Compositions and methods for high-throughput nucleic acid analysis and quality control | |
| CN102753686B (en) | Probe design process in DNA microarray, there is the DNA microarray of the probe utilizing the method to design | |
| CN117683927A (en) | Functional KASP molecular marker of rice blast resistance gene and application thereof | |
| von Maydell | PCR allele competitive extension (PACE) | |
| CN113265474B (en) | Detection primer group and probe group for digital PCR (polymerase chain reaction) chimerism rate and application thereof | |
| CN116377082B (en) | Application of sheep LCORL gene single nucleotide polymorphism marker in growth trait selection | |
| CN109161609B (en) | SNP molecular marker of wheat leaf rust resistance gene Lr42, detection method and application | |
| CN109706247B (en) | Method for monitoring genetic quality of inbred mouse by using microsatellite technology | |
| CN116287387A (en) | SNP locus and KASP molecular marker closely linked with PMMoV resistance gene L3 of capsicum and application | |
| CN106636406B (en) | Molecular marker R207 coseparated with wheat few-tillering gene Ltn3 and application thereof | |
| CN114606335A (en) | Development and application of KASP molecular marker of sugarcane mosaic virus disease resistance gene of corn | |
| CN110484627B (en) | Method for monitoring genetic quality of A/J inbred line mice, primer set and application thereof | |
| CN109486988B (en) | Method for high-throughput detection of corn stalk rot resistance genotyping and kit thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| PE01 | Entry into force of the registration of the contract for pledge of patent right | ||
| PE01 | Entry into force of the registration of the contract for pledge of patent right |
Denomination of invention: Primer and probe sets for detecting chimerism rate in digital PCR and their applications Effective date of registration: 20230719 Granted publication date: 20211102 Pledgee: Industrial Bank Co.,Ltd. Shanghai Nanhui Branch Pledgor: SHANGHAI TISSUEBANK MEDICAL LABORATORY Co.,Ltd.|SHENZHEN TISSUEBANK PRECISION MEDICINE CO.,LTD.|SHANGHAI TISSUEBANK BIOTECHNOLOGY Co.,Ltd.|Shanghai dishuobeiken Gene Technology Co.,Ltd.|SHANGHAI TISSUEBANK BIOTECHNOLOGY CO.,LTD. Registration number: Y2023310000384 |
|
| PC01 | Cancellation of the registration of the contract for pledge of patent right | ||
| PC01 | Cancellation of the registration of the contract for pledge of patent right |
Granted publication date: 20211102 Pledgee: Industrial Bank Co.,Ltd. Shanghai Nanhui Branch Pledgor: SHANGHAI TISSUEBANK MEDICAL LABORATORY Co.,Ltd.|SHENZHEN TISSUEBANK PRECISION MEDICINE CO.,LTD.|SHANGHAI TISSUEBANK BIOTECHNOLOGY Co.,Ltd.|Shanghai dishuobeiken Gene Technology Co.,Ltd.|SHANGHAI TISSUEBANK BIOTECHNOLOGY CO.,LTD. Registration number: Y2023310000384 |
|
| PE01 | Entry into force of the registration of the contract for pledge of patent right | ||
| PE01 | Entry into force of the registration of the contract for pledge of patent right |
Denomination of invention: Primer and probe sets for detecting chimerism rate in digital PCR and their applications Granted publication date: 20211102 Pledgee: Industrial Bank Co.,Ltd. Shanghai Nanhui Branch Pledgor: SHANGHAI TISSUEBANK MEDICAL LABORATORY Co.,Ltd.|SHENZHEN TISSUEBANK PRECISION MEDICINE CO.,LTD.|SHANGHAI TISSUEBANK BIOTECHNOLOGY Co.,Ltd.|Shanghai dishuobeiken Gene Technology Co.,Ltd.|SHANGHAI TISSUEBANK BIOTECHNOLOGY CO.,LTD. Registration number: Y2024310000533 |