CN113215225B

CN113215225B - Real-time fluorescent quantitative PCR instrument calibration kit

Info

Publication number: CN113215225B
Application number: CN202110523217.0A
Authority: CN
Inventors: 胡腾杰; 何玉红; 周秋梅
Original assignee: Hangzhou Miyin Biotechnology Co ltd
Current assignee: Hangzhou Miyin Biotechnology Co ltd
Priority date: 2021-05-13
Filing date: 2021-05-13
Publication date: 2023-05-05
Anticipated expiration: 2041-05-13
Also published as: CN113215225A

Abstract

The invention discloses a real-time fluorescence quantitative PCR instrument calibration kit, which comprises PCR premix, PCR enzyme, a standard substance and a primer dry plate, wherein the standard substance is a mixture of two or four kinds of cDNA (complementary deoxyribonucleic acid) in cDNA G1, cDNA G2, cDNA G3 and cDNA G4; the target detected by the kit is miRNA, and the target miRNA comprises at least one high GC-ratio miRNA and at least one low GC-ratio miRNA. The invention can comprehensively and accurately evaluate the real performance of the equipment, observe the marginal effect condition of the equipment, and effectively avoid the marginal range of obvious influence according to the calibration condition of the kit when a researcher needs to conduct accurate research.

Description

Real-time fluorescent quantitative PCR instrument calibration kit

Technical Field

The invention relates to the technical field of genetic engineering, in particular to a real-time fluorescent quantitative PCR instrument calibration kit.

Background

Along with the advancement of research in the gene field, the gene detection technology is rapidly developed, and the application of the real-time fluorescence quantitative PCR instrument is also becoming wider and wider. The real-time fluorescence quantitative PCR detection technology is to add fluorescent genes into a PCR reaction system, monitor the whole PCR process in real time by utilizing fluorescent signal accumulation, and has the problems of very many integrated elements, complex system, large volume and difficult equipment calibration. To maintain the accuracy of its detection, the device needs to be calibrated on time every year. At present, the calibration of the real-time fluorescent quantitative PCR is generally carried out by a manufacturer or a professional third party, and the manufacturer or the professional third party does not have wanted equipment and calibration capability, so the calibration cost is high, the calibration mode is rough, the actual conditions of the equipment cannot be accurately reflected, such as the edge effect of the equipment, but the non-calibration mode can show how large the edge effect is, and the reaction in the range is relatively stable, so the provision of a low-cost simple and accurate calibration mode is very important.

At present, there are two main ways to calibrate a fluorescent quantitative PCR instrument: one is to calibrate the temperature field part of the fluorescent quantitative PCR instrument, and the method can not calibrate the optical part of the fluorescent quantitative PCR instrument and can not comprehensively evaluate the performance of equipment; the other is to use chemical reagents to detect the device, typically using biological reagent test trays or using plasmid DNA of known concentration, which is relatively extensive and not very accurate in reacting the device performance, and not showing the edge effect of the device, and small differences in temperature difference between wells may be amplified exponentially during gene amplification, and may affect experimental results for finer experiments.

Disclosure of Invention

The invention aims to solve the problem of accurate calibration of a real-time fluorescent quantitative PCR instrument, and provides a real-time fluorescent quantitative PCR instrument calibration kit which can comprehensively and accurately evaluate the real performance of equipment, observe the marginal effect condition of the equipment, and effectively avoid the marginal range of obvious influence according to the calibration condition of the kit when a researcher needs to conduct accurate research.

The technical scheme adopted for solving the technical problems is as follows:

a real-time fluorescence quantitative PCR instrument calibration kit comprises PCR premix, PCR enzyme, a standard substance and a primer dry plate, wherein the standard substance is a mixture of two or four kinds of cDNA (complementary deoxyribonucleic acid) of cDNA G1, cDNA G2, cDNA G3 and cDNA G4, the sequence of the cDNA G1 is shown as SEQ ID No.1, the sequence of the cDNA G2 is shown as SEQ ID No.2, the sequence of the cDNA G3 is shown as SEQ ID No.3, and the sequence of the cDNA G4 is shown as SEQ ID No. 4; the target detected by the kit is miRNA, and the target miRNA comprises at least one high GC-ratio miRNA and at least one low GC-ratio miRNA.

The target miRNA comprises miRNA G1, miRNA G2, miRNA G3 and miRNA G4, wherein the GC ratio of the miRNA G1 and the miRNA G4 is 20% -40% (low GC ratio), and the GC ratio of the miRNA G2 and the miRNA G3 is 60% -80% (high GC ratio).

The sequence of miRNA G1 is shown in SEQ ID No.5, the sequence of miRNA G2 is shown in SEQ ID No.6, the sequence of miRNA G3 is shown in SEQ ID No.7, and the sequence of miRNA G4 is shown in SEQ ID No. 8.

cDNA G1 is obtained by reverse transcription with miRNA G1 as a template or is directly synthesized according to the sequence; cDNA G2 is obtained by reverse transcription by taking miRNA G2 as a template or is directly synthesized according to the sequence; cDNA G3 is obtained by reverse transcription with miRNA G3 as a template or is directly synthesized according to the sequence; cDNA G4 is obtained by reverse transcription using miRNA G4 as a template or is directly synthesized according to the sequence.

The PCR enzyme is DNA polymerase with the concentration of 2U/ul-10U/ul.

The primer dry plate is 384-well plate or 96-well plate, and the primer dry plate contains positive and negative primer dry powder for detecting target miRNA.

Primers for detecting a target miRNA include primers for detecting miRNA G1:

forward primer: 5'-GGCATAGGTTATGGCTTTTCA-3' the number of the individual pieces of the plastic,

reverse primer: 5'-ACCGCTGGTCACATAGGAATG-3'.

Primers for detecting a target miRNA include primers for detecting miRNA G2:

forward primer: 5'-TCATCACTTGAGCGCCT-3' the number of the individual pieces of the plastic,

reverse primer: 5'-CTGTCACCTCGGCTCTGTC-3'.

Primers for detecting a target miRNA include primers for detecting miRNA G3:

forward primer: 5'-ACCGCACAAAGCCTGCCC-3' the number of the individual pieces of the plastic,

reverse primer: 5'-GCCTGGACCCGAGGAGC-3'.

Primers for detecting a target miRNA include primers for detecting miRNA G4:

forward primer: 5'-ATCCACCCTCCGTCAAGAGCAA-3' the number of the individual pieces of the plastic,

reverse primer: 5'-CAGGCGCGTCACATTTTTCGTT-3'.

The beneficial effects of the invention are as follows:

1. the method is simple to operate, and the corresponding target index primer is freeze-dried or dried on the reaction plate in advance, and when the method is used, the mixed solution is simply prepared and then directly added into the reaction plate.

2. The GC ratio of the detection targets is different, and the detection targets can reflect the conditions when different genes are tested.

3. The reaction is sensitive, the detected target is miRNA, the edge effect of the equipment can be reflected on the experimental result, and the obvious difference area can be avoided when a fine experiment is carried out.

4. And the calibration is carried out once, the performances of the equipment in different aspects can be reflected by different analysis modes of the data, and the equipment can be comprehensively evaluated.

5. The sequence is short, the expenditure of a synthetic target and a primer can be reduced, and the cost is low.

Drawings

FIG. 1 is a 384 well plate primer profile.

FIG. 2 is a 96-well plate primer profile.

Fig. 3 is a marginal effect heat map.

Detailed Description

The technical scheme of the invention is further specifically described by the following specific examples.

In the present invention, the materials and equipment used are commercially available or commonly used in the art, unless otherwise specified. The methods in the following examples are conventional in the art unless otherwise specified.

Examples:

the kit comprises the following components:

sequence number	Component (A)	Specification of specification	Quantity of
				1	PCR premix	3749 ul/tube	2 pipe
2	PCR enzyme	120 ul/tube	1 pipe
				3	Standard substance	280 ul/tube	2 pipe
4	Primer dry plate	1 plate/bag	2 bags

The PCR enzyme is DNA polymerase with the concentration of 2U/ul-10U/ul.

Wherein the standard substance is cDNA mixed solution of 2 or 4 miRNAs after reverse transcription, and cDNA can be directly synthesized according to sequence;

wherein the GC content of the target miRNA is different, and the GC ratio of G1/G4 is 20-40%The GC ratio of G2/G3 is 60% -80%; the concentration is 10 ² copies/ul-10 ⁶ copies/ul。

The primer dry plate is 384-well plate or 96-well plate, and the plate contains positive and negative primer dry powder for detecting target, and the process is stoving or freeze drying.

Specific example 1:384 real-time fluorescent quantitative PCR instrument calibration kit production

The production steps are as follows:

1. PCR enzyme production: the brands of DNA polymerase selected in this example were: an LGC; cargo name: klear Taq-5000U;

2. diluting DNA polymerase according to the concentration of 5U/ul, sub-packaging according to 120 ul/tube, and labeling after sub-packaging;

3. and (3) producing a PCR premix: the PCR Buffer brands selected in this example are: miRXES; cargo name: PCR Buffer Premix (10X). Diluting 10×premix with enzyme-free and nucleic acid-free water to 2×concentration, mixing, packaging with 3749 ul/tube, and labeling;

4. and (3) standard product production: in this example, the cDNA of G1/G2/G3/G4 was synthesized directly, and mixed in equal proportions after being prepared into an equal concentration solution according to the concentration report provided by the manufacturer, and diluted to 6X 10 ⁴ Packaging the cobies/ul according to 280 ul/tube, and labeling after packaging;

wherein the cDNA sequence is shown in Table 1:

table 1: cDNA sequence listing

5. And (3) producing a primer dry plate: preparing the synthesized positive and negative primers of G1 to G4 into equal concentration solutions according to concentration reports provided by manufacturers, respectively mixing the equal concentration solutions according to equal proportion according to different genes after the preparation, diluting to 0.75uM concentration, adding the primers into 384-well plates according to the sequence of FIG. 1 by using a pipetting workstation after mixing, transferring 4ul of each well into an oven, drying at 55 ℃ for 80min, sealing by using a sealing plate film after drying, and sealing by using an aluminum foil bag and then labeling.

Wherein the primer sequences are shown in Table 2:

table 2: primer sequence listing

6. And (3) assembling: and (3) placing the PCR enzyme, the PCR premix, the standard substance and the primer dry plate into the same kit and sealing.

Wherein the miRNA selected by G1/G2/G3/G4 is shown in the table 3, the GC ratio of G1/G4 is low, and the GC ratio of G2/G3 is high;

table 3: miRNA gene sequence

Sequence number	Gene name	Gene sequence	GC％
				G1	hsa-miR-135b-5p	UAUGGCUUUUCAUUCCUAUGUGA(SEQ ID No.5)	35％
G2	hsa-miR-339-3p	UGAGCGCCUCGACGACAGAGCCG(SEQ ID No.6)	70％
				G3	hsa-miR-596	AAGCCUGCCCGGCUCCUCGGG(SEQ ID No.7)	76％
G4	hsa-miR-335-5p	UCAAGAGCAAUAACGAAAAAUGU(SEQ ID No.8)	30％

Specific example 2:96 real-time fluorescent quantitative PCR instrument calibration kit production

The production steps are as follows:

1. PCR enzyme production: the brands of DNA polymerase selected in this example were: phenanthroic Peng; cargo name: anstart Taq DNA Polymerase;

2. diluting DNA polymerase according to the concentration of 5U/ul, sub-packaging according to 80 ul/tube, and labeling after sub-packaging;

3. and (3) producing a PCR premix: the PCR Buffer brands selected in this example are: miRXES; cargo name: PCR Buffer Premix (10X). Diluting 10×premix with enzyme-free and nucleic acid-free water to 2×concentration, mixing, packaging with 1875 ul/tube, and labeling;

4. and (3) standard product production: in this example, the cDNA of G1/G2 was synthesized directly, and mixed in equal proportions after being prepared into an equal concentration solution according to the concentration report provided by the manufacturer, and diluted to 6.multidot.10 ⁴ Packaging the cobies/ul with 280 ul/tube, and labeling after packaging, wherein the cDNA sequence is shown in Table 1;

5. and (3) producing a primer dry plate: preparing the synthesized positive and negative primers of G1 to G2 into an equal concentration solution according to a concentration report provided by a manufacturer, respectively mixing the equal concentration solution according to equal proportion according to different genes after the preparation, diluting to 1.5uM concentration, adding the primers into a 96-well plate according to the sequence of a liquid transferring work station after mixing according to the sequence of FIG. 2, transferring 4ul of each hole into a refrigerator, freezing, performing freeze-drying treatment, sealing by using a sealing plate film after freeze-drying, and sealing by using an aluminum foil bag and labeling; wherein the corresponding primer sequences are shown in Table 2;

384 real-time fluorescent quantitative PCR instrument calibration kit

Calibration equipment: ABI-384 real-time fluorescence quantitative PCR instrument Quantum studio ^TM 5

Preparing a premix: taking out 1 tube of PCR premix from the kit, adding 3800ul nuclease-free water (self-contained), adding 51ul PCR enzyme, mixing uniformly, taking 7395ul premix, adding into a new 15ml centrifuge tube, adding 255ul standard substance into the centrifuge tube, mixing uniformly, and placing on ice for standby; a 96-well deep well plate was prepared and the premix was transferred to a series of deep well plates, 900ul each.

Rotating plate: and taking out one primer plate from the kit, transferring the prepared premix into the primer plate by using a gun, 15ul each hole, pasting a film by using a PCR film after transferring, and centrifuging.

And (3) detecting: the 384 plates were placed in a PCR apparatus, programmed, and subjected to PCR.

Setting reaction conditions of a PCR instrument: automatically setting the baseline, manually setting the threshold line to 0.4, and the condition settings are as in Table 4

Table 4 real-time fluorescent quantitative PCR instrument set conditions

And (5) finishing the detection of the second primer plate according to the steps.

384 real-time fluorescent quantitative PCR instrument calibration kit data analysis

The present embodiment analyzes the test data in different ways and analyzes the performance of the device from different angles.

Marginal effect (heat map) analysis:

the CT detection result is exported to obtain 2-plate data, the 2-plate data are averaged, the data from G1 to G4 are split after the averaging, the data are subjected to color gradation display after the splitting, the obtained result is shown in a figure 3, the obvious hot ring effect is shown, the equipment is normal, the approximate marginal effect range of the equipment can be known according to the result, and if an experiment with higher precision is to be carried out, the area with obvious difference can be avoided.

Uniformity analysis:

the data of plate 1 and plate 2 were analyzed separately and the average value, SD value, max (max) value, min (min) value, and (max-min) value of each gene were counted, and the results are shown in Table 5. Wherein the SD value of each gene of each plate is required to be less than or equal to 0.125, and the (max-min) value is less than or equal to 0.8, which means that the uniformity of the device is good.

Table 5 data uniformity analysis

	Average value of	SD	max	min	max-min
						Panel 1-G1	23.87	0.08	24.05	23.71	0.34
Panel 2-G1	23.98	0.09	24.23	23.79	0.44
						Boards 1-G2	21.60	0.07	21.77	21.42	0.34
Panel 2-G2	21.70	0.08	21.91	21.49	0.42
						Boards 1-G3	21.66	0.09	21.96	21.44	0.52
Boards 2-G3	21.83	0.09	22.13	21.65	0.48
						Boards 1 to G4	21.60	0.08	21.81	21.38	0.43
Boards 2-G4	21.78	0.09	21.99	21.58	0.41

Repeatability analysis:

calculating CT average values of four holes (A1/A2/B1/B2) from G1 to G4, generating 96 numerical values for each plate, calculating absolute values of the plates (plate 1-plate 2), and counting the numbers of the numerical values which are larger than 0.2, 0.4, 0.6 and 0.8, wherein the number meeting the number requirement of the table 6 indicates that the equipment repeatability is good.

Table 6 data repeatability analysis

Accuracy analysis:

the average CT values of the genes of the plate 1 and the plate 2 are calculated respectively, and the difference value between the genes is calculated, and if the table 7 meets the upper and lower limit requirements, the accuracy of the equipment is good.

Table 7 data accuracy analysis

	G1-G2	G1-G3	G1-G4	G2-G3	G2-G4	G3-G4
							Board
1	2.267	2.285	2.361	0.018	0.094	0.076
							Board 2	2.300	2.323	2.325	0.023	0.025	0.002
Upper limit of	2.668	2.459	3.027	0.367	0.431	0.969
							Lower limit of	2.068	1.935	1.691	-0.666	-0.389	-0.747

The principle of the kit of the invention is as follows: the most intuitive PCR amplification is used for detecting the performance of equipment, the selected detection target is miRNA, the sequence is short, the reaction is more sensitive, and the detection can be influenced by the slight change of temperature, so that the edge effect of the equipment can be reflected. Genes with different GC ratios are different in sensitivity degree to different systems and temperatures, so that target genes with high and low GC ratios can represent the amplification conditions of different genes. Meanwhile, the primer dry plate is used, different primers are preset in the reaction plate in advance, experimental operation errors can be reduced, the operation errors are prevented from being substituted into equipment calibration, and a user can use the primer conveniently.

The above-described embodiment is only a preferred embodiment of the present invention, and is not limited in any way, and other variations and modifications may be made without departing from the technical aspects set forth in the claims.

SEQUENCE LISTING

<110> Hangzhou foraging biotechnology Co Ltd

<120> a real-time fluorescent quantitative PCR instrument calibration kit

<130> 2021.5.13

<160> 16

<170> PatentIn version 3.3

<210> 1

<211> 40

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 1

ggcataggtt atggcttttc attcctatgt gaccagcggt 40

<210> 2

<211> 40

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 2

tcatcacttg agcgcctcga cgacagagcc gaggtgacag 40

<210> 3

<211> 36

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 3

accgcacaaa gcctgcccgg ctcctcgggt ccaggc 36

<210> 4

<211> 45

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 4

atccaccctc cgtcaagagc aataacgaaa aatgtgacgc gcctg 45

<210> 5

<211> 23

<212> RNA

<213> Artificial sequence (Artificial sequence)

<400> 5

uauggcuuuu cauuccuaug uga 23

<210> 6

<211> 23

<212> RNA

<213> Artificial sequence (Artificial sequence)

<400> 6

ugagcgccuc gacgacagag ccg 23

<210> 7

<211> 21

<212> RNA

<213> Artificial sequence (Artificial sequence)

<400> 7

aagccugccc ggcuccucgg g 21

<210> 8

<211> 23

<212> RNA

<213> Artificial sequence (Artificial sequence)

<400> 8

ucaagagcaa uaacgaaaaa ugu 23

<210> 9

<211> 21

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 9

ggcataggtt atggcttttc a 21

<210> 10

<211> 21

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 10

accgctggtc acataggaat g 21

<210> 11

<211> 17

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 11

tcatcacttg agcgcct 17

<210> 12

<211> 19

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 12

ctgtcacctc ggctctgtc 19

<210> 13

<211> 18

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 13

accgcacaaa gcctgccc 18

<210> 14

<211> 17

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 14

gcctggaccc gaggagc 17

<210> 15

<211> 22

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 15

atccaccctc cgtcaagagc aa 22

<210> 16

<211> 22

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 16

caggcgcgtc acatttttcg tt 22

Claims

1. The real-time fluorescent quantitative PCR instrument calibration kit is characterized by comprising PCR premix, PCR enzyme, a standard substance and a primer dry plate, wherein:

the standard substance is a mixture composed of 4 cDNA sequences with the sequence numbers of G1, G2, G3 and G4, and the corresponding cDNA sequences are as follows:

the cDNA sequence is obtained by reverse transcription with 4 miRNAs with sequence numbers of G1, G2, G3 and G4 as templates, or is directly synthesized according to the sequence;

the primer dry plate is 384-hole plate, the plate contains positive and negative primer dry powder for detecting target miRNA, and the corresponding positive and negative primer sequences are as follows:

the target miRNA comprises 4 miRNA genes with sequence numbers of G1, G2, G3 and G4, and the corresponding miRNA sequences and GC content thereof occupy the following proportion:

sequence number Gene sequence GC content in% by weight G1 UAUGGCUUUUCAUUCCUAUGUGA(SEQ ID No.5) 35％ G2 UGAGCGCCUCGACGACAGAGCCG(SEQ ID No.6) 70％ G3 AAGCCUGCCCGGCUCCUCGGG(SEQ ID No.7) 76％ G4 UCAAGAGCAAUAACGAAAAAUGU(SEQ ID No.8) 30％

The PCR enzyme is DNA polymerase with the concentration of 2U/ul-10U/ul.