CN113234731A - GmARF16 gene for coding soybean ARF transcription factor and application thereof - Google Patents

Abstract

The invention discloses a GmARF16 gene for coding a soybean ARF transcription factor and application thereof, wherein the nucleotide sequence of the GmARF16 gene is shown as SEQ ID NO. 1. The gene can influence the growth and development of the nodule. In addition, the method utilizes a CRISPR/Cas vector, quickly obtains a chimera transgenic plant through agrobacterium-mediated soybean hairy root genetic transformation, successfully mutates the GmARF16 gene, analyzes the salt resistance of the chimera transgenic plant, and shows that the mutant GmARF16 gene can improve the salt resistance of soybean and inhibit the generation of root nodules of the soybean.

Description

GmARF16 gene for coding soybean ARF transcription factor and application thereof

Technical Field

The invention belongs to the technical field of biology, and particularly relates to a coding soybean ARF transcription factor GmARF16 and application thereof.

Background

Soil salinization is one of the most main factors influencing global agricultural production, Chinese land salinization approximately occupies 1/10 of global salinization area, and the land salinization shows a rising trend, and secondary salinization of China exceeds 6 multiplied by 10⁶hm²Accounting for 25% of the cultivated land area in China. Due to the fact thatTherefore, the research on the salt tolerance mechanism of plants and the improvement of the salt tolerance of crops become the focus of attention of many researchers. Salt stress can cause various damages to plants, such as ion imbalance, oxidative stress, osmotic stress and the like, and too high salt concentration can even cause plant death.

Auxins have little control over almost all aspects of plant growth and development and plant response to biotic, abiotic stresses and growth tendencies in the environment. Arfs (auxin stress factors) are transcription factors that are critical to auxin signal sensing and signaling pathways, and play an extremely important role in plant development, response to biotic, abiotic stress and growth tendency, and the like. It activates or inhibits the expression of a target gene by specifically binding to the auxin response element TGTCTC/TGTCCC/TGTCAC in the promoter region of the auxin response gene. ARF proteins comprise 3 domains: an N-terminal B3-type DNA Binding Domain (DBD), an intermediate MR domain-inhibiting domain (RD) or Activating Domain (AD), and a C-terminal dimerization domain (CTD).

Soybean (Glycine max (Linn.) Merr) originated in china 5000 years ago, is an important crop and feed crop, plays an important role in the crop structure of China, but in recent years, the soybean industry of China is slowly developed, the import ratio is high, and the contradiction between supply and demand is more prominent. Meanwhile, the saline-alkali soil area in China is wide, the saline-alkali soil area tends to be further increased due to climate change and unreasonable cultivation modes of human beings, and soil salinization has great influence on soybean morphogenesis and growth and development, so that the yield and quality of soybeans are directly influenced. Therefore, the salt stress related gene GmARF16 is cloned in the soybean, so that gene resources can be provided for the salt tolerance research of the soybean, and the contribution is made to the cultivation of new stress-resistant soybean varieties.

Disclosure of Invention

An object of the present invention is to provide a GmARF16 gene encoding a soybean ARF transcription factor.

The second purpose of the invention is to provide a protein coded by the gene.

The third purpose of the invention is to provide an expression vector capable of mutating the gene, namely a GmARF16 gene editing vector.

The fourth object of the present invention is to provide a host cell containing the expression vector.

The most important purpose of the invention is to provide the application of inhibiting the expression of the gene in improving the salt resistance of the soybean.

The technical scheme of the invention is summarized as follows:

a GmARF16 gene for coding a soybean ARF transcription factor is a nucleotide sequence shown in SEQ ID NO. 1. The nucleotide sequence consists of 2103 bases. The GmARF16 gene has the function of regulating the salt resistance of plants.

The protein coded by the gene is an amino acid sequence shown in SEQ ID NO. 2. The sequence consists of 700 amino acid residues (1).

The protein encoded by the GmARF16 gene may further include a protein derived from (1) which is formed by substituting, deleting or adding one or more (e.g., 1 to 30; preferably 1 to 20; more preferably 1 to 10; e.g., 5, 3) amino acid residues in the amino acid sequence of SEQ ID NO.2 and has (1) a protein function; or a protein derived from (1) having a homology of 80% (preferably 90% or more, e.g., 95%, 98%, 99% or more) or more with the protein sequence defined in (1) and having the protein function of (1).

That is, the functions of the gene protected by the present invention include not only the above-mentioned GmARF16 gene, but also homologous genes having high homology (e.g., homology higher than 40%, preferably higher than 50%, preferably higher than 60%, more preferably higher than 70%, more preferably higher than 80%, more preferably higher than 90%, more preferably higher than 95%, more preferably higher than 98%) with SEQ ID NO. 1.

Transgenic cell lines, recombinant bacteria, recombinant vectors, expression vectors and host cells containing the expression vectors containing the genes also fall into the protection scope of the invention.

The gene has the function of promoting the generation of soybean nodules, and compared with GmARF16 gene editing mutant plants, the number of the nodules is larger. It can be seen that soybean GmARF16 can influence the growth and development of the nodule.

The GmARF16 gene editing vector, gene editing genetic material, a host cell containing the vector and a construction method thereof also fall into the protection scope of the invention. The CRISPR/Cas vector pGEL201 XU 6-GmARF16 containing the gene can mutate the GmARF16 gene. Specifically, the method utilizes a CRISPR/Cas vector, and soybean hairy root genetic transformation mediated by agrobacterium tumefaciens is utilized to quickly obtain a chimeric transgenic plant, so that the GmARF16 gene is successfully mutated, namely, the functional expression of the gene is inhibited, the salt resistance of soybean can be improved, and the generation of soybean nodules can be inhibited.

In the present invention, there is no particular limitation on the plant suitable for use in the present invention, as long as it is suitable for carrying out a gene transformation operation, such as various crops, flowering plants, or forestry plants. The plant may be, for example (without limitation): dicotyledonous, monocotyledonous, or gymnosperm.

As an embodiment, the "plant" includes but is not limited to: the soybean is suitable for all genes with the gene or the genes homologous with the gene. The gene is particularly suitable for plants needing to improve the salt tolerance, and in the practical application process, the plants needing to improve the salt tolerance can be cultivated into strains of the gene in a transgenic way.

As used herein, "plant" includes whole plants, parent and progeny plants thereof, and various parts of the plant, including seeds, fruits, shoots, stems, leaves, roots (including tubers), flowers, tissues and organs, having the gene or nucleic acid of interest in each of these various parts. Reference herein to "plant" also includes plant cells, suspension cultures, callus tissue, embryos, meristematic regions, gametophytes, sporophytes, pollen and microspores, again wherein each of the foregoing comprises a gene/nucleic acid of interest.

The present invention includes any plant cell, or any plant obtained or obtainable by the methods therein, as well as all plant parts and propagules thereof. The present patent also encompasses transfected cells, tissues, organs or whole plants obtained by any of the foregoing methods. The only requirement is that the progeny exhibit the same genotypic or phenotypic characteristics and that the progeny obtained using the methods of this patent have the same characteristics.

The invention also extends to harvestable parts of a plant as described above, but not limited to seeds, leaves, fruits, flowers, stems, roots, rhizomes, tubers and bulbs. It also relates to other post-harvest derivatives of the plant, such as dry granules or powders, oils, fats and fatty acids, starches or proteins. The invention also relates to food products or food additives obtained from the relevant plants.

The invention has the advantages that:

the invention discloses a GmARF16 gene for coding a soybean ARF transcription factor for the first time, in the process of identifying the function of the GmARF16 gene, a chimera transgenic plant is quickly obtained by utilizing a CRISPR/Cas vector through agrobacterium-mediated soybean hairy root genetic transformation, the GmARF16 gene is successfully mutated, the chimera transgenic plant is subjected to salt resistance analysis, and the result shows that the mutated GmARF16 gene can improve the salt resistance of soybean and can inhibit the generation of soybean root nodules.

The function of the GmARF16 gene knocked out from soybean is verified by the inventor by using a gene editing technology, so that the function of the GmARF16 gene in plant development and plant salt tolerance is favorably clarified from a molecular mechanism, and a theoretical basis and a gene resource are provided for soybean molecular breeding.

For saline-alkali areas, salt-tolerant plants need to be cultivated to adapt to the growth of the areas, and new varieties can be cultivated by knocking out GmARF16 genes or homologous genes.

Drawings

FIG. 1 sequence structure analysis of GmARF 16;

FIG. 2 salt stress induced expression of GmARF 16;

FIG. 3 expression of GmARF16 in different tissues;

FIG. 4 identification of the salt tolerance of mutant plants under salt stress to controls (EV: no-load control; CR-GmARF 16: GmARF16 mutant plants);

FIG. 5 relative root elongation of mutant plants versus control under salt treatment (EV: no-load control; CR-GmARF 16: GmARF16 mutant plants);

FIG. 6 identification of the mutant plant target site gene editing (bimodal is considered to be the presence of gene editing);

FIG. 7 mutant plants and control nodule growth phenotype (EV: empty control; CR-GmARF 16: GmARF16 mutant plants).

Detailed Description

The present invention will be described in detail below with reference to specific examples. These embodiments are provided so that this disclosure will be thorough and complete, and will fully convey the scope of the invention to those skilled in the art.

Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art. The test methods in the following examples are conventional methods unless otherwise specified. Unless otherwise indicated, all reagents and materials used are commercially available.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. In addition, any methods and materials similar or equivalent to those described herein can be used in the practice of the present invention. The preferred embodiments and materials described herein are intended to be exemplary only.

The practice of the present invention will employ, unless otherwise indicated, conventional techniques of botany, microorganisms, tissue culture, molecular biology, chemistry, biochemistry, DNA recombination, and bioinformatics, which will be apparent to those skilled in the art. These techniques are explained fully in the published literature, and the methods of DNA extraction, phylogenetic tree construction, gene editing method, gene editing vector construction, gene editing plant acquisition, and the like used in the present invention can be realized by methods already disclosed in the prior art, in addition to the methods used in the following examples.

The terms "nucleic acid", "nucleic acid sequence", "nucleotide", "nucleic acid molecule" or "polynucleotide" as used herein are meant to include isolated DNA molecules (e.g., cDNA or genomic DNA), RNA molecules (e.g., messenger RNA), natural types, mutant types, synthetic DNA or RNA molecules, DNA or RNA molecules composed of nucleotide analogs, either single-stranded or double-stranded structures. These nucleic acids or polynucleotides include, but are not limited to, gene coding sequences, antisense sequences, and regulatory sequences for non-coding regions. These terms include a gene. "Gene" or "gene sequence" is used broadly to refer to a functional DNA nucleic acid sequence. Thus, a gene may include introns and exons as in genomic sequences, and/or include coding sequences as in cDNA, and/or include cDNA and its regulatory sequences. In particular embodiments, e.g., with respect to an isolated nucleic acid sequence, it is preferred to default to cDNA.

In addition, in order to more intuitively understand the technical scheme of the invention, some technical terms related to the invention are explained as follows:

"Gene editing, is an emerging Gene function technology that precisely modifies specific target sequences in the genome of an organism.

"Gene knockout", Gene knock out, is a technique for site-directed integration of an exogenous Gene into a certain site on the genome of a target cell by homologous recombination to achieve the purpose of site-directed modification of a certain Gene on a chromosome.

"Mutant, refers to an individual that has undergone a mutation and is characterized by a phenotype that is different from the wild type.

"Expression vectors" refer to vectors in which Expression elements (such as promoter, RBS, terminator, etc.) are added on the basis of the basic skeleton of the cloning vector to enable the Expression of the target gene.

An Agrobacterium-mediated transformation method, Agrobacterium-mediated transformation, refers to a technique of inserting a target gene into a modified T-DNA region, transferring and integrating an exogenous gene into a plant cell by virtue of Agrobacterium infection, and then regenerating a transgenic plant by cell and tissue culture techniques.

Examples

The inventor of the invention utilizes bioinformatics technology to obtain the GmARF16 gene sequence on the basis of soybean genome. The coding frame sequence of the GmARF16 gene is cloned by molecular cloning. In addition, the GmARF16 gene is edited in soybean by using a CRISPR/Cas9 gene editing system to obtain a function deletion mutant, and a gene editing plant is subjected to function verification.

Compared with the traditional transgenic technology, the CRISPR/Cas9 gene editing technology has many advantages. The traditional transgenic technology is characterized in that an exogenous target gene is introduced into a target organism, so that the plant traits are changed, the insertion position of the target gene in a receptor genome is random, and the CRISPR/Cas9 gene editing technology is not introduced with the exogenous gene and only modifies the endogenous gene, so that the technology is safer and more efficient; secondly, the CRISPR/Cas9 gene editing technology can realize simultaneous editing of multiple sites and can realize accurate regulation and control of mutation or insertion sites, which cannot be realized by the traditional transgenic technology; in addition, the traditional transgenic technology can only down-regulate the expression of a target gene at the RNA level, can not completely inhibit the transcription of the target gene, and is unstable in heredity, and the CRISPR/Cas9 gene editing technology can realize the mutation of the target gene and is more stable and reliable.

First, obtaining GmARF16 gene of coding soybean ARF transcription factor

A GmARF16 gene (figure 1) for coding a soybean ARF transcription factor is obtained by screening through various technical means such as transcriptome, genome and proteomics, the full-length coding frame nucleotide sequence of the gene is 2103bp and consists of 700 amino acids, and the nucleotide sequence is obtained through sequencing and is shown as a sequence SEQ ID NO.1, and the protein sequence is shown as a sequence SEQ ID NO. 2.

Second, response of GmARF16 gene to salt stress and expression determination at different positions

Treating with 0.9% NaCl +1/2Hoagland solution in the first heart stage of two leaves, taking leaves at different time periods, quick freezing with liquid nitrogen, and storing in a refrigerator at-80 deg.C. RNA was extracted and inverted to cDNA using the Trizol method. A fluorescent quantitative kit from TAKARA was used. The reaction was carried out on a quantitative PCR instrument (Applied Biosystems Stepone Plus), the expression level of the gene was detected according to a relative quantitative method, the reaction program was carried out according to the instruction manual provided by TAKARA, the soybean Actin gene was used as an internal reference in the reaction, and the primer sequence was:

Actin-F：CGGTGGTTCTATCTTGGCATC

Actin-R：GTCTTTCGCTTCAATAACCCTA

GmARF16-F：GTTATTTTTCTTGTGTGTGCGC

GmARF16-R：CTTACAGAGCAAAGCATAGCAG

taking different parts of the leaves, quickly freezing the leaves with liquid nitrogen, and storing the leaves in a refrigerator at the temperature of minus 80 ℃. RNA was extracted and inverted to cDNA using the Trizol method. A fluorescent quantitative kit from TAKARA was used. The reaction was carried out on a quantitative PCR instrument (Applied Biosystems Stepone Plus), the expression level of the gene was detected by a relative quantitative method, the reaction program was carried out according to the manual provided by TAKARA, the soybean Actin gene was used as an internal reference in the reaction, and the primer sequence was as described above.

The results showed that the GmARF16 gene was induced by salt stress and the expression level in roots was higher than other parts (FIG. 2, FIG. 3).

Thirdly, functional identification of soybean ARF transcription factor GmARF16 gene

In order to study the role of the GmARF16 gene in salt resistance of soybean, the function of the GmARF16 gene is identified by constructing a gene editing transgenic plant.

3.1 construction of Gene editing vectors

A CRISPR/Cas9 gene editing system is used, a knockout target of a GmARF16 gene is predicted through an online website (http:// skl.scau.edu.cn/targettdisign /), SgRNA is designed on CDS close to a starting coding region, and a pGEL201 XU 6-GmARF16 gene knockout vector is constructed according to the instruction.

(1) The target site is found by using CRISPR-GE online software, and the synthetic oligonucleotide is designed, wherein the primer sequence is as follows:

and (3) primer F: ggattgCAGGAATTTGCAGTGAGAAC

And (3) primer R: aaacGTTCTCACTGCAAATTCCTGca

(2) Annealing oligonucleotides to double strands

The reaction was carried out at 94 ℃ for 50s and cooled at room temperature.

(3) Connection carrier

The reaction conditions were as follows: 5min at 37 ℃; 5min at 20 ℃; coli DH 5. alpha. was transformed for 8 cycles. It was spread on LB plates containing 100mg/ml kanamycin resistance. Culturing at 37 ℃, picking single colonies after 12h for colony PCR verification, sequencing positive colonies, and using M13 universal primers as sequencing primers.

3.2 genetic transformation of Soybean hairy root

(1) Planting 50 soybean Dongnong in mixed soil, germinating in a greenhouse, and picking out agrobacterium with an injector to infect cotyledon nodes when the cotyledon is not completely unfolded in 6 days;

(2) covering with transparent cover after injection, keeping the interior moist, burying the infection site and the part below the infection site with vermiculite, and watering. Culturing at 28 deg.C for 14 hr/10 hr in dark for 3-4 weeks, pouring water every two days, and maintaining the wet environment of the impregnated part.

(3) When hairy roots grow to 5-10cm, the main roots were subtracted, the complex plants were placed in clear water, recovered for 3-4 days, then treated with 120mM NaCl for six days, and the root length was measured before and after salt treatment, respectively.

3.3 Positive identification of Gene-edited transgenic Material

Taking a single root, extracting genome DNA, designing a specific PCR primer (F: CTGTTGCAATCACTTACTTGT, R: CCTTCACACAAAACTCTGGG) near the SgRNA target site, amplifying a sequence near the mutation site, sequencing, and judging that gene editing exists when a sequencing peak image has double peaks at the mutation site (figure 6).

3.4 phenotypic analysis of Soybean GmARF16 Gene editing mutants

In clear water, after 6 days of culture, the relative elongation of roots of the mutant is not significantly different from that of a control, leaves are kept green (figure 4), while the relative elongation of roots of the mutant plant is higher than that of the control after 6 days of salt treatment, most of the leaves of the mutant plant are kept green, and the leaves of the control plant are yellow, withered and even inactivated, so that the mutant GmARF16 gene can improve the tolerance of soybeans to salt stress under the condition of salt stress (figure 4 and figure 5).

Meanwhile, the mutant GmARF16 gene in the soybean hairy root can inhibit the generation of the root nodules, and in an unloaded control, each hairy root grows about 15 root nodules on average, while only about 8 root nodules are generated in each mutant hairy root, which shows that the soybean GmARF16 can influence the growth and development of the root nodules, and the generation of the root nodules is obviously reduced after the gene is mutated (figure 7).

Sequence listing

<110> Shandong university of agriculture

<120> GmARF16 gene for coding soybean ARF transcription factor and application thereof

<130> 2021

<160> 2

<170> SIPOSequenceListing 1.0

<210> 1

<211> 2103

<212> DNA

<213> Glycine max（Linn.）Merr

<400> 1

atgctatttc aggaatttgc agtgagaaca ggttactgta tgatggagtc aaaggagaaa 60

ttgaaagagg tggagaagtg tttggattct cggctatggc atgcgtgtgc gggagggatg 120

gttcaaatgc cagtggtgaa tgctaaggtg ttctactttc ctcagggtca tgctgaacat 180

gcatgtggac ccgtggactt cagggtttat cccaaaattc cacctttcat tcaatgcaaa 240

gttggagcta tcaaatacat ggctgatcct gaaactgatg aggtttatgt aaagcttagg 300

cttgttcctt tgaccagaaa cgagggtgat tttgaggatg atgctgttgg aggcatcaat 360

ggatctgaaa ataaagataa atccccttct tttgccaaaa ccttgacaca gtctgatgcc 420

aacaatggtg ggggcttttc tgttcccaga tattgtgctg agacaatttt tcctcggttg 480

gactattccg cggaccctcc cgttcagaac atccttgcca aggatgttca tggtgagaca 540

tggaaattta ggcacattta taggggcacg ccgcgccggc acttgttaac taccgggtgg 600

agtagctttg tgaatcacaa gaagcttgtg gcgggggatt caattgtgtt tttgagggca 660

gaaaaggatg atctgcgtgt tggaattcgg cgggctaaga gggggattgg aattggtgga 720

ggacctgagg ctcctgcagg gtggaattca ggtgggggga ttcgtcctat gccttatgga 780

gggttttcag cttttttgag agaggaagat agccagctct tgagaaatgg gttgagtcca 840

aatgcaaagg ggaaagtgag gcctgaagca gttattgagg ctgcaactct tgctgccaat 900

atgcagccat ttgaggttgt ttactatccc cgggcaagtg ccccagagtt ttgtgtgaag 960

gccaatttag ttagagccgc attgcaggtt aggtggtgtc ctggaatgag gttcaagatg 1020

ccctttgaaa cagaggactc ctcgcggata agctggttta tgggaaccat ctcttctgtt 1080

aactttgctg atccaagatg gcccaactct ccttggagac ttctccaggt tacatgggat 1140

gaaccagagt tacttcaaaa tgtaaaaagg gtgagcccgt ggctggttga aattgtatca 1200

aacatgccta ccattcatct ttcccattac tcaacacaac aaaagaagcc aagattccct 1260

caacacccgg atttttcttt tgatggtcag atttcattgc cagcatttcc cagcaacttt 1320

ctaggtccaa gcaatccgtt tggttgtcta gctgaaagta ctcctgctgg catacaggga 1380

gccaggcatg ctaattatgg tatatcccta tcaaatctcc acttcaataa actgcagtca 1440

ggcctatttc aagctggttt ccctccactt gatcacactg cttccccagt attgagagtc 1500

tcctccaaca atgcagcaac aatgcaaaag gtcggcacgg gtgacaacgt ctcttgctta 1560

ctgtccatgt caactgctac tcaaccttca aagaaagtgg atgatgtgaa ggcaccccaa 1620

ttggtgcttt ttggccaaac aattctcacc gaacagcaaa tttctttgaa cacctctgct 1680

aagacagatc ctactcgaaa taattcattt gatggaaatg ctgataaaat gtgcaagttt 1740

tcagatggtt ttggttatgc tcttcaccca caaggctctt ctcttgagag gttacagtgg 1800

tacaaggatc aacaaaaaga aaccatggct agtttggaga caggtcactg taaagttttt 1860

atggaatctg aagacattgg tcggactatg gatctcacaa tgcttggatc ttatgatgaa 1920

ttgtatagaa agctggcaga catgtttggc atagaaaaat ctgtggtgct aagtcacatg 1980

ctttaccgtg atacaactgg ggcagtcaag cacattggag atgaagcatt cagcgaattt 2040

accaaaactg caaggaggtt gaccattcta atggattcca acagcgatgg tagaggaatc 2100

tag 2103

<210> 2

<211> 700

<212> PRT

<213> Glycine max（Linn.）Merr

<400> 2

Met Leu Phe Gln Glu Phe Ala Val Arg Thr Gly Tyr Cys Met Met Glu

1 5 10 15

Ser Lys Glu Lys Leu Lys Glu Val Glu Lys Cys Leu Asp Ser Arg Leu

20 25 30

Trp His Ala Cys Ala Gly Gly Met Val Gln Met Pro Val Val Asn Ala

35 40 45

Lys Val Phe Tyr Phe Pro Gln Gly His Ala Glu His Ala Cys Gly Pro

50 55 60

Val Asp Phe Arg Val Tyr Pro Lys Ile Pro Pro Phe Ile Gln Cys Lys

65 70 75 80

Val Gly Ala Ile Lys Tyr Met Ala Asp Pro Glu Thr Asp Glu Val Tyr

85 90 95

Val Lys Leu Arg Leu Val Pro Leu Thr Arg Asn Glu Gly Asp Phe Glu

100 105 110

Asp Asp Ala Val Gly Gly Ile Asn Gly Ser Glu Asn Lys Asp Lys Ser

115 120 125

Pro Ser Phe Ala Lys Thr Leu Thr Gln Ser Asp Ala Asn Asn Gly Gly

130 135 140

Gly Phe Ser Val Pro Arg Tyr Cys Ala Glu Thr Ile Phe Pro Arg Leu

145 150 155 160

Asp Tyr Ser Ala Asp Pro Pro Val Gln Asn Ile Leu Ala Lys Asp Val

165 170 175

His Gly Glu Thr Trp Lys Phe Arg His Ile Tyr Arg Gly Thr Pro Arg

180 185 190

Arg His Leu Leu Thr Thr Gly Trp Ser Ser Phe Val Asn His Lys Lys

195 200 205

Leu Val Ala Gly Asp Ser Ile Val Phe Leu Arg Ala Glu Lys Asp Asp

210 215 220

Leu Arg Val Gly Ile Arg Arg Ala Lys Arg Gly Ile Gly Ile Gly Gly

225 230 235 240

Gly Pro Glu Ala Pro Ala Gly Trp Asn Ser Gly Gly Gly Ile Arg Pro

245 250 255

Met Pro Tyr Gly Gly Phe Ser Ala Phe Leu Arg Glu Glu Asp Ser Gln

260 265 270

Leu Leu Arg Asn Gly Leu Ser Pro Asn Ala Lys Gly Lys Val Arg Pro

275 280 285

Glu Ala Val Ile Glu Ala Ala Thr Leu Ala Ala Asn Met Gln Pro Phe

290 295 300

Glu Val Val Tyr Tyr Pro Arg Ala Ser Ala Pro Glu Phe Cys Val Lys

305 310 315 320

Ala Asn Leu Val Arg Ala Ala Leu Gln Val Arg Trp Cys Pro Gly Met

325 330 335

Arg Phe Lys Met Pro Phe Glu Thr Glu Asp Ser Ser Arg Ile Ser Trp

340 345 350

Phe Met Gly Thr Ile Ser Ser Val Asn Phe Ala Asp Pro Arg Trp Pro

355 360 365

Asn Ser Pro Trp Arg Leu Leu Gln Val Thr Trp Asp Glu Pro Glu Leu

370 375 380

Leu Gln Asn Val Lys Arg Val Ser Pro Trp Leu Val Glu Ile Val Ser

385 390 395 400

Asn Met Pro Thr Ile His Leu Ser His Tyr Ser Thr Gln Gln Lys Lys

405 410 415

Pro Arg Phe Pro Gln His Pro Asp Phe Ser Phe Asp Gly Gln Ile Ser

420 425 430

Leu Pro Ala Phe Pro Ser Asn Phe Leu Gly Pro Ser Asn Pro Phe Gly

435 440 445

Cys Leu Ala Glu Ser Thr Pro Ala Gly Ile Gln Gly Ala Arg His Ala

450 455 460

Asn Tyr Gly Ile Ser Leu Ser Asn Leu His Phe Asn Lys Leu Gln Ser

465 470 475 480

Gly Leu Phe Gln Ala Gly Phe Pro Pro Leu Asp His Thr Ala Ser Pro

485 490 495

Val Leu Arg Val Ser Ser Asn Asn Ala Ala Thr Met Gln Lys Val Gly

500 505 510

Thr Gly Asp Asn Val Ser Cys Leu Leu Ser Met Ser Thr Ala Thr Gln

515 520 525

Pro Ser Lys Lys Val Asp Asp Val Lys Ala Pro Gln Leu Val Leu Phe

530 535 540

Gly Gln Thr Ile Leu Thr Glu Gln Gln Ile Ser Leu Asn Thr Ser Ala

545 550 555 560

Lys Thr Asp Pro Thr Arg Asn Asn Ser Phe Asp Gly Asn Ala Asp Lys

565 570 575

Met Cys Lys Phe Ser Asp Gly Phe Gly Tyr Ala Leu His Pro Gln Gly

580 585 590

Ser Ser Leu Glu Arg Leu Gln Trp Tyr Lys Asp Gln Gln Lys Glu Thr

595 600 605

Met Ala Ser Leu Glu Thr Gly His Cys Lys Val Phe Met Glu Ser Glu

610 615 620

Asp Ile Gly Arg Thr Met Asp Leu Thr Met Leu Gly Ser Tyr Asp Glu

625 630 635 640

Leu Tyr Arg Lys Leu Ala Asp Met Phe Gly Ile Glu Lys Ser Val Val

645 650 655

Leu Ser His Met Leu Tyr Arg Asp Thr Thr Gly Ala Val Lys His Ile

660 665 670

Gly Asp Glu Ala Phe Ser Glu Phe Thr Lys Thr Ala Arg Arg Leu Thr

675 680 685

Ile Leu Met Asp Ser Asn Ser Asp Gly Arg Gly Ile

690 695 700

Claims (7)

1. The GmARF16 gene for coding the soybean ARF transcription factor is characterized in that the nucleotide sequence of the GmARF16 gene is shown as SEQ ID NO. 1.

2. The protein encoded by the GmARF16 gene of claim 1, wherein the amino acid sequence of the protein is shown as SEQ ID No. 2.

3. Use of the gene of claim 1 or the protein of claim 2 to promote the production of root nodules in soybean.

4. A transgenic cell line, a recombinant bacterium, a recombinant vector, an expression vector and a host cell containing the expression vector, which contain the gene of claim 1.

5. The GmARF16 gene editing vector of claim 1.

6. Use of inhibiting the functional expression of the gene of claim 1 or the protein of claim 2 to increase salt resistance in soybean.

7. The use according to claim 6, wherein the salt-tolerant soybean plant is obtained by knocking out GmARF16 gene.

Images