CN113249493A - Real-time fluorescence PCR method, probe, primer and kit for typing human platelet alloantigen system alleles - Google Patents
Real-time fluorescence PCR method, probe, primer and kit for typing human platelet alloantigen system alleles Download PDFInfo
- Publication number
- CN113249493A CN113249493A CN202110247485.4A CN202110247485A CN113249493A CN 113249493 A CN113249493 A CN 113249493A CN 202110247485 A CN202110247485 A CN 202110247485A CN 113249493 A CN113249493 A CN 113249493A
- Authority
- CN
- China
- Prior art keywords
- hpa
- real
- fluorescent
- alleles
- typing
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6858—Allele-specific amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biophysics (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides a real-time fluorescence PCR method, a probe, a primer and a kit for typing human platelet alloantigen system alleles. The real-time fluorescence PCR method for typing the alleles of the human platelet alloantigen system carries out typing designation on the a and b alleles of the HPA-6w and HPA-21w antigen systems in the same amplification reaction system and the same amplification reaction program, and specifically comprises the following steps: (1) preparing human genome DNA as a template for PCR amplification; (2) synthesizing an amplification primer and a specific fluorescent probe and preparing a PCR amplification reaction system; (3) acquiring a fluorescent signal by using a real-time fluorescent PCR device under the same amplification reaction system and the same amplification reaction program; (4) analyzing the fluorescent signal result obtained in the step (3), and determining the genotype according to the strength of the fluorescent signal. The invention realizes the detection of the HPA-6w and HPA-21w alleles under the same condition, adopts different probes aiming at the a and b alleles and effectively solves the defect of real-time fluorescence based on PCR-SSP in the past.
Description
Technical Field
The invention belongs to the technical field of genotyping, and particularly relates to a real-time fluorescence PCR method, a probe, a primer and a kit for genotyping human platelet alloantigen systems.
Background
Blood group antigens exist on the surface of human platelets, and play an important role in alloimmunity and platelet immune response. Platelet-specific Alloantigen Systems (HPAs) exist on human platelet membranes in addition to carbohydrate erythroid blood group antigens such as AB, H, Lewis, I, P and the like and HLA-I leukocyte antigens on platelets. HPA presents certain polymorphism among individuals, and can generate allogeneic platelet antibodies through the immune stimulation of ways such as blood transfusion, pregnancy or hematopoietic stem cell transplantation and the like, which is one of the causes of allogeneic immune thrombocytopenia. Therefore, the research on the platelet alloantigen system provides a related detection method, which is helpful for determining the genotype of the individual platelet antigen system and avoiding the generation of corresponding antibodies.
Studies have shown that the HPA genes are localized on platelet membrane glycoproteins and CD109, and 35 of the now well-known HPA systems have been reached, and the development of HPA genotyping will help to define individual HPA antigen expression. Currently, the major methods for HPA genotyping are polymerase chain reaction-sequence specific primers (PCR-SSP), PCR-sequence based typing techniques (PCR-sequence based typing, PCR-SBT) and real-time fluorescence PCR techniques. The PCR-SSP method is fast, simple and convenient, but the method needs two pairs of primers to effectively distinguish one antigen system, so that more hole sites need to be amplified when detecting a plurality of HPA systems, and new special mutation sites are difficult to define. The PCR-SBT typing method can accurately type HPA, is a gold standard method, but needs to amplify, enzyme-cut and sequence template DNA, and has long time consumption and high cost. Real-time fluorescent Quantitative PCR (Quantitative Real-time PCR, QT-PCR) can accurately classify an HPA system and has the advantage of short time consumption, but most of the existing methods are based on the improvement of PCR-SSP technology, the fluorescence detection is increased after SSP primer amplification, one HPA system still needs to amplify two wells, and each well has the risk of false negative caused by amplification failure.
The HPA distribution has the difference of population, and different nationalities and regional distributions. Early studies show that HPA-6w and HPA-21w have polymorphism in Chinese population, and international studies show that the polymorphism of HPA-21w system mainly exists in east Asia population, which is also a polymorphic site reported in the early research of our laboratory. The current real-time fluorescent quantitative PCR method for detecting HPA-6w and HPA-21w alleles is few, so the invention establishes a real-time fluorescent PCR method for typing HPA-6w and HPA-21w alleles of a human platelet alloantigen system aiming at the problem, and contributes to the typing work of HPA-6w and HPA-21 w.
Disclosure of Invention
The invention firstly solves the problem of providing a real-time fluorescence PCR method for typing HPA-6w and HPA-21w alleles of a human platelet alloantigen system so as to provide a rapid typing method for the HPA-6w and HPA-21w alleles.
Therefore, the above object of the present invention is achieved by the following technical solutions:
a real-time fluorescence PCR method for typing human platelet alloantigen system alleles is characterized in that: the real-time fluorescence PCR method for typing the alleles of the human platelet alloantigen system carries out typing designation on the a and b alleles of the HPA-6w and HPA-21w antigen systems in the same amplification reaction system and the same amplification reaction program, and specifically comprises the following steps:
(1) preparing human genome DNA as a template for PCR amplification;
(2) synthesizing an amplification primer and a specific fluorescent probe and preparing a PCR amplification reaction system;
(3) acquiring a fluorescent signal by using a real-time fluorescent PCR device under the same amplification reaction system and the same amplification reaction program;
(4) analyzing the fluorescent signal result obtained in the step (3), and determining the genotype according to the strength of the fluorescent signal.
While adopting the technical scheme, the invention can also adopt or combine the following technical scheme:
as a preferred technical scheme of the invention: the amplification primers in the step (2) are as follows:
(1) amplification primer of HPA-6w antigen system gene sequence
HPA-6F：5’TGTGAGTGCTCAGAGGAGGA3’
HPA-6R：5’GTGGCAGACACATTGACCAC 3’
(2) Amplification primer of HPA-21w antigen system gene sequence
HPA-21F：5’GGAGATCAGAGCTGGACTGG 3’
HPA-21R：5’TAGAACCTGGGTGTGTGCAA 3’
The specific fluorescent probe in the step (2) is as follows:
(1) fluorescent probe of HPA-6w antigen system
HPA-6 aP: 5 'FAM-CAGCCCCCGRGAGGGTC-3' MGB for the detection of HPA-6a allele;
HPA-6 bP: 5 'HEX-CAGCCCCCARGAGGGTCA-3' MGB for detecting HPA-6b allele;
(2) fluorescent probe of HPA-21w antigen system
HPA-21 aP: 5 'FAM-ACATGACGAAAATACCTG-3' MGB for the detection of HPA-21a allele;
HPA-21 bP: 5 'HEX-CTACATGACAAAAATA-3' MGB for the detection of HPA-21b alleles.
As a preferred technical scheme of the invention: the real-time fluorescent PCR amplification reaction system in the step (3) comprises:
SGexcel GoldStar TaqMan mix 7.5. mu.l; the concentration of each primer is 50 mu mol/L, and the dosage of each primer is 0.06 mu L; the concentration of each probe is 50 mu mol/L, and the dosage of the probe is 0.06 mu L; 50-100 ng/. mu.l of genomic DNA 1.5. mu.l; the balance being H2Make up to 15. mu.l of O.
As a preferred technical scheme of the invention: the real-time fluorescent PCR amplification reaction program in the step (3) is as follows:
pre-denaturation at 95 ℃ for 3 min; 50 cycles of 95 ℃ for 20s and 60 ℃ for 30 s; the fluorescence signal was read every cycle.
The second purpose of the invention is to provide an amplification primer composition for a real-time fluorescence PCR method for typing human platelet alloantigen system alleles, aiming at the defects in the prior art.
Therefore, the above object of the present invention is achieved by the following technical solutions:
the amplification primer composition for the real-time fluorescence PCR method for typing human platelet alloantigen system alleles is characterized by comprising the following steps of: the amplification primer composition comprises:
(1) amplification primer of HPA-6w antigen system gene sequence
HPA-6F：5’TGTGAGTGCTCAGAGGAGGA 3’
HPA-6R：5’GTGGCAGACACATTGACCAC 3’
(2) Amplification primer of HPA-21w antigen system gene sequence
HPA-21F：5’GGAGATCAGAGCTGGACTGG 3’
HPA-21R：5’TAGAACCTGGGTGTGTGCAA 3’。
The third purpose of the invention is to provide a fluorescent probe composition for the real-time fluorescent PCR method of human platelet alloantigen system allele typing, aiming at the defects in the prior art.
Therefore, the above object of the present invention is achieved by the following technical solutions:
the fluorescent probe composition for the real-time fluorescent PCR method of human platelet alloantigen system allele typing is characterized in that: the fluorescent probe composition comprises:
(1) fluorescent probe of HPA-6w antigen system
HPA-6aP：5’FAM-CAGCCCCCGRGAGGGTC-3’MGB
HPA-6bP：5’HEX-CAGCCCCCARGAGGGTCA-3’MGB
(2) Fluorescent probe of HPA-21w antigen system
HPA-21aP：5’FAM-ACATGACGAAAATACCTG-3’MGB
HPA-21bP：5’HEX-CTACATGACAAAAATA-3’MGB。
It is still another object of the present invention to provide a kit for real-time fluorescent PCR for isotyping human platelet alloantigen system alleles.
Therefore, the above object of the present invention is achieved by the following technical solutions:
the kit for the real-time fluorescence PCR method for typing human platelet alloantigen system alleles is characterized in that: the kit for the real-time fluorescent PCR method for typing the human platelet alloantigen system allele comprises the amplification primer composition for the real-time fluorescent PCR method for typing the human platelet alloantigen system allele and the fluorescent probe composition for the real-time fluorescent PCR method for typing the human platelet alloantigen system allele.
The oligonucleotide primers and probes designed by the invention are obtained by designing according to the continuous oligonucleotide sequences of the human HPA antigen gene sequences in GenBank including the genetic polymorphic sites thereof. Amplification primers and probes for the ITGB3 gene sequences of HPA-6w and HPA-21bw antigen systems were designed based on the sequence numbered NC-000017.10 (45331208-45390077) in GenBank.
The invention uses 2 pairs of oligonucleotide primers to respectively amplify 2 gene segments of HPA-6w and HPA-21w systems. Wherein primers of HPA-6w and HPA-21w antigen systems respectively amplify 45378565-45378681 site and 45386600-45386818 site in the sequence with the GenBank accession number of NC-000017.10 (45331208-45390077), thereby ensuring effective amplification of 2 antigen system genes. The design of the amplification primers refers to a dbSNP database to avoid the polymorphic sites of the HPA antigen coding sequence and avoid the omission of any mutation points.
Aiming at the a and b alleles of HPA-6w and HPA-21w systems, the invention designs 4 specific fluorescent probes (HPA-6 aP, HPA-6bP, HPA-21aP and HPA-21bP respectively, and are used for detecting the HPA-6a allele, the HPA-6b allele, the HPA-21a allele and the HPA-21b allele respectively), the sequence positions are 45378612-45378628, 45378612-45378629, 45386715-45386732 and 45386713-45386728 respectively, a fluorescent reporter (FAM or HEX) is marked on the probe 5', and a quencher MGB is marked on the probe 3'. When the probe is complete, the fluorescent signal emitted by the reporter group is absorbed by the quenching group; when a specific allele probe can be mutually complemented with a target sequence in the PCR amplification process, the Taq enzyme utilizes the 5'-3' exonuclease activity to carry out enzyme digestion and degradation on the probe, so that a report fluorescent group and a quenching fluorescent group are separated, a fluorescence monitoring system can receive a fluorescent signal, and the allele exists on an individual sequence; when the specific allele probe cannot be complemented with the sequence, the reporter fluorophore and the quencher fluorophore on the probe are not separated, the fluorescence monitoring system cannot detect the corresponding fluorescence signal, and the allele does not exist on the individual sequence, so that the identification of the allele is realized.
The method provided by the invention realizes the detection of the alleles of HPA-6w and HPA-21w under the same amplification reaction system and amplification reaction program by self-designing primers and probes and optimizing amplification detection conditions, and effectively solves the defect of real-time fluorescence based on PCR-SSP in the past by adopting different probes aiming at the alleles a and b. Meanwhile, the method provided by the invention can realize the identification of a systematic allele a and b in a single hole, and reduces the required hole sites compared with the conventional real-time fluorescence based on PCR-SSP; meanwhile, the method provided by the invention establishes a real-time fluorescence method of HPA-21w allele aiming at the HPA-21 distribution characteristic of Chinese population for the first time.
The reagent and the method provided by the invention can be used as an independent and widely-applied identification method, solve the problem of rapid and accurate setting of the allele of the HPA-6w and HPA-21w antigen systems, exert the characteristics of high flux, accurate result and rapidness of real-time fluorescence PCR (polymerase chain reaction) on setting operation of the allele of the HPA gene, and have great importance on related applications in the fields of blood transfusion medical research, genetics and the like, thereby having important significance on medical research units, pharmaceutical research and reagent development units.
Drawings
FIG. 1 is a diagram showing the results of real-time fluorescence PCR of HPA-6w, the specimen being HPA-6waa genotype.
FIG. 2 is a diagram showing the results of real-time fluorescence PCR of HPA-6w, the specimen being HPA-6wab genotype.
FIG. 3 is a diagram showing the results of real-time fluorescence PCR of HPA-21w, the specimen being HPA-21waa genotype.
FIG. 4 is a diagram showing the results of real-time fluorescence PCR of HPA-21w, the specimen being HPA-21wab genotype.
Detailed Description
The present invention will be described in further detail with reference to examples.
The present embodiment will be described in detail with reference to examples of typing of HPA-6w and HPA-21bw system antigen alleles using blood of a donor as a test sample.
The real-time fluorescent PCR method for genotyping of the invention comprises the following steps:
1. human genomic DNA was prepared as a template for PCR amplification in the subsequent steps.
200 mu l of whole blood to be detected is taken, genomic DNA is extracted according to the instruction of a MagDNA Pure LC DNA Isolation Kit, and the concentration and purity of the genomic DNA are determined by using a spectrophotometer.
2. Synthesizing 2 pairs of amplification primers and 4 specific fluorescent probes, wherein specific primer sequences and probe sequences are shown in the invention content and gene sequences in a sequence table, and are not described herein any more, and the amplification primers and the fluorescent probes are diluted to 50 mu mol/L by using pure water.
Preparation of SGexcel GoldStar TaqMan mix (With ROX, Shanghai Biotech Co., Ltd.), RNase-free H2And O, preparing a PCR reaction system according to the following table 1 with the PCR amplification template prepared in the step 1.
TABLE 1
After the PCR reaction system is mixed evenly, amplification is carried out on a QuantStaudio Dx fluorescence PCR instrument of ABI company in America according to the following procedures:
read plate 1 time after each cycle.
3. The results of the fluorescence signals read were analyzed by QuantStaudio Test Development software of ABI, USA, to determine the genotypes of HPA-6w and HPA-21bw antigen systems.
FIG. 1 is a diagram showing the results of real-time fluorescence PCR of HPA-6w, the specimen being HPA-6waa genotype. In FIG. 1, FAM fluorescent probe is positive, while HEX probe is negative.
FIG. 2 is a diagram showing the results of real-time fluorescence PCR of HPA-6w, the specimen being HPA-6wab genotype. In FIG. 2, FAM fluorescent probe was positive, while HEX probe was positive. Compared with FIG. 1, the fluorescence value of FAM fluorescent probe is decreased, and the fluorescence value of HEX probe is increased.
FIG. 3 is a diagram showing the results of real-time fluorescence PCR of HPA-21w, the specimen being HPA-21waa genotype. In FIG. 3, FAM fluorescent probe was positive, while HEX probe was negative.
FIG. 4 is a diagram showing the results of real-time fluorescence PCR of HPA-21w, the specimen being HPA-21wab genotype. In FIG. 4, the FAM fluorescent probe was positive, while the HEX probe was positive. Compared with FIG. 1, the fluorescence value of FAM fluorescent probe is decreased, and the fluorescence value of HEX probe is increased.
The above-described embodiments are intended to illustrate the present invention, but not to limit the present invention, and any modifications, equivalents, improvements, etc. made within the spirit of the present invention and the scope of the claims fall within the scope of the present invention.
Sequence listing
<110> Zhejiang province blood center
<120> real-time fluorescence PCR method, probe, primer and kit for typing human platelet alloantigen system alleles
<160> 8
<170> SIPOSequenceListing 1.0
<210> 1
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
<210> 2
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
<210> 3
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
<210> 4
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
<210> 5
<211> 17
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 5
cagcccccgr gagggtc 17
<210> 6
<211> 18
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 6
cagcccccar gagggtca 18
<210> 7
<211> 18
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 7
acatgacgaa aatacctg 18
<210> 8
<211> 16
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 8
ctacatgaca aaaata 16
Claims (7)
1. A real-time fluorescence PCR method for typing human platelet alloantigen system alleles is characterized in that: the real-time fluorescence PCR method for typing the alleles of the human platelet alloantigen system carries out typing designation on the a and b alleles of the HPA-6w and HPA-21w antigen systems in the same amplification reaction system and the same amplification reaction program, and specifically comprises the following steps:
(1) preparing human genome DNA as a template for PCR amplification;
(2) synthesizing an amplification primer and a specific fluorescent probe and preparing a PCR amplification reaction system;
(3) acquiring a fluorescent signal by using a real-time fluorescent PCR device under the same amplification reaction system and the same amplification reaction program;
(4) analyzing the fluorescent signal result obtained in the step (3), and determining the genotype according to the strength of the fluorescent signal.
2. The real-time fluorescent PCR method for human platelet alloantigen system allele typing according to claim 1, wherein: the amplification primers in the step (2) are as follows:
(1) amplification primer of HPA-6w antigen system gene sequence
HPA-6F：5’TGTGAGTGCTCAGAGGAGGA 3’
HPA-6R：5’GTGGCAGACACATTGACCAC 3’
(2) Amplification primer of HPA-21w antigen system gene sequence
HPA-21F：5’GGAGATCAGAGCTGGACTGG 3’
HPA-21R：5’TAGAACCTGGGTGTGTGCAA 3’
The specific fluorescent probe in the step (2) is as follows:
(1) fluorescent probe of HPA-6w antigen system
HPA-6aP：5’FAM-CAGCCCCCGRGAGGGTC-3’MGB
HPA-6bP：5’HEX-CAGCCCCCARGAGGGTCA-3’MGB
(2) Fluorescent probe of HPA-21w antigen system
HPA-21aP：5’FAM-ACATGACGAAAATACCTG-3’MGB
HPA-21bP：5’HEX-CTACATGACAAAAATA-3’MGB。
3. The real-time fluorescent PCR method for human platelet alloantigen system allele typing according to claim 1, wherein: the real-time fluorescent PCR amplification reaction system in the step (3) comprises:
SGexcel GoldStar TaqMan mix 7.5. mu.l; the concentration of each primer is 50 mu mol/L, and the dosage of each primer is 0.06 mu L; the concentration of each probe is 50 mu mol/L, and the dosage of the probe is 0.06 mu L; 50-100 ng/. mu.l of genomic DNA 1.5. mu.l; the balance being H2Make up to 15. mu.l of O.
4. The real-time fluorescent PCR method for human platelet alloantigen system allele typing according to claim 1, wherein: the real-time fluorescent PCR amplification reaction program in the step (3) is as follows:
pre-denaturation at 95 ℃ for 3 min; 50 cycles of 95 ℃ for 20s and 60 ℃ for 30 s; the fluorescence signal was read every cycle.
5. The amplification primer composition for the real-time fluorescence PCR method for typing human platelet alloantigen system alleles is characterized by comprising the following steps of: the amplification primer composition comprises:
(1) amplification primer of HPA-6w antigen system gene sequence
HPA-6F：5’TGTGAGTGCTCAGAGGAGGA 3’
HPA-6R：5’GTGGCAGACACATTGACCAC 3’
(2) Amplification primer of HPA-21w antigen system gene sequence
HPA-21F：5’GGAGATCAGAGCTGGACTGG 3’
HPA-21R：5’TAGAACCTGGGTGTGTGCAA 3’。
6. The fluorescent probe composition for the real-time fluorescent PCR method of human platelet alloantigen system allele typing is characterized in that: the fluorescent probe composition comprises:
(1) fluorescent probe of HPA-6w antigen system
HPA-6aP：5’FAM-CAGCCCCCGRGAGGGTC-3’MGB
HPA-6bP：5’HEX-CAGCCCCCARGAGGGTCA-3’MGB
(2) Fluorescent probe of HPA-21w antigen system
HPA-21aP：5’FAM-ACATGACGAAAATACCTG-3’MGB
HPA-21bP：5’HEX-CTACATGACAAAAATA-3’MGB。
7. The kit for the real-time fluorescence PCR method for typing human platelet alloantigen system alleles is characterized in that: the kit for the real-time fluorescent PCR method for human platelet alloantigen system allele typing comprises the amplification primer composition for the real-time fluorescent PCR method for human platelet alloantigen system allele typing according to claim 5 and the fluorescent probe composition for the real-time fluorescent PCR method for human platelet alloantigen system allele typing according to claim 6.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110247485.4A CN113249493A (en) | 2021-03-05 | 2021-03-05 | Real-time fluorescence PCR method, probe, primer and kit for typing human platelet alloantigen system alleles |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110247485.4A CN113249493A (en) | 2021-03-05 | 2021-03-05 | Real-time fluorescence PCR method, probe, primer and kit for typing human platelet alloantigen system alleles |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN113249493A true CN113249493A (en) | 2021-08-13 |
Family
ID=77181029
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202110247485.4A Pending CN113249493A (en) | 2021-03-05 | 2021-03-05 | Real-time fluorescence PCR method, probe, primer and kit for typing human platelet alloantigen system alleles |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN113249493A (en) |
Citations (10)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1847408A (en) * | 2006-02-20 | 2006-10-18 | 张涌 | Thrombocyte glucoprotein HPA-1 and HPA-2 genotype detecting chip and its use |
| US20070041905A1 (en) * | 2005-08-19 | 2007-02-22 | Hoffman Rebecca S | Method of treating depression using a TNF-alpha antibody |
| US7781161B2 (en) * | 2002-03-07 | 2010-08-24 | The Johns Hopkins University School Of Medicine | Genomic screen for epigenetically silenced tumor suppressor genes |
| CN101845520A (en) * | 2010-05-11 | 2010-09-29 | 上海市血液中心 | HPA allelic gene typing detection reagent kit |
| CN101892314A (en) * | 2010-06-22 | 2010-11-24 | 天津市秀鹏生物技术开发有限公司 | Primer group and kit for detecting human platelet alloantigen gene |
| CN103261437A (en) * | 2010-12-20 | 2013-08-21 | 深圳华大基因科技有限公司 | Genotyping method for hpa and primers used |
| EP2380993B1 (en) * | 2004-03-08 | 2015-12-23 | Rubicon Genomics, Inc. | Method for generating and amplifying DNA libraries for sensitive detection and analysis of DNA methylation |
| CN105296601A (en) * | 2014-06-25 | 2016-02-03 | 浙江省血液中心 | PCR-SBT (PCR-sequence-based typing) method and reagent for human blood platelet alloantigen system genotyping |
| EP3600371A1 (en) * | 2017-03-21 | 2020-02-05 | The Regents of The University of Michigan | Erg targeted therapy |
| CN111455027A (en) * | 2020-04-10 | 2020-07-28 | 江苏省血液中心 | Mass spectrum detection method and kit for genotyping of platelet antigen |
-
2021
- 2021-03-05 CN CN202110247485.4A patent/CN113249493A/en active Pending
Patent Citations (10)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US7781161B2 (en) * | 2002-03-07 | 2010-08-24 | The Johns Hopkins University School Of Medicine | Genomic screen for epigenetically silenced tumor suppressor genes |
| EP2380993B1 (en) * | 2004-03-08 | 2015-12-23 | Rubicon Genomics, Inc. | Method for generating and amplifying DNA libraries for sensitive detection and analysis of DNA methylation |
| US20070041905A1 (en) * | 2005-08-19 | 2007-02-22 | Hoffman Rebecca S | Method of treating depression using a TNF-alpha antibody |
| CN1847408A (en) * | 2006-02-20 | 2006-10-18 | 张涌 | Thrombocyte glucoprotein HPA-1 and HPA-2 genotype detecting chip and its use |
| CN101845520A (en) * | 2010-05-11 | 2010-09-29 | 上海市血液中心 | HPA allelic gene typing detection reagent kit |
| CN101892314A (en) * | 2010-06-22 | 2010-11-24 | 天津市秀鹏生物技术开发有限公司 | Primer group and kit for detecting human platelet alloantigen gene |
| CN103261437A (en) * | 2010-12-20 | 2013-08-21 | 深圳华大基因科技有限公司 | Genotyping method for hpa and primers used |
| CN105296601A (en) * | 2014-06-25 | 2016-02-03 | 浙江省血液中心 | PCR-SBT (PCR-sequence-based typing) method and reagent for human blood platelet alloantigen system genotyping |
| EP3600371A1 (en) * | 2017-03-21 | 2020-02-05 | The Regents of The University of Michigan | Erg targeted therapy |
| CN111455027A (en) * | 2020-04-10 | 2020-07-28 | 江苏省血液中心 | Mass spectrum detection method and kit for genotyping of platelet antigen |
Non-Patent Citations (1)
| Title |
|---|
| 周豪杰 等: ""1例新生儿血小板减少症患儿发现HPA-21bw等位基因报告"", 《免疫学杂志》 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107385064B (en) | Fluorescence labeling composite amplification kit for simultaneously amplifying human autosomal SNP and STR loci and application thereof | |
| CN102337338B (en) | Method for simultaneously and quickly detecting number of five types of chromosomes, and kit and application thereof | |
| CN102912028B (en) | Amplification composite for detecting microdeletion of Y-chromosome and detection kit | |
| CN113502335B (en) | Molecular marker related to sheep growth traits and application thereof | |
| CN108913757B (en) | Primer group and detection kit for chromosome aneuploid number abnormality and application thereof | |
| CN111926116A (en) | Primer and probe for rapidly and quantitatively detecting duck adenovirus type 4, detection method and application thereof | |
| CN104745691A (en) | Primer group complexly amplified by fluorescent mark for synchronously analyzing 27 genetic locus of human genomic DNA, kit and application | |
| CN106939334B (en) | Method for detecting fetal DNA content in plasma of pregnant woman | |
| CN110541041B (en) | SNP marker related to Chinese domestic horse dwarf trait and application thereof | |
| CN111235261B (en) | Kit for detecting human platelet-specific antigen HPA 1-29 genotyping | |
| CN102534030B (en) | Kit for jointly detecting four deafness predisposing genes and application thereof | |
| CN113249493A (en) | Real-time fluorescence PCR method, probe, primer and kit for typing human platelet alloantigen system alleles | |
| CN110423826B (en) | C57BL/6 subline mouse KASP genetic detection kit and primer | |
| CN103103267A (en) | Kit for detecting genotype of human chromosome 21 STR (short tandem repeat) | |
| US11939630B2 (en) | Fluorescent PCR method for detecting HLA-B*15:02 allele and specific primer probe combination thereof | |
| CN111172248A (en) | General kit for verifying copy number variation based on fragment analysis technology | |
| NL2029449B1 (en) | Fluorescent pcr method for detecting hla-b*15:02 allele and specific primer probe combination thereof | |
| CN114457151B (en) | Detection kit for detecting phenylalanine hydroxylase gene mutation and detection method thereof | |
| CN113046430B (en) | Amplification composition for chromosome aneuploid number abnormality and application thereof | |
| CN103436625B (en) | 6 deaf sick susceptibility loci somatotype/mutant proportion detection kit | |
| CN103451301B (en) | Deaf sick tumor susceptibility gene SLC26A4 2168A > G, IVS7-2A > G mutation detection kit | |
| CN103451300B (en) | Deaf sick tumor susceptibility gene GJB2 235delC, 299delAT mutation detection kit | |
| CN116024349B (en) | Primer probe combination and kit for methylation detection of cervical cancer | |
| CN110863039B (en) | Primer group, method and kit for detecting SLCO1B1 and APOE gene polymorphism based on shared primer probe | |
| CN102605052B (en) | Fluorescence detection kit for detecting deafness susceptibility gene GJB2 235delC and application of fluorescence detection kit |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20210813 |