CN113265414A

CN113265414A - Construction method for converting high-yield bacterial strain of fengycin by using glucose

Info

Publication number: CN113265414A
Application number: CN202110560598.XA
Authority: CN
Inventors: 闻建平; 何明亮; 银莹
Original assignee: Tianjin University
Current assignee: Tianjin University
Priority date: 2021-05-21
Filing date: 2021-05-21
Publication date: 2021-08-17
Anticipated expiration: 2041-05-21
Also published as: CN113265414B

Abstract

The invention provides a construction method for transforming a high-yield bacterial strain of fengycin by using glucose, which comprises the steps of connecting a P43 promoter gene and a degQ gene from bacillus subtilis 168 in series with a sfp gene from bacillus amyloliquefaciens FZB42 to form a gene expression module pHP13-P43-sfp-degQ, and transferring the module into an original bacterial strain of the bacillus subtilis 168 to obtain a bacterial strain cell BSP000 for synthesizing the fengycin. Three overexpression target genes of accA, cypC and gapA are predicted by constructing a BSP000 strain genome scale metabolic network model, and the three genes are overexpressed in the BSP000 strain to obtain the fenggen high-yield engineering strain BSP003, wherein the fermentation yield of the fenggen reaches 59.87mg/L, and is increased by 126% compared with an artificial strain BSP 000. Has practical application value for realizing the industrial production of the fengyuan.

Description

Construction method for converting high-yield bacterial strain of fengycin by using glucose

Technical Field

The invention belongs to the technical field of bacillus subtilis genetic engineering, and particularly relates to a method for constructing a genetic engineering strain capable of synthesizing fengyuan by using glucose by carrying out serial co-expression on sfp gene degQ genes, and finally realizing the improvement of the yield of the fengyuan of the engineering strain by simulating a target gene for overexpression by using a model.

Background

Lignocellulose is an abundant renewable resource on the earth at present, and five-carbon sugars such as arabinose and xylose and six-carbon sugars such as glucose and galactose can be generated after hydrolysis. The lignocellulose is comprehensively treated and utilized by a biological method, which is beneficial to solving the environmental problem.

Strains which utilize glucose to convert fengycin, such as Bacillus amyloliquefaciens LPB-18N (CN201911402559.6), are currently found in nature. However, the lignocellulosic hydrolysate is complex in composition and therefore needs to be treated using a multi-flora cell system. The following research on transforming the artificial cell of the fengycin with glucose is necessary, which is the starting point for the research on the interrelation of the multiple artificial cell populations.

The biological activity of the plumping element is equivalent to that of partial chemical pesticide, and the plumping element can obviously inhibit the growth of plant fungi, but has no obvious inhibiting effect on yeast and bacteria. Non-ribosomal peptide antibiotics like fengycin generally have unique biological activity functions, and can help microorganisms producing the antibiotics to better adapt to living environments, especially inhibit or kill opponents when encountering competition with other fungi or bacteria for survival, thereby greatly improving the self-competition capability. In recent years, a lot of researchers have made a lot of studies on the bacteriostatic activity of fengyuan by many scholars at home and abroad, and fengyuan has very wide application in the aspects of effectively preventing and treating plant diseases and the like (CN 201810540353.9).

A Fenogen synthetic gene cluster in the bacillus subtilis shares the same promoter pfen, the synthetic gene cluster comprises five coding genes which are sequentially arranged according to the sequence of fenC, fenD, fenE, fenA and fenB, each coding gene can code one subunit to realize a specific catalytic function, the sequential action of the five subunits can realize the synthesis of one Fenogen molecule, and the total length of a gene cluster sequence is 38.7 kb. The fengycin molecule is composed of two parts of a beta-fatty acid chain and a peptide ring, wherein the synthesis of the polypeptide part is different from the synthesis of common polypeptide, and the fengycin molecule is synthesized by non-ribosomal peptide synthetase which comprises a plurality of functional modules, such as an adenylation structural domain A, a condensation structural domain C, peptide acyl carrier protein PCP and the like.

Although fengycin has good antifungal activity, the yield is greatly limited, so many researchers have conducted various researches to improve the final yield of the strain fengycin, for example, ruu et al can improve the yield of fengycin by 72% (CN201911399328.4) by constructing gene knockout mutants. By adding K into fermentation medium of the fengycin⁺、Mg²⁺、Fe²⁺、Mn²⁺The results of the metal elements show that the biomass of the bacillus subtilis is obviously improved, and the yield of the fengyuan is also obviously improved.

Glucose is used as an important hydrolysate of lignocellulose, and the effective utilization of glucose has very important significance on the degradation of the lignocellulose. The Chassis cell Bacillus subtilis 168 strain can grow by using glucose, but can not synthesize the target product plumogen.

Disclosure of Invention

In order to solve the problems in the prior art, the invention constructs the bacillus subtilis strain capable of synthesizing the fengyuan by using glucose, designs a genome scale metabolic network model aiming at the problem of low yield of the fengyuan of the strain, and carries out genetic engineering modification on the strain under the guidance of the genome scale metabolic network model so as to improve the yield of the fengyuan.

The gene expression module pHP13-P43-sfp-degQ is formed by connecting a P43 promoter gene (the nucleotide sequence of which is shown as SEQ ID NO: 1) from bacillus subtilis 168, a degQ gene (the nucleotide sequence of which is shown as SEQ ID NO: 3) and a sfp gene (the nucleotide sequence of which is shown as SEQ ID NO: 2) from bacillus amyloliquefaciens FZB42 in series by using a genetic engineering technology, and the module is transferred into an original strain of the bacillus subtilis 168 by a chemical transformation method to obtain an artificial strain BSP000 capable of synthesizing the fengycin. In order to improve the yield of the bacterial strain for synthesizing the toyoxin, three overexpression target genes of accA gene (the nucleotide sequence of which is shown as SEQ ID NO: 5), cypC gene (the nucleotide sequence of which is shown as SEQ ID NO: 6) and gapA gene (the nucleotide sequence of which is shown as SEQ ID NO: 7) are predicted by constructing a bacterial strain genome scale metabolic network model, and the yield of the bacterial strain toyoxin is greatly promoted by overexpressing the three genes in a BSP000 bacterial strain, so that the high-yield engineering bacterial strain BSP003 of the toyoxin is obtained.

The purpose of the invention is realized by the following technical scheme:

a construction method for converting a high-yield bacterial strain of fengycin by using glucose; a bacillus subtilis 168 modified strain with excellent performance is successfully constructed by utilizing a synthetic biology method, and can synthesize the fengycin by utilizing glucose. A bacillus subtilis genome scale metabolic network model aiming at the production of the fengyuan is constructed. The gene modification of the bacillus subtilis is guided according to the constructed model simulation prediction, so that the synthesis capacity of the fengyuan of the bacillus subtilis is improved, the blindness of determining a target gene in the gene modification process is greatly reduced, the experimental amount is reduced, and the efficiency of synthesizing the fengyuan by modifying the bacillus subtilis in metabolic engineering is improved.

A construction method for converting a high-yield bacterial strain of fengycin by using glucose; comprises the following steps

1) Designing PCR primers according to the known sequence of the P43 promoter gene, and amplifying the P43 promoter gene by taking the Bacillus subtilis 168 genome as a template;

2) designing a PCR primer according to the known sequence of the sfp gene, and amplifying the sfp gene by using a bacillus amyloliquefaciens FZB42 genome as a template;

3) designing a PCR primer according to the known sequence of the degQ gene, and amplifying the gene degQ by taking a bacillus subtilis 168 genome as a template;

4) connecting a P43 promoter gene, an sfp gene and a degQ gene with pHP13 plasmid in series through enzyme digestion to form a gene expression module pHP 13-P43-sfp-degQ;

5) transferring the recombinant gene expression module pHP13-P43-sfp-degQ constructed in the step 4) into an original strain of the bacillus subtilis 168 by a chemical conversion method to construct a strain BSP000 capable of synthesizing the fengycin by using glucose;

6) aiming at the BSP000 strain, collecting all gene-protein-reaction information of the strain from a database, and constructing a genome scale network metabolic model of the BSP000 strain after optimization such as supplementing deletion reaction, removing redundant reaction and the like;

7) calculating the network metabolism model constructed in the step 6) by using flux balance analysis and a minimum metabolism regulation algorithm to obtain three overexpression target genes of accA, cypC and gapA;

8) designing PCR primers according to known sequences of accA, cypC and gapA genes, and amplifying the genes accA, cypC and gapA by taking a bacillus subtilis 168 genome as a template;

9) the genes accA, cypC and gapA are connected with pHY300PLK plasmid in series through enzyme digestion to form a gene over-expression vector pHY300 ACG;

10) transferring the gene over-expression vector pHY300ACG constructed in the step 9) into a BSP000 strain by a chemical conversion method to obtain a BSP003 strain;

11) carrying out shake flask fermentation culture on the genetic engineering strain constructed in the step 10) by using a fermentation medium, and efficiently producing the fengyuan.

The nucleotide sequence of the promoter gene of P43 is SEQ ID NO. 1.

The nucleotide sequence of the sfp gene is SEQ ID NO. 2.

The nucleotide sequence of the degQ gene is SEQ ID NO. 3.

The pHP13 plasmid nucleotide sequence is SEQ ID NO: 4.

The nucleotide sequence of the accA gene is SEQ ID NO. 5.

The nucleotide sequence of the cypC gene is SEQ ID NO. 6.

The nucleotide sequence of the gapA gene is SEQ ID NO. 7.

The pHY300PLK plasmid nucleotide sequence is SEQ ID NO 8.

The fermentation medium is as follows: glucose 20g/L, peptone 20g/L, MgSO₄·7H₂O 0.5g/L，Na₂HPO₄·2H₂O 0.4g/L，NaH₂PO₄ 0.154g/L，pH 7.2～7.4。

And (3) carrying out shake-flask fermentation culture on the constructed genetic engineering strain by using a fermentation culture medium, and efficiently producing the fengyuan.

The method can ensure that the bacillus subtilis 168 has the ability of synthesizing the fengyuan, the yield of the fengyuan is 26.44mg/L, a genome scale network metabolic model of a BSP000 strain is constructed for improving the synthesis of the fengyuan, and a target gene target is predicted to be subjected to genetic engineering transformation, so that the yield of the fengyuan is improved to 59.87mg/L and is improved by 126%. The method provided by the invention provides a new strategy for improving the yield of the fengycin and has practical application value and potential commercial value for realizing the industrial production of the fengycin.

Drawings

FIG. 1: electrophoresis results of the P43 amplified gene;

FIG. 2: electrophoresis results of the P43-sfp junction fragment;

FIG. 3: electrophoresis results of the P43-sfp-degQ junction fragment;

FIG. 4: a flow chart for constructing a gene expression vector module pHP 13-P43-sfp-degQ;

FIG. 5: constructing a flow chart of an accA, cypC and gapA three-gene overexpression plasmid pHY300 ACG;

FIG. 6: comparison graph of BSP003 fengogen yield of artificial strain BSP000 and gene engineering strain.

Detailed Description

In order to make the objects, technical solutions and effects of the present invention clearer, the following detailed description of the present invention is given with reference to the accompanying drawings and specific examples, which are illustrative and not restrictive, and modifications and variations can be made thereto by those skilled in the art according to the spirit of the present invention, and these modifications and variations should be construed as being within the scope of the present invention, which is defined by the claims.

The first embodiment is as follows: construction of Fenogen synthetic Strain BSP000

(1) Design and synthesis of P43 promoter amplification primer. According to the nucleotide sequence of the P43 promoter, the nucleotide sequence is shown as SEQ ID NO:1, the amplification primers are designed as follows (the lower line represents the enzyme cutting site), and the primers are synthesized by Scirpus Biotech limited.

P43-F1:CCCAAGCTTGCGGCTTCCTTGTAGAGCTCAGC(HindⅢ)

P43-R1:

CGCGGATCCCTCGAGACGCGTGCATGCTCTAGAAGATCTCTGCAGGTCGACCATGTGTACATTCCTCTC(BamHⅠ)

(2) And (3) extracting a bacillus subtilis 168 genome. Collecting 3-5mL of overnight cultured bacillus subtilis liquid in a centrifuge tube, centrifuging at 12000rpm for 1min, discarding supernatant, and collecting thallus precipitate. Adding 1mL of sterile water into the centrifuge tube, suspending and precipitating, centrifuging at 12000rpm for 1min, discarding supernatant, and repeatedly washing for 2-3 times. Add 100. mu.L of cell wall-breaking buffer, resuspend the cells, and vortex for 3 min. Weigh in 0.2g quartz sand, add 200 μ L phenol: chloroform: isopentanol (25:24:1) was vortexed thoroughly for 3min to disrupt the bacterial cells. Add 10. mu.L of 10 XTE buffer to the centrifuge tube and vortex well for 3 min. Centrifuge at 12000rpm for 5min and take the supernatant into another clean sterile centrifuge tube. Adding 900 μ L of anhydrous ethanol and 20 μ L of 3M sodium acetate solution into the supernatant, mixing, and standing at room temperature for more than 30 min. Centrifuging at 12000rpm for 10min, discarding supernatant, and collecting the precipitate at the bottom of the centrifuge tube. The pellet was washed with 500. mu.L of 70% ethanol, gently pipetted, and then centrifuged at 12000rpm for 1 min. The precipitate was washed with 500. mu.L of 70% ethanol, gently whipped, and then centrifuged at 12000rpm for 10min, and the precipitate was collected and dried on a 55 ℃ metal bath until no alcohol smell was observed. The precipitate was dissolved with double distilled water preheated in advance in a 55 ℃ metal bath and stored in a refrigerator at-20 ℃.

(3) Amplification of the P43 promoter (the amplification results are shown in FIG. 1). The P43 promoter was amplified using the extracted Bacillus subtilis 168 genome as a template and the above-mentioned P43-F1 and P43-R1 as primers. The PCR reaction system is as follows: total volume 50. mu.L, sterile water 16. mu.L, 2 × Phanta Max Buffer 25. mu.L, dNTP Mix 1. mu.L, upstream primer 2. mu.L, downstream primer 2. mu.L, Phanta Max Super Fidelity DNA Polymerase 1. mu.L, template 3. mu.L; the PCR reaction program is: 95 ℃ for 3min, 95 ℃ for 15s, 72 ℃ for 60s/kb, 72 ℃ for 5min, 4 ℃ incubation, cycle number: 30.

(4) designing and synthesizing sfp gene amplification primers. According to the nucleic acid sequence of sfp gene, the nucleotide sequence is shown as SEQ ID NO:2, the amplification primers are designed as follows (the lower straight line represents the enzyme cutting site), and the primers are synthesized by Scenario Biotech, Inc.

sfp-F:GCGTCGACCCAAGGAGGGTATAGCTATGAAAATTTACGGAGTATATATG(SalⅠ)

sfp-R:GAAGATCTTTATAACAGCTCTTCATACGTTTTC(BglⅡ)

(5) Extraction of Bacillus amyloliquefaciens FZB42 genome. Collecting 3-5mL of overnight cultured bacillus amyloliquefaciens bacterial liquid in a centrifuge tube, centrifuging at 12000rpm for 1min, discarding supernatant, and collecting bacterial precipitates. Adding 1mL of sterile water into the centrifuge tube, suspending and precipitating, centrifuging at 12000rpm for 1min, discarding supernatant, and repeatedly washing for 2-3 times. Add 100. mu.L of cell wall-breaking buffer, resuspend the cells, and vortex for 3 min. Weigh in 0.2g quartz sand, add 200 μ L phenol: chloroform: isopentanol (25:24:1) was vortexed thoroughly for 3min to disrupt the bacterial cells. Add 10. mu.L of 10 XTE buffer to the centrifuge tube and vortex well for 3 min. Centrifuge at 12000rpm for 5min and take the supernatant into another clean sterile centrifuge tube. Adding 900 μ L of anhydrous ethanol and 20 μ L of 3M sodium acetate solution into the supernatant, mixing, and standing at room temperature for more than 30 min. Centrifuging at 12000rpm for 10min, discarding supernatant, and collecting the precipitate at the bottom of the centrifuge tube. The pellet was washed with 500. mu.L of 70% ethanol, gently pipetted, and then centrifuged at 12000rpm for 1 min. The precipitate was washed with 500. mu.L of 70% ethanol, gently whipped, and then centrifuged at 12000rpm for 10min, and the precipitate was collected and dried on a 55 ℃ metal bath until no alcohol smell was observed. The precipitate was dissolved with double distilled water preheated in advance in a 55 ℃ metal bath and stored in a refrigerator at-20 ℃.

(6) And (3) amplification of sfp gene. And (3) amplifying the sfp gene by using the extracted bacillus amyloliquefaciens FZB42 genome as a template and the sfp-F and the sfp-R as primers. The PCR reaction system is as follows: total volume 50. mu.L, sterile water 16. mu.L, 2 × Phanta Max Buffer 25. mu.L, dNTP Mix 1. mu.L, upstream primer 2. mu.L, downstream primer 2. mu.L, Phanta Max Super Fidelity DNA Polymerase 1. mu.L, template 3. mu.L; the PCR reaction program is: 95 ℃ for 3min, 95 ℃ for 15s, 72 ℃ for 60s/kb, 72 ℃ for 5min, 4 ℃ incubation, cycle number: 30.

(7) design and synthesis of primers for amplification of the degQ gene. According to the nucleotide sequence of the degQ gene, the nucleotide sequence is shown as SEQ ID NO:3, the amplification primers are designed as follows (the lower straight line represents the enzyme cutting site), and the primers are synthesized by Scirpus Biotech limited.

degQ-F:GAAGATCTCCAAGGAGGGTATAGCTATGGAAAAGAAACTTGAAGAAG(BglⅡ)

degQ-R:CGGAATTCTTTCTCCTTGATCCGGACAGAATC(EcoRⅠ)

(8) Amplification of the degQ gene. And (3) amplifying the degQ gene by using the extracted bacillus subtilis 168 genome as a template and the degQ-F and the degQ-R as primers. The PCR reaction system is as follows: total volume 50. mu.L, sterile water 16. mu.L, 2 × Phanta Max Buffer 25. mu.L, dNTP Mix 1. mu.L, upstream primer 2. mu.L, downstream primer 2. mu.L, Phanta Max Super Fidelity DNA Polymerase 1. mu.L, template 3. mu.L; the PCR reaction program is: 95 ℃ for 3min, 95 ℃ for 15s, 72 ℃ for 60s/kb, 72 ℃ for 5min, 4 ℃ incubation, cycle number: 30.

(9) the process and screening of recombinant plasmid pHP13-P43-sfp-degQ are constructed by connecting P43 promoter, sfp and degQ gene to pHP13 plasmid. As shown in FIG. 4, the P43 promoter fragment in (8) was digested with restriction enzymes Hind III and BamH I, plasmid pHP13 was also digested with Hind III and BamH I, and the gene fragment containing the cleaved ends was enzymatically ligated with plasmid pHP13 containing the same cleaved ends using T4 ligase. The sfp and degQ genes were ligated in the same manner in this order to a plasmid containing P43 promoter (the amplification results of P43-sfp after the sfp gene ligation are shown in FIG. 2, and the amplification results of P43-sfp-degQ after the degQ gene ligation are shown in FIG. 3). And transforming the ligation product into a large intestine DH5 alpha competence, coating the ligation product in an LB solid culture medium (LB solid culture medium formula: 10g/L peptone, 5g/L yeast powder, 10g/L sodium chloride and 16g/L agar) containing 5 mu g/mL chloramphenicol, culturing at 37 ℃ for 16-18 hours, selecting a single colony growing out, carrying out colony PCR verification, and screening out a correct double-gene vector pHP13-P43-sfp-degQ after the verification that the size of the fragment is consistent with that of a theoretical fragment. Liquid amplification culture is carried out on the single colony which is correctly obtained, and the extracted plasmid is sent to the department of biotechnology limited company for sequencing verification.

(10) Introducing an expression plasmid pHP13-P43-sfp-degQ into an original strain of the bacillus subtilis 168 in a transformation mode, coating the original strain on a chloramphenicol screening pressure plate for solid plate culture, performing inverted standing culture at 37 ℃ for 12-14h, selecting a single colony with a large diameter for verification, screening out a correct zygote, extracting a plasmid for verification, and finally obtaining an initial artificial strain of the bacillus subtilis 168 capable of producing the fengycin, which is named as BSP 000.

Example two: construction of Fengyin high-producing strain BSP003

(1) Aiming at the BSP000 strain, collecting all gene-protein-reaction information of the strain from a database, constructing a genome scale network metabolic model of the BSP000 strain after optimization such as filling deletion reaction, removing redundant reaction and the like, and simulating three gene overexpression targets of accA, cypC and gapA by utilizing a Flux Balance Analysis (FBA) and a minimum metabolic adjustment (MOMA) algorithm.

(2) Design and synthesis of P43 promoter, accA, cypC and gapA gene amplification primers. Amplification primers were designed based on the nucleic acid sequences of accA gene (nucleotide sequence shown by SEQ ID NO: 5), cypC gene (nucleotide sequence shown by SEQ ID NO: 6) and gapA gene (nucleotide sequence shown by SEQ ID NO: 7), respectively (the lower straight line indicates the cleavage site), and the primers were synthesized by Scutellaria Biotech Co., Ltd.

P43-F2:CCAAGCTTTGATAGGTGGTATGTTTTCGCT(HindⅢ)

P43-R2:CGGATCCCAGTCTAGACACCTCGAGGCGAGATCTCATGTGTACATTC(BamHⅠ)

accA-F:GAAGATCTCCAAGGAGGGTATAGCTGTGGCTCCAAGATTAGAATTTG(BglⅡ)

accA-R:CCGCTCGAGTTAGTTTACCCCGATATATTG(XhoⅠ)

cypC-F:CGCTCGAGCCAAGGAGGGTATAGCTATGAATGAGCAGATTCCACATG(XhoⅠ)

cypC-R:GCTCTAGATTAACTTTTTCGTCTGATTCCG(XbaⅠ)

gapA-F:GCTCTAGACCAAGGAGGGTATAGCTATGGCAGTAAAAGTCGGTATT(XbaⅠ)

gapA-R:CGGGATCCTTAAAGACCTTTTTTTGCGATG(BamHⅠ)

(3) Amplification of the P43 promoter, accA, cypC and gapA genes. The extracted Bacillus subtilis 168 genome is used as a template, and the P43-F2, P43-R2, accA-F, accA-R, cypC-F, cypC-R, gapA-F and gapA-R are used as primers to amplify the P43 promoter, accA, cypC and gapA genes. The PCR reaction system is as follows: total volume 50. mu.L, sterile water 16. mu.L, 2 × Phanta Max Buffer 25. mu.L, dNTP Mix 1. mu.L, upstream primer 2. mu.L, downstream primer 2. mu.L, Phanta Max Super Fidelity DNA Polymerase 1. mu.L, template 3. mu.L; the PCR reaction program is: 95 ℃ for 3min, 95 ℃ for 15s, 72 ℃ for 60s/kb, 72 ℃ for 5min, 4 ℃ incubation, cycle number: 30.

(4) the process and screening of recombinant plasmid pHY300ACG constructed by sequentially linking the P43 promoter, accA, cypC and gapA genes to pHY300PLK plasmid (the nucleotide sequence is shown in SEQ ID NO: 8). The construction scheme is shown in FIG. 5, the P43 promoter fragment in (3) is digested with restriction enzymes Hind III and BamH I, plasmid pHY300PLK is also digested with Hind III and BamH I, and the gene fragment containing the cleaved ends is enzymatically ligated with plasmid pHP13 containing the same cleaved ends using T4 ligase. The accA, cypC and gapA genes were ligated in the same manner in sequence to a plasmid containing the P43 promoter. And transforming the ligation product into a large intestine DH5 alpha competence, coating the ligation product in an LB solid culture medium (LB solid culture medium formula: 10g/L peptone, 5g/L yeast powder, 10g/L sodium chloride and 16g/L agar) containing 100 mu g/mL ampicillin, culturing at 37 ℃ for 16-18 hours, selecting a single colony growing out, carrying out colony PCR verification, and verifying that the size of the fragment accords with the size of a theoretical fragment, namely screening out a correct three-gene vector pHY300 PLK. Liquid amplification culture is carried out on the single colony which is correctly obtained, and the extracted plasmid is sent to the department of biotechnology limited company for sequencing verification.

(10) Introducing an expression plasmid pHY300PLK into a bacillus subtilis BSP000 original strain in a mode of transformation, coating the strain on a chloramphenicol and tetracycline screening pressure plate for solid plate culture, performing inverted standing culture at 37 ℃ for 12-14h, selecting a single colony with a large diameter for verification, screening out a correct zygote, extracting a plasmid for verification, and finally obtaining the bacillus subtilis strain capable of efficiently producing the toyoxin, wherein the bacillus subtilis strain is named as BSP 003.

Example three: culture and fermentation of BSP000 and BSP003 strains

(1) The components of the culture medium:

seed culture medium: 10g/L of tryptone, 5g/L of yeast extract powder, 10g/L of NaCl and 7.0 of pH;

fermentation medium: glucose 20g/L, peptone 20g/L, MgSO₄·7H₂O 0.5g/L，Na₂HPO₄·2H₂O 0.4g/L，NaH₂PO₄ 0.154g/L，pH 7.2～7.4。

(2) Culturing and fermenting BSP000 and BSP003 strains. Respectively inoculating the fengycin synthetic strain BSP000 and the fengycin high-yield strain BSP003 of the invention to an LB liquid culture medium at 37 ℃ for activation culture for 12-14h, taking a bacterial liquid to continuously perform solid plate culture, reversing and standing the bacterial liquid at 37 ℃ for culture for 16h, taking a bacterial colony with a larger diameter, performing seed culture in a seed culture medium with a liquid containing 50mL of liquid, culturing the bacterial colony at 37 ℃ and 220rpm/min for 12h to obtain a seed liquid, inoculating the seed liquid into a fermentation culture medium with an inoculation amount of 8.5% in volume ratio, fermenting at 37 ℃ and 190rpm/min, taking 30mL of fermentation liquid in a sterilized and dried 50mL special centrifuge tube at 48h, centrifuging at 8000rpm for 30min, collecting a supernatant, adjusting the pH to 2 by 6M HCl, standing in a refrigerator at 4 ℃ for 24h, centrifuging at 8000rpm for 30min after complete precipitation, collecting the precipitate, extracting the precipitate by using 5mL of methanol, adjusting the pH to 7.0, standing at 4 ℃ for 12h, the product is filtered by a 0.22 mu m oil film and then is used for the yield analysis of liquid chromatogram; liquid chromatograph 1100(Agilent, USA), column type: XDB C-18 reverse phase column (250 mm. times.4.6 mm, 5 μm), mobile phase: v (acetonitrile): v (water): v (trifluoroacetic acid) ═ 50: 50: 0.5, 0.8mL/min, 30 ℃, 210nm, and 20 muL of sample injection. The detection result of the fermentation yield is shown in fig. 6, the BSP000 can be produced to 26.44mg/L by the method provided by the invention, and the synthesis of the fengycin is realized; the yield of the fengycin of BSP003 is 59.87mg/L, which is increased by 126 percent compared with BSP 000.

The method provided by the invention provides a new strategy for improving the yield of the fengycin, and has practical application value and potential commercial value in the industrial production of the fengycin.

While the methods and techniques of the present invention have been described in terms of preferred embodiments, it will be apparent to those of ordinary skill in the art that variations and/or modifications of the methods and techniques described herein may be made without departing from the spirit and scope of the invention. It is expressly intended that all such similar substitutes and modifications apparent to those skilled in the art are deemed to be within the spirit, scope and content of the invention.

Sequence listing

<110> Tianjin university

<120> construction method for converting high-yield bacterial strain of fengycin by using glucose

<160> 8

<170> SIPOSequenceListing 1.0

<210> 1

<211> 354

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

gcggcttcct tgtagagctc agcattattg agtggatgat tatattcctt ttgataggtg 60

gtatgttttc gcttgaactt ttaaatacag ccattgaaca tacggttgat ttaataactg 120

acaaacatca ccctcttgct aaagcggcca aggacgctgc cgccggggct gtttgcgttt 180

ttgccgtgat ttcgtgtatc attggtttac ttattttttt gccaaagctg taatggctga 240

aaattcttac atttatttta catttttaga aatgggcgtg aaaaaaagcg cgcgattatg 300

taaaatataa agtgatagcg gtaccattat aggtaagaga ggaatgtaca catg 354

<210> 2

<211> 675

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

atgaaaattt acggagtata tatggaccgc ccgctttctg caggggaaga ggatcggatg 60

atggcggccg tgtccgccga aaagcgggaa aaatgccggc gcttttacca taaggaggat 120

gctcaccgca ccttgatcgg cgacatgctg atccgcaccg ctgcggcgaa ggcttatgga 180

cttgatccgg ccgggatttc attcggcgtc caggaatacg gaaagccgta catccccgcg 240

cttccggaca tgcactttaa catttcccac tccgggcgct ggatcgtgtg cgccgttgat 300

tcaaaaccga tcggcattga tattgaaaaa atgaagcccg gcacaattga tatcgccaaa 360

cggttttttt cgccgacgga atacagtgat ctgcaagcga aacaccccga tcagcagacc 420

gattattttt accacctgtg gtcgatgaaa gaaagcttta tcaagcaggc cggaaaaggg 480

ctttccctgc cgcttgattc attcagcgtc cgccttaaag acgacggcca tgtgtccatt 540

gagctcccgg acggacatga accttgtttc atccgcacat atgaggcgga cgaggagtat 600

aagctggccg tttgtgcggc gcatcccgat ttttgtgacg ggattgagat gaaaacgtat 660

gaagagctgt tataa 675

<210> 3

<211> 325

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

atggaaaaga aacttgaaga agtaaaacaa ttgttattcc gactcgaact tgatattaaa 60

gaaacgacag attcattacg aaacattaac aaaagcattg atcaactcga taaatacaat 120

tatgcaatga aaatttcgtg aaaaagactt ggaaacaagt cttttttttc gttctaccga 180

tacaataaat ggataaagta ttatatgatt gttaaaaaac gaaaaacctg ctgtccttta 240

aatgtcccat ttagtaaaat ggaatgggag gggggaagtc gttattgagc agatatgttt 300

agattctgtc cggatcaagg agaaa 325

<210> 4

<211> 4748

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

tatattttat aggattggtt tttaggaaat ttaaactgca atatatcctt gtttaaaact 60

tggaaattat cgtgatcaac aagtttattt tctgtagttt tgcataattt atggtctatt 120

tcaatggcag ttacgaaatt acacctcttt actaattcaa gggtaaaatg gccttttcct 180

gagccgattt caaagatatt atcatgttca tttaatctta tatttgtcat tattttatct 240

atattatgtt ttgaagtaat aaagttttga ctgtgtttta tatttttctc gttcattata 300

accctcttta atttggttat atgaattttg cttattaacg attcattata accacttatt 360

ttttgtttgg ttgataatga actgtgctga ttacaaaaat actaaaaatg cccatatttt 420

ttcctcctta taaaattagt ataattatag cacgaaaagg atctaggtga agatcctttt 480

tgataatctc atgaccaaaa tcccttaacg tgagttttcg ttccactgag cgtcagaccc 540

cgtagaaaag atcaaaggat cttcttgaga tccttttttt ctgcgcgtaa tctgctgctt 600

gcaaacaaaa aaaccaccgc taccagcggt ggtttgtttg ccggatcaag agctaccaac 660

tctttttccg aaggtaactg gcttcagcag agcgcagata ccaaatactg ttcttctagt 720

gtagccgtag ttaggccacc acttcaagaa ctctgtagca ccgcctacat acctcgctct 780

gctaatcctg ttaccagtgg ctgctgccag tggcgataag tcgtgtctta ccgggttgga 840

ctcaagacga tagttaccgg ataaggcgca gcggtcgggc tgaacggggg gttcgtgcac 900

acagcccagc ttggagcgaa cgacctacac cgaactgaga tacctacagc gtgagctatg 960

agaaagcgcc acgcttcccg aagggagaaa ggcggacagg tatccggtaa gcggcagggt 1020

cggaacagga gagcgcacga gggagcttcc agggggaaac gcctggtatc tttatagtcc 1080

tgtcgggttt cgccacctct gacttgagcg tcgatttttg tgatgctcgt caggggggcg 1140

gagcctatgg aaaaacgcca gcaacgcggc ctttttacgg ttcctggcct tttgctggcc 1200

ttttgctcac atgttctttc ctgcgttatc ccctgattct gtggataacc gtattaccgc 1260

ctttgagtga gctgataccg ctcgccgcag ccgaacgacc gagcgcagcg agtcagtgag 1320

cgaggaagcg gaagagcgcc caatacgcaa accgcctctc cccgcgcgtt ggccgattca 1380

ttaatgcagc tggcacgaca ggtttcccga ctggaaagcg ggcagtgagc gcaacgcaat 1440

taatgtgagt tagctcactc attaggcacc ccaggcttta cactttatgc ttccggctcg 1500

tatgttgtgt ggaattgtga gcggataaca atttcacaca ggaaacagct atgaccatga 1560

ttacgccaag cttggctgca ggtcgacgga tccccgggaa ttcactggcc gtcgttttac 1620

aacgtcgtga ctgggaaaac cctggcgtta cccaacttaa tcgccttgca gcacatcccc 1680

ctttcgccag ctggcgtaat agcgaagagg cccgcaccga tcgcccttcc caacagttgc 1740

gcagcctgaa tggcgaatgg cgactaacgg ggcaggttag tgacattaga aaaccgactg 1800

taaaaagtac agtcggcatt atctcatatt ataaaagcca gtcattaggc ctatctgaca 1860

attcctgaat agagttcata aacaatcctg catgataacc atcacaaaca gaatgatgta 1920

cctgtaaaga tagcggtaaa tatattgaat tacctttatt aatgaatttt cctgctgtaa 1980

taatgggtag aaggtaatta ctattattat tgatatttaa gttaaaccca gtaaatgaag 2040

tccatggaat aatagaaaga gaaaaagcat tttcaggtat aggtgttttg ggaaacaatt 2100

tccccgaacc attatatttc tctacatcag aaaggtataa atcataaaac tctttgaagt 2160

cattctttac aggagtccaa ataccagaga atgttttaga tacaccatca aaaattgtat 2220

aaagtggctc taacttatcc caataaccta actctccgtc gctattgtaa ccagttctaa 2280

aagctgtatt tgagtttatc acccttgtca ctaagaaaat aaatgcaggg taaaatttat 2340

atccttcttg ttttatgttt cggtataaaa cactaatatc aatttctgtg gttatactaa 2400

aagtcgtttg ttggttcaaa taatgattaa atatctcttt tctcttccaa ttgtctaaat 2460

caattttatt aaagttcatt tgatatgcct cctaaatttt tatctaaagt gaatttagga 2520

ggcttacttg tctgctttct tcattagaat caatcctttt ttaaaagtca atattactgt 2580

aacataaata tatattttaa aaatatccca ctttatccaa ttttcgtttg ttgaactaat 2640

gggtgcttta gttgaagaat aaaagaccac attaaaaaat gtggtctttt gtgttttttt 2700

aaaggatttg agcgtagcga aaaatccttt tctttcttat cttgatacta tatagaaaca 2760

acatcatttt tcaaaattag gtcaaagcct tgtgtatcaa gggtttgatg gttctttgac 2820

aggtaaaaac tccttctgct attattaagg tgtcgaatca aaataataga atgctagaga 2880

actagctcag aaggagtttt tttgttgatt tattcatctg aaaatgatta tagcatcctc 2940

gaagataaaa ccgcaacagg taaaaagcgg gattggaagg ggaaaaagag acggacgaac 3000

ctcatggcgg agcattacga agcgttagag agtaagattg gggcacctta ctatggcaaa 3060

aaggctgaaa aactaattag ttgtgcagag tatctttcgt ttaagagaga cccggagacg 3120

ggcaagttaa aactgtatca agcccatttt tgtaaagtga ggttatgtcc gatgtgtgcg 3180

tggcgcaggt cgttaaaaat tgcttatcac aataagttga tcgtagagga agccaataga 3240

cagtacggct gcggatggat ttttctcacg ctgacgattc gaaatgtaaa gggagaacgg 3300

ctgaagccac aaatttctgc gatgatggaa ggctttagga aactgttcca gtacaaaaaa 3360

gtaaaaactt cggttcttgg atttttcaga gctttagaga ttaccaaaaa tcatgaagaa 3420

gatacatatc atcctcattt tcatgtgttg ataccagtaa ggaaaaatta ttttgggaaa 3480

aactatatta agcaggcgga gtggacgagc ctttggaaaa aggcgatgaa attggattac 3540

actccaattg tcgatattcg tcgagtgaaa ggtaaagcta agattgacgc tgaacagatt 3600

gaaaacgatg tgcggaacgc aatgatggag caaaaagctg ttctcgaaat ctctaaatat 3660

ccggttaagg atacggatgt tgtgcgcggt aataaggtga ctgaagacaa tctgaacacg 3720

gtgctttact tggatgatgc gttggcagct cgaaggttaa ttggatacgg tggcattttg 3780

aaggagatac ataaagagct gaatcttggt gatgcggagg acggcgatct ggtcaagatt 3840

gaggaagaag atgacgaggt tgcaaatggt gcatttgagg ttatggctta ttggcatcct 3900

ggcattaaaa attacataat caaataaaaa aagcagacct ttagaaggcc tgctttttta 3960

actaacccat ttgtattgtg ttgaaatatg ttttgtatgg tgcactctca gtacaatctg 4020

ctctgatgcc gcatagttaa gccagccccg acacccgcca acacccgctg acgcgccctg 4080

acgggcttgt ctgctcccgg catccgctta cagacaagct gtgaccgtct ccgggagctg 4140

catgtgtcag aggttttcac cgtcatcacc gaaacgcgcg agacgaaagg gcctcgtgat 4200

acgcctattt ttataggtta atgtcatgat aataatggtt tcttagcgat tcacaaaaaa 4260

taggcacacg aaaaacaagt taagggatgc agtttatgca tcccttaact tacttattaa 4320

ataatttata gctattgaaa agagataaga attgttcaaa gctaatattg tttaaatcgt 4380

caattcctgc atgttttaag gaattgttaa attgattttt tgtaaatatt ttcttgtatt 4440

ctttgttaac ccatttcata acgaaataat tatacttttg tttatctttg tgtgatattc 4500

ttgatttttt tctacttaat ctgataagtg agctattcac tttaggttta ggatgaaaat 4560

attctcttgg aaccatactt aatatagaaa tatcaacttc tgccattaaa agtaatgcca 4620

atgagcgttt tgtatttaat aatcttttag caaacccgta ttccacgatt aaataaatct 4680

cattagctat actatcaaaa acaattttgc gtattatatc cgtacttatg ttataaggta 4740

tattacca 4748

<210> 5

<211> 978

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

gtggctccaa gattagaatt tgaaaaaccg gtgattgaac tgcaaaccaa aatcgccgaa 60

ctaaaaaaat tcacccaaga ttccgatatg gatctaagtg cggaaatcga acggctcgaa 120

gaccgtctcg ctaagcttca ggatgatatt tacaaaaatt tgaagccgtg ggaccgggtt 180

caaatcgcgc gtctggcgga ccgtccgaca actcttgatt atatcgaaca cctgtttacc 240

gacttttttg aatgtcacgg agacagagcg tacggggacg atgaagccat tgtcggcggg 300

attgcgaagt tccacggcct ccctgtaacg gtaatcgggc atcagcgcgg caaagacacg 360

aaggaaaacc tagtccgcaa ttttgggatg ccgcatccag aaggctacag aaaagcgctt 420

cgtctgatga aacaggctga caaatttaac agaccaatta tctgttttat tgatacgaag 480

ggggcatacc ctggacgagc agctgaagaa agaggacaaa gtgaagctat tgccaaaaac 540

ctgtttgaga tggccggcct tcgagtgcct gttatctgca tcgtcattgg tgaaggcgga 600

agcggcggag cccttggtct gggtgtaggc aatcacttgc atatgctgga aaactctact 660

tattctgtta tttctccgga aggtgccgcg gcacttttat ggaaggactc cagtcttgct 720

aaaaaagcag cagaaacaat gaaaatcact gcgccggatt taaaagaatt aggtattata 780

gatcatatga ttaaagaagt aaaaggcgga gcgcaccatg atgtgaagct gcaggcaagc 840

tatatggacg aaacccttaa acaatcgtta aaaactttac tgaagctgag cgaagaagaa 900

ttagttcagc agcgttatga aaaatataaa gcaattggca aagtctcggt tgaagatcaa 960

tatatcgggg taaactaa 978

<210> 6

<211> 1254

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

atgaatgagc agattccaca tgacaaaagt ctcgataaca gtctgacact gctgaaggaa 60

gggtatttat ttattaaaaa cagaacagag cgctacaatt cagatctgtt tcaggcccgt 120

ttgttgggaa aaaactttat ttgcatgact ggcgctgagg cggcgaaggt gttttatgat 180

acggatcgat tccagcggca gaacgctttg cctaagcggg tgcagaaatc gctgtttggt 240

gttaatgcga ttcagggaat ggatggcagc gcgcatatcc atcggaagat gctttttctg 300

tcattgatga caccgccgca tcaaaaacgt ttggctgagt tgatgacaga ggagtggaaa 360

gcagcagtca caagatggga gaaggcagat gaggttgtgt tatttgaaga agcaaaagaa 420

atcctgtgcc gggtagcgtg ctattgggca ggtgttccgt tgaaggaaac ggaagtcaaa 480

gagagagcgg atgacttcat tgacatggtc gacgcgttcg gtgctgtggg accgcggcat 540

tggaaaggaa gaagagcaag gccgcgtgcg gaagagtgga ttgaagtcat gattgaagat 600

gctcgtgccg gcttgctgaa aacgacttcc ggaacagcgc tgcatgaaat ggcttttcac 660

acacaagaag atggaagcca gctggattcc cgcatggcag ccattgagct gattaatgta 720

ctgcggccta ttgtcgccat ttcttacttt ctggtgtttt cagctttggc gcttcatgag 780

catccgaagt ataaggaatg gctgcggtct ggaaacagcc gggaaagaga aatgtttgtg 840

caggaggtcc gcagatatta tccgttcggc ccgtttttag gggcgcttgt caaaaaagat 900

tttgtatgga ataactgtga gtttaagaag ggcacatcgg tgctgcttga tttatatgga 960

acgaaccacg accctcgtct atgggatcat cccgatgaat tccggccgga acgatttgcg 1020

gagcgggaag aaaatctgtt tgatatgatt cctcaaggcg gggggcacgc cgagaaaggc 1080

caccgctgtc caggggaagg cattacaatt gaagtcatga aagcgagcct ggatttcctc 1140

gtccatcaga ttgaatacga tgttccggaa caatcactgc attacagtct cgccagaatg 1200

ccatcattgc ctgaaagcgg cttcgtaatg agcggaatca gacgaaaaag ttaa 1254

<210> 7

<211> 1008

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

atggcagtaa aagtcggtat taacggtttt ggtcgtattg gacgtaacgt attccgcgca 60

gcattaaaca atcctgaagt tgaggtagta gcggttaacg atttaacaga tgctaacatg 120

ctggctcacc ttttacaata tgattctgta cacggaaaat tagacgctga agtttcagtt 180

gacggtaaca accttgttgt taacggcaaa acaattgaag tttctgcaga acgcgatcct 240

gctaaactta gctggggcaa acaaggcgtt gaaatcgtag ttgaatctac tggtttcttc 300

acaaaacgcg cagacgctgc gaaacactta gaagctggcg cgaaaaaagt aatcatctct 360

gctcctgcta acgaagaaga tatcacaatc gttatgggtg ttaacgaaga taaatacgat 420

gcggctaacc acgatgttat ctctaacgca tcttgcacaa caaactgcct tgcgccgttt 480

gcaaaagtac ttaacgataa attcggcatc aaacgcggta tgatgacaac tgttcactct 540

tacacaaacg atcagcaaat ccttgatctt ccgcacaaag actaccgtcg tgcgcgtgca 600

gcagctgaaa acatcatccc aacatcaact ggtgctgcta aagcagtttc tctagttctt 660

cctgaactaa aaggcaaact gaacggtgga gcaatgcgtg ttccaactcc aaacgtttct 720

ctagttgact tggttgctga actgaaccaa gaagtaacag ctgaagaagt aaacgcagct 780

cttaaagaag cggctgaagg cgaccttaaa ggaatccttg gctacagcga agagccatta 840

gtttctggcg actacaacgg aaacaaaaac tcttctacaa tcgatgctct ttctacaatg 900

gttatggaag gcagcatggt aaaagtaatc tcttggtacg ataacgaaag cggctactct 960

aaccgcgttg ttgaccttgc agcttacatc gcaaaaaaag gtctttaa 1008

<210> 8

<211> 3

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

Claims

1. A construction method for converting a high-yield bacterial strain of fengycin by using glucose; is characterized by comprising the following steps

2) designing a PCR primer according to the known sequence of the sfp gene, and amplifying the gene sfp by using a bacillus subtilis 168 genome as a template;

3) designing a PCR primer according to the known sequence of the degQ gene, and amplifying the gene degQ by taking the genome of the bacillus amyloliquefaciens FZB42 as a template;

4) the gene sfp and the gene degQ are connected in series with pHP13 plasmid through enzyme digestion enzyme to form a gene expression module pHP 13-P43-sfp-degQ;

2. The method as claimed in claim 1, wherein the nucleotide sequence of the P43 promoter gene is SEQ ID NO. 1.

3. The method as claimed in claim 1, wherein the nucleotide sequence of sfp gene is SEQ ID NO 2.

4. The method as claimed in claim 1, wherein the nucleotide sequence of the degQ gene is SEQ ID NO. 3.

5. The method as claimed in claim 1, wherein the pHP13 plasmid has the nucleotide sequence of SEQ ID NO 4.

6. The method of claim 1, wherein the nucleotide sequence of accA gene is SEQ ID NO 5.

7. The method of claim 1, wherein the nucleotide sequence of the cypC gene is SEQ ID NO 6.

8. The method of claim 1, wherein the nucleotide sequence of gapA gene is SEQ ID NO 7.

9. The method of claim 1, wherein the pHY300PLK plasmid nucleotide sequence is SEQ ID NO 8.

10. The method of claim 1, wherein the fermentation medium is: glucose 20g/L, peptone 20g/L, MgSO₄·7H₂O 0.5g/L，Na₂HPO₄·2H₂O 0.4g/L，NaH₂PO₄ 0.154g/L，pH 7.2～7.4。