CN113214404A

CN113214404A - Epidermal growth factor-lysozyme fusion protein and application thereof

Info

Publication number: CN113214404A
Application number: CN202010068882.0A
Authority: CN
Inventors: 王东芳; 张意红
Original assignee: Hangzhou Fangyun Biotechnology Co ltd
Current assignee: Hangzhou Fangyun Biotechnology Co ltd
Priority date: 2020-01-21
Filing date: 2020-01-21
Publication date: 2021-08-06
Anticipated expiration: 2040-01-21
Also published as: CN113214404B

Abstract

The invention discloses an epidermal growth factor-lysozyme fusion protein and application thereof in improving the expression quantity of epidermal growth factor EGF in plants and preparing a medicament for treating ulcer or/and healing wounds. According to the invention, the expression quantity of EGF can be increased and the stability of EGF is improved through the fusion expression of EGF and lysozyme; the new protein obtained after fusion expression of EGF and lysozyme has the biological functions of EGF and lysozyme, and has synergistic effect in the treatment of wound or ulcer.

Description

Epidermal growth factor-lysozyme fusion protein and application thereof

(I) technical field

The invention relates to an epidermal growth factor and lysozyme fusion protein, a coding gene and application thereof.

(II) background of the invention

Epidermal Growth Factor (EGF) is a small peptide consisting of 53 amino acid residues and has strong mitogenic effects on various tissue cells in vitro and in vivo. Human epidermal growth factor (hEGF) is a 6.2kda polypeptide consisting of 53 amino acid residues and 3 intramolecular disulfide bonds (Carpenter G et al.j Biol chem.1990). One of the major biological functions of hEGF is to promote the production of epithelial and endothelial cells, promote tissue repair, and accelerate the healing process of damaged tissues due to ulcerations and wounds (Schultz G et al j Cell biochem. 1991). hEGF is also effective in treating wrinkles, age spots, freckles and acne. Traditionally, hEGF was purified from animal urine via complex purification steps. However, the hEGF yield and purity of this process are low and do not meet the needs of industrial production. Genetic engineering is a method that allows large-scale production of pure hEGF. hEGF was produced in a variety of host systems in escherichia coli, brevibacillus brevis, saccharomyces cerevisiae, and baculovirus over the last two decades. In E.coli, hEGF production is not industrially desirable because cytoplasmic hEGF tends to form inclusion bodies, which can be rapidly degraded by proteases, resulting in misfolding of hEGF. At the same time, the overall production cost is increased due to the additional downstream processing steps required to release hEGF from inclusion bodies. In addition, the hEGF produced by prokaryotic systems has lower biological activity compared to eukaryotic systems due to the lack of post-translational modifications. Therefore, eukaryotic expression systems may be the best choice for large-scale production of high-activity hEGF. However, at present, in the eukaryotic system, the expression level of EGF is very low, which severely limits the industrialization of recombinant EGF production using the eukaryotic system. For example, EGF expressed in tobacco represents only 0.000006%, i.e., 20-60pg/mg, of total soluble protein (Higo et al. bioscibiotechnol biochem. 1993). Even after optimization, only 0.3% of total soluble protein was achieved in tobacco leaves (Bai, Jie-Ying, et al. Biotechnology letters.2007), and 6.7+/-3.1to 129.0 +/-36.7. mu.g EGF/g (He, Yonghua, et al. plos one.2016) was achieved in soybean seeds. Therefore, it is very urgent to increase the expression level of EGF in eukaryotic expression systems, particularly in plant expression systems.

Lysozyme (LYZ), also known as muramidase (muramidase), is a stable alkaline protease with a chemical name of N-acetylmuramidase (N-acetylmuramidaglycanohydrolase). It can hydrolyze N-acetylglucosamine in bacterial cell wall peptidoglycan and beta-1, 4 glycosidic bond between N-acetylmuramic acid, promote decomposition of insoluble mucopolysaccharide of bacterial cell wall into soluble glycopeptide, reduce stability of bacterial cell wall, cause overflow of cell wall cracked content, and finally cause bacterial lysis. In the case of binding to negatively charged viral proteins, lysozyme is able to form double salts with DNA, RNA, apoproteins. This double salt has the property of inactivating the virus. The research shows that the lysozyme can selectively decompose the cell wall of the microorganism on the premise of not damaging other tissues. The characteristics make the lysozyme have the unique efficacies of resisting bacteria, diminishing inflammation, resisting viruses, enhancing immunity, promoting the proliferation of beneficial bacteria such as bifidobacterium and the like. Lysozyme is classified into type 3: type C, type G and phage lysozyme. Human lysozyme (Human lysozyme, hLY) belongs to the group of C-type lysozyme, consists of 130 amino acid residues, has a relative molecular mass of 15kda, is secreted by mononuclear macrophages, and has a non-specific defense effect in the body (Huang, Jianmin, et al. molecular Breeding 2002). The human lysozyme extracted from nature is mainly extracted from human leucocyte or human milk, and has low yield and high price, so that the human lysozyme cannot be applied to clinic. However, scientists have attempted to express human lysozyme in rice seeds and have obtained transformants with lysozyme protein content of up to 0.6% of rice weight, accounting for 45% of soluble protein (Huang, Jianmin, et al molecular Breeding.2002).

A fusion gene refers to a method of joining two different genes or DNA fragments to form a new gene by means of molecular biology. The protein expressed by the obtained fusion gene may have the functions of the two proteins before fusion. However, since the function of protein is influenced by the primary structure, secondary structure and higher structure of protein amino acid sequence, the function and character of fusion protein obtained after fusion of different genes are often unpredictable, and results need to be obtained through specific research and analysis. Surprisingly, the expression quantity of EGF in the obtained fusion protein is increased and the stability is enhanced after EGF and lysozyme are subjected to fusion expression by using the method. Moreover, the fusion protein has the biological activity of EGF and lysozyme.

At present, EGF on the market is mainly obtained by a prokaryotic expression system, namely escherichia coli expression, and has high production cost and low biological activity due to lack of post-translational modification. Many researchers have tried to produce recombinant EGF by eukaryotic expression system, but the expression amount is very low, far from the level of industrialization. Therefore, it is highly desirable to increase the expression level of EGF in eukaryotic expression systems, particularly in plant bioreactors.

Disclosure of the invention

The invention aims to provide an epidermal growth factor-lysozyme fusion protein, which is a fusion expression method for obtaining the fusion protein with the cell division promoting effect of the epidermal growth factor and the bactericidal effect of lysozyme and simultaneously improving the expression quantity of the epidermal growth factor EGF by fusing and expressing the epidermal growth factor EGF and the lysozyme LYZ; because the lysozyme has a bactericidal effect, the lysozyme and the EGF form a synergistic effect when treating ulcer or wound healing, and the problems of low bioactivity and low expression level of the conventional epidermal growth factor EGF are solved.

The technical scheme adopted by the invention is as follows:

the invention provides an epidermal growth factor-lysozyme fusion protein, which is formed by linking an Epidermal Growth Factor (EGF) and Lysozyme (LYZ) by using a connecting peptide, namely the epidermal growth factor, the connecting peptide and the lysozyme are sequentially linked or the lysozyme, the connecting peptide and the epidermal growth factor are sequentially linked.

Further, the epidermal growth factor can be derived from human or mammals, and is not limited to the nucleotide sequence shown in table 1, preferably human epidermal growth factor, and the nucleotide sequence is shown in SEQ ID No. 7.

TABLE 1 epidermal growth factor and amino acid sequences from different sources

Further, the lysozyme can be derived from prokaryotes or eukaryotes, is not limited to the nucleotide sequence shown in table 2, and preferably has the nucleotide sequence shown in SEQ ID No. 8.

TABLE 2 Lysozyme from different sources and the amino acid sequence accession numbers

Sources of lysozyme	NCBI Sequence ID
		Human (Human)	1IWT_A
Egg (Hen Egg)	1LZD_A
		Sheep (sheet)	P80190.1
Cattle (Cattle)	AAB26394.1
		Seaweed (algae)	PRW61607.1

Furthermore, the amino acid sequence of the connecting peptide is shown in SEQ ID NO.1 or SEQ ID NO. 2. When the amino acid sequence of the connecting peptide is shown as SEQ ID NO.1, the amino acid sequence of the epidermal growth factor-lysozyme fusion protein (marked as EGF-LG-L) is shown as SEQ ID NO.5, and the nucleotide sequence of the coding gene is shown as SEQ ID NO. 3. When the amino acid sequence of the connecting peptide is shown as SEQ ID NO.2, the amino acid sequence of the epidermal growth factor-lysozyme fusion protein (marked as EGF-LRG-L) is shown as SEQ ID NO.6, and the nucleotide sequence of the coding gene is shown as SEQ ID NO. 4.

The invention provides an expression vector containing an epidermal growth factor-lysozyme fusion protein coding gene, which can be a prokaryotic expression vector or a eukaryotic expression vector. The eukaryotic expression vector provided by the invention comprises but is not limited to yeast expression vectors, insect expression vectors, animal cell expression vectors and plant expression vectors, and preferably plant expression vectors.

The invention provides a prokaryotic expression method of epidermal growth factor-lysozyme fusion protein, which is characterized in that a prokaryotic expression vector containing fusion genes is constructed, the vector is transformed into a prokaryotic expression strain, and the prokaryotic expression is induced and expressed.

The invention provides a eukaryotic expression method of epidermal growth factor-lysozyme fusion protein, which is characterized in that a plant expression binary vector containing a fusion gene is transferred into a plant by an agrobacterium-mediated method, and a positive plant is screened out by a screening marker or a molecular detection method. The plant into which the binary expression vector is transferred comprises monocotyledons and dicotyledons, including but not limited to rice, corn, soybean, tomato and cucumber, and preferably rice and corn.

The invention provides an application of an epidermal growth factor-lysozyme fusion protein in improving the expression quantity of an epidermal growth factor EGF in plants, wherein the plants comprise rice, corn, soybean, tomato and cucumber.

The invention provides an application of epidermal growth factor-lysozyme fusion protein in preparing a medicament for treating ulcer or/and wound healing, and particularly relates to the application of the epidermal growth factor-lysozyme fusion protein or a transgenic crop processed product containing the fusion protein in contact with ulcer or wound to promote new cell division and growth, kill bacteria on the ulcer or wound and synergistically promote wound healing.

The invention provides an application of epidermal growth factor-lysozyme fusion protein in antibody preparation. The invention is characterized in that the invention carries out immunoassay by expressing, extracting or artificially synthesizing the full-length sequence or partial sequence of the epidermal growth factor-lysozyme fusion protein, and screens out the antibody with epidermal growth factor resistance and lysozyme resistance.

Compared with the prior art, the invention has the following beneficial effects: firstly, the expression quantity of EGF can be increased through the fusion expression of epidermal growth factor EGF and lysozyme LYZ; secondly, the stability of the epidermal growth factor EGF can be improved through the fusion of the epidermal growth factor EGF and lysozyme; thirdly, the new protein obtained after fusion expression of the epidermal growth factor EGF and the lysozyme has the biological functions of the EGF and the lysozyme, and has a synergistic effect when being applied to wounds or ulcers and the like.

(IV) description of the drawings

FIG. 1 is a schematic diagram of the expression cassette of the EGF-lysozyme fusion gene; a promoter: preferably a seed or fruit specific promoter; EGF-LYZ fusion gene: is the fusion gene of epidermal growth factor and lysozyme.

FIG. 2 is a schematic diagram of the structure of an epidermal growth factor-lysozyme fusion gene plant expression vector.

FIG. 3 is a flow chart of a method for obtaining transgenic rice with an epidermal growth factor-lysozyme fusion gene.

(V) detailed description of the preferred embodiments

The invention will be further described with reference to specific examples, but the scope of the invention is not limited thereto:

example 1 obtaining of fusion Gene of epidermal growth factor and lysozyme

The nucleotide coding sequence of human epidermal growth factor (SEQ ID NO.7) and the nucleotide coding sequence of human lysozyme (SEQ ID NO.8) were artificially synthesized as templates, and the following PCR primers were designed to obtain the fusion gene by means of multiple PCR cycles. The PCR reaction conditions are as follows: 3 minutes at 95 ℃; repeating 32 cycles at 95 ℃ for 15 seconds and 72 ℃ for 1 minute; then 10 minutes at 72 ℃.

(1) Fusion gene EGF-LG-L

Using human epidermal growth factor coding nucleotide sequence (SEQ ID NO.7) as a template, and carrying out PCR amplification by using primers EL-F1 and ELG-R1; then, PCR amplification was carried out using the above amplification product as a template and primers EL-F1 and ELG-R2, and the amplification product was named EGF-LG.

The encoding nucleotide sequence (SEQ ID NO.8) of human lysozyme is taken as a template, and primers ELG-F1 and EL-R are used for amplification; then, PCR amplification was carried out using the above-mentioned amplification product as a template and primers ELG-F2 and EL-R, and the amplification product was named LG-L.

And then EGF-LG and LG-L are used as templates, primers EL-F2 and EL-R are used for amplification, an amplification product is a fusion gene of the human epidermal growth factor and the human lysozyme, and is named as EGF-LG-L, a nucleotide sequence is shown as SEQ ID NO.3, an encoded amino acid sequence is shown as SEQ ID NO.5, and a connecting peptide coding sequence between a human epidermal growth factor coding sequence and a human lysozyme coding sequence is shown as SEQ ID NO. 1.

(2) Fusion gene EGF-LRG-L

Using human epidermal growth factor coding nucleotide sequence (SEQ ID NO.7) as a template, and carrying out PCR amplification by using primers EL-F1 and ELRG-R1; then, PCR amplification is carried out by using the amplification product as a template and using primers EL-F1 and ELRG-R2; then, PCR amplification was carried out using the above-mentioned amplification product as a template and primers EL-F1 and ELRG-R3, and the amplification product was named EGF-LRG.

The coding nucleotide sequence (SEQ ID NO.8) of human lysozyme is taken as a template, and primers ELRG-F1 and EL-R are used for amplification; then, PCR amplification is carried out by using the amplification product as a template and using primers ELRG-F2 and EL-R; then, PCR amplification was carried out using the above-mentioned amplification product as a template and primers ELRG-F3 and EL-R, and the amplification product was named LRG-L.

And then EGF-LRG and LRG-L are used as templates, primers EL-F2 and EL-R are used for amplification, an amplification product is a fusion gene of the human epidermal growth factor and the human lysozyme, and is named as EGF-LRG-L, a nucleotide sequence is shown as SEQ ID No.4, an encoded amino acid sequence is shown as SEQ ID No.6, and a connecting peptide coding sequence between a human epidermal growth factor coding sequence and a human lysozyme coding sequence is shown as SEQ ID No. 2.

Table 3: primer for PCR amplification of epidermal growth factor and lysozyme fusion gene

Primer name	Primer sequences
		EL-F1	5’GGATCCAACAATGGGTAACAGCGACAGCGAGTGCCCGCT
EL-F2	5’CATATTTCGCAAAGACGGATCCAACAATGGGTAACAGCGACAGC
		ELG-R1	5’CCTCCTTCGCAGCAGCCTCCCTCAGCTCCCACCACTTCA
ELG-R2	5’CTCCTTGGCGGCAGCCTCCTTCGCAGCAGCCTCC
		ELG-F1	5’GAGGCCGCTGCCAAGAAGGTGTTCGAGCGCTGCGA
ELG-F2	5’GAGGCTGCCGCCAAGGAGGCCGCTGCCAAGAAGGT
		EL-R	5’CCAAATGTTTGAATTATCACACGCCGCAGCCCTGCACGTAC
ELRG-R1	5’GGACCCGCCACCTCCCCTCAGCTCCCACCACTTCA
		ELRG-R2	5’GAGCCACCGCCGGACCCGCCACCTCCCCTCA
ELRG-R3	5’GTGCGGAGCCACCGCCGGACCCGCCA
		ELRG-F1	5’CAGCTCCGGCTCCGAAGGTGTTCGAGCGCTGCGA
ELRG-F2	5’GGTGGCTCCGCACCAGCTCCGGCTCCGAAGGTG
		ELRG-F3	5’GGGTCCGGCGGTGGCTCCGCACCAGCTCC

Example 2 construction of fusion Gene prokaryotic expression vector

Primers ELGL-F:5 'GATATACCATGGGCAACAGCGACAGCGAGTGCCCGCT and ELGL-R: 5' GGTTCCTCGAGCACGCCGCAGCCCTGCACGTACT, which were provided with NcoI and XhoI restriction sites, respectively, were designed. The fusion gene EGF-LG-L obtained in example 1 is used as a template (SEQ ID NO.3), the DNA fragment obtained by amplification is subjected to double enzyme digestion through NcoI and XhoI, and is connected into a pET-28a (+) vector digested by the same enzyme, the connected plasmid is transferred into escherichia coli BL21(DE3), and a recombinant strain escherichia coli BL21(DE3) -EGL is obtained by screening, and the expression vector is named as pET-28 a-EGL.

Under the same condition, EGF-LG-L of the fusion gene is replaced by EGF-LRG-L (SEQ ID NO.4), so as to obtain a recombinant strain Escherichia coli BL21(DE3) -ERGL, and an expression vector is named as pET-28 a-ERGL.

Example 3 prokaryotic expression and protein extraction

The recombinant strains escherichia coli BL21(DE3) -EGL and escherichia coli BL21(DE3) -ERGL obtained by example 2 were each streaked on an LB solid medium containing kanamycin (50ug/ml) to obtain a single clone, and then the colony of the single clone was inoculated into 100 ml of LB liquid medium, shake-cultured at 37 ℃ to OD600 ═ 0.6, added with IPTG to 0.5mM, and cultured for 4 hours under the same conditions. The culture medium was collected and centrifuged at 5000g for 10 minutes to precipitate E.coli, and then the supernatant was discarded to collect the precipitate. 30 ml of 20mM Tris-HCl buffer solution is added into the sediment, and the sediment can be used for subsequent experiments after being subjected to ultrasonic disruption. Human epidermal growth factor and human lysozyme fusion proteins (EGL, designated EGL and ERGL, respectively) with a molecular weight of about 23.6kd were detected by protein SDS gel electrophoresis. The fusion protein EGL and the fusion protein ERGL can be obtained with high purity by tapping recovery or His label purification.

The purification of the His tag protein belongs to a conventional experimental method and is specifically completed by the following four steps:

the first step is as follows: fixing Ni column and waste liquid collecting vessel, flowing out 20% ethanol in the column, adding PBS 1CV to clean the Ni column.

The second step is that: taking the supernatant fluid of the escherichia coli subjected to ultrasonic disruption, controlling the flow rate at 150cm/h, properly adopting an injector needle and a pipette tip to control the flow rate, receiving 28ul of a flow-through fluid sample, adding 7ul of 5 xSDS-PAGE loading buffer, blowing, sucking and uniformly mixing, and taking the sample as the flow-through sample.

The third step: preparing 25mM imidazole solution 1-1.5CV from PBS to clean the Ni column, collecting a sample of impurity washing solution of 28ul, adding 7ul of 5 xSDS-PAGE loading buffer, and uniformly mixing by blowing and sucking, wherein the sample is used as an impurity washing sample.

The fourth step: preparing 200mM imidazole solution with PBS (1 CV) to elute EGL or ERGL protein, collecting the EGL or ERGL protein into 3-4 ml centrifuge tubes, collecting 28ul of collected sample, adding 7ul of 5 xSDS-PAGE loading buffer, blowing and sucking the sample uniformly, and taking the sample as an elution collection sample. The purity and concentration of EGL or ERGL protein were determined by SDS-PAGE polyacrylamide gel electrophoresis.

Example 4 preparation of antibodies against epidermal growth factor and lysozyme fusion protein EGL or ERGL

The antibody preparation has a general method (research progress [ J ] of the Shore Biying antibody preparation method. plant quarantine, 2003 (5)), and specifically, EGL or ERGL protein obtained by the method in example 3 can be used for immunizing rabbits with protein samples purified by 0.22um filter membranes, and the potency can be measured by injecting the protein samples twice, once in 15 days, and one week after the third injection. The injection dose is 0.5mg/kg body weight for 4 times, and rabbit polyclonal antibody against EGL or ERGL is obtained respectively.

Example 5 fusion protein plant expression binary vector construction

Construction of Agrobacterium T-DNA vector: the binary vector pCambia1300-p35S-CP4 is modified from the vector pCambia1300, and simply the hygromycin resistance gene in the pCambia1300 vector is replaced by the glyphosate resistance gene CP 4. Specifically, after the pCambia1300 vector is subjected to XhoI enzyme digestion, dephosphorylation treatment is carried out, then both ends of the pCambia1300 vector are connected with a CP4 gene fragment (SEQ ID NO.9) which is obtained after XhoI enzyme digestion and contains chloroplast transit signal peptide and a terminator in an artificial synthesis manner, and transformation is carried out, so that the obtained vector is pCambia1300-p35S-CP 4.

Artificially synthesizing a promoter (SEQ ID NO.10) and a terminator sequence (SEQ ID NO.11) of a human epidermal growth factor and human lysozyme fusion gene, wherein the promoter sequence comprises a rice seed specific expression promoter GT1 and a signal peptide coding sequence thereof. Artificial synthesis the primers in Table 4 were used for construction of the human epidermal growth factor and human lysozyme fusion gene expression cassette (FIG. 1).

Table 4: primer for constructing EGL fusion gene binary expression vector

Name (R)	Sequence of	Cleavage site
			PF	5’GGGAAGCTTAAAGGTGCCGTGCAGTTCAAACAATT	HindIII
PR	5’GCTGTCGCTGTTGGCTAGGGAGCCATCGCACAAG	Is free of
			EGLF	5’GGCTCCCTAGCCAACAGCGACAGCGAGTGCCC	Is free of
EGLR	5’GTAATGAGCTCTTATCACACGCCGCAGCCCTGCACGT	Is free of
			TF	5’CTGCGGCGTGTGATAAGAGCTCATTACAGGTGACC	Is free of
TR	5’CGCGGTACCCGATCTAGTAACATAGATGACACCGC	KpnI

Using an artificially synthesized promoter (SEQ ID NO.10) as a template, and amplifying by using primers PF and PR to obtain a fragment pGT 1; using artificially synthesized terminator (SEQ ID NO.11) as a template, and amplifying by using primers TF and TR to obtain a fragment Ter; using the fusion gene EGF-LG-L (SEQ ID NO.3) obtained in example 1 as a template, a fragment EGL was obtained by amplification using primers EGLF and EGLR. The 3 PCR products (fragment pGT1, fragment EGL and fragment Ter) were mixed as a template, and amplified with primers PF and TR to obtain fragment pGT 1-EGL-Ter. The fragment pGT1-EGL-Ter and the vector pCambia1300-p35S-CP4 were digested with HindIII and KpnI, respectively, and the vector and the fragment were ligated with T4 ligase to obtain the final vector, which was named pCambia1300-CP4-EGL (FIG. 2).

As a control, a plasmid expressing human epidermal growth factor alone was constructed. Similarly, primers EGF-F were artificially synthesized: 5' CTCCCTAGCCAACAGCGACAGCGAGTGCCC and EGF-R: 5' TGTCGCTGTTGGCTAGGGAGCCATCGCACAA. Using an artificially synthesized promoter (SEQ ID NO.10) as a template, and amplifying by using primers PF and PR to obtain a fragment pGT 1; using artificially synthesized terminator (SEQ ID NO.11) as a template, and amplifying by using primers TF and TR to obtain a fragment Ter; the EGF fragment is obtained by amplification with the primers EGF-F and EGF-R, using the nucleotide sequence (SEQ ID NO.7) encoding human epidermal growth factor of example 1 as a template. The 3 PCR products (fragment pGT1, fragment Ter, fragment EGF) were mixed as a template, and amplified with primers PF and TR to obtain fragment pGT 1-EGF-Ter. The fragment pGT1-EGL-Ter and the vector pCambia1300-p35S-CP4 were digested with HindIII and KpnI, respectively, and the vector and the fragment were ligated with T4 ligase to obtain the final vector, which was named pCambia1300-CP 4-EGF.

Finally, the above 2T-DNA plasmids (pCambia1300-CP4-EGL, pCambia1300-CP4-EGF) were transferred to Agrobacterium LBA4404 by electroporation, and positive clones were selected by YEP solid medium containing 15. mu.g/mL tetracycline and 50. mu.g/mL kanamycin and were then used for the subsequent plant transformation.

Example 6 obtaining of Rice expressing epidermal growth factor-Lysozyme fusion protein

The transgenic rice is obtained by adopting the prior art (Luzhong, Gong ancestor Xun (1998) Life sciences 10: 125-. The method we used includes processes of callus preparation, infection, selection, pre-differentiation, differentiation and rooting (FIG. 3). Specifically, mature and full 'Xishui-134' seeds are selected for shelling and induced to generate callus as a transformation material. Agrobacterium plates were taken of the vectors constructed in example 5, pCambia1300-CP4-EGL and pCambia1300-CP4-EGF, respectively. A single colony is selected and inoculated, and agrobacterium for transformation is prepared. The more to be transformedPlacing the injured tissue into Agrobacterium tumefaciens bacterial liquid with OD of about 0.6 (preparation of Agrobacterium tumefaciens bacterial liquid, inoculating Agrobacterium tumefaciens into culture medium, culturing at 28 deg.C to OD of about 0.6, culture medium composition: 3g/L K₂HPO₄、1g/L NaH₂PO₄、1g/L NH₄Cl、0.3g/L MgSO₄·7H₂O、0.15g/L KCl、0.01g/L CaCl₂、0.0025g/L FeSO₄·7H₂O, 5g/L sucrose, 20mg/L acetosyringone, water as solvent, pH 5.8), agrobacterium is allowed to bind to the callus surface, then the callus is transferred to co-culture medium (MS +2mg/L2,4-D (2, 4-dichlorophenoxyacetic acid) +30g/L glucose +30g/L sucrose +3g/L agar (sigma 7921) +20mg/L acetosyringone), and co-culture is carried out for 2-3 days at 28 ℃. The transformed calli were rinsed with sterile water, transferred to selection medium (MS +2mg/L2,4-D +30g/L sucrose +3g/L agar (Sigma 7921) +20mg/L acetosyringone +2mM glyphosate (Sigma)), and selected for two months at 28 ℃ (subculture) (FIG. 3). After screening, the callus with good growth activity is transferred to a pre-differentiation culture medium (MS +0.1g/L inositol +5mg/L ABA (abscisic acid) +1mg/L NAA (naphthylacetic acid) +5 mg/L6-BA (6-benzylaminopurine) +20g/L sorbitol +30g/L sucrose +2.5g/L gelrite (plant gel)), and cultured for about 20 days at 28 ℃, then the pre-differentiated callus is transferred to a differentiation culture medium, and the differentiation and germination are carried out by illumination for 14 hours every day. After 2-3 weeks, transferring the resistant regenerated plants to a rooting culture medium (1/2MS +0.2mg/L NAA +20g/L sucrose +2.5g/L gelrite) for strong seedling and rooting, finally washing the regenerated plants and removing agar, transplanting the washed regenerated plants to a greenhouse, and screening out a high-expression transgenic line EGL (marked as transgenic rice EGL) and a transgenic line EGF (marked as transgenic rice EGF) through an EGF expression quantity detection test.

Example 7 measurement of EGF expression and Activity in transgenic Rice seeds EGL

1. Expression level of EGF

1 transgenic rice EGL seed obtained by the method of example 6 was taken and ground thoroughly in 1ml Phosphate Buffered Saline (PBS) with 0.35M NaCl in a pre-cooled mortar and pestle. The slurry was then poured into centrifuge tubes and centrifuged at 14000rpm for 10 minutes at 4 ℃ to collect the supernatant.

The supernatant was prepared from 12% pre-gel (SurePAGE)^TMKinseri) was subjected to SDS-PAGE. Western blot experiments were performed using the rabbit polyclonal antibody against EGL prepared in example 4 as the primary antibody, which was used at a volume ratio of 1: 5000. The expression level of the fusion protein can be roughly determined according to the strength of the hybridization signal.

EGF expression of the transgenic rice EGL can be accurately tested by using a human Lysozyme (LYZ) ELISA kit (SU-BN11222, Shanghai Boyan Biotech Co., Ltd.). The specific method comprises the following steps: the supernatant was collected, absorbance was measured at OD450 nm, and the amount of EGL expression in the sample was calculated according to the standard human lysozyme curve, and the results are shown in Table 5.

Human lysozyme standard: diluting human lysozyme standard (L1667-1G, Sigma-Aldrich) with PBS buffer solution to concentration of 800, 400, 200, 100, 50, 25ng/ml, detecting absorbance at OD450 nm, and obtaining standard curve y-38.109 x-7.0253 (R) with human lysozyme concentration as abscissa and absorbance as ordinate²＝0.999)。

TABLE 5 expression level of EGF in EGL seeds of transgenic rice

Rice seed	EGF expression amount (μ g/g)
		Transgenic rice EGL	169.7±19.5
EGF of rice seeds	52.6±11.2

Remarking: 3 replicates were measured for each sample.

2. Human Lysozyme (LYZ) activity

Lysozyme activity detection is a conventional detection method, and can detect lysozyme activity by using a cell suspension turbidimetry method (von huoyong, xu-minds, and grand anzhi. "bioassay method for lysozyme research." food and fermentation industry 04(2002):62-66.), and comprises the following specific steps:

1. preparing standard solution

16mg of lysozyme powder was weighed out accurately, dissolved in 0.1mol/L phosphate buffer, pH6.2, to prepare an enzyme solution with a concentration of 4mg/ml, and the enzyme solution was diluted sequentially with the same buffer to 2, 1, 0.5, 0.25, 0.125 and 0.0625 mg/ml.

2. Turbidimetric measurement

3.0ml of test bacterium suspension is taken and placed in a cuvette to measure the OD450 value under 450nm, and then 0.2ml of lysozyme sample is added and quickly shaken up. The OD450 was recorded every 30 seconds from the time of addition of the enzyme solution.

3. Calculation of lysozyme Activity

Definition of enzyme activity unit: OD450 decreased by 1 enzyme activity unit (1U) per 0.001 position at 25 ℃ and pH 6.2. The enzyme activity is calculated by the formula

The lysozyme activity measured according to the above method is shown in Table 6.

3. Human Epidermal Growth Factor (EGF) activity

Human epidermal growth factor activity assay As a conventional assay, we used the MTS/PMS assay (determination of the in vitro biological activity of Haematocon, Lihuangjin. recombinant human epidermal growth factor [ J ] Guangdong medicine, 1998,019(005): 324-.

Bal/3T3 (human skin fibroblasts) was purchased from Shanghai cell, a Chinese academy. Medium RMIP1640, DMEM, both from GIBCO, MTS/PMS (lot #563670) from Promega. hEGF (lot # E9644) was purchased from Sigma, usa. Specifically, the method comprises the following steps: (1) cell culture: Bal/3T3 cells stored in liquid nitrogen were activated with RMIP1640 medium containing 20% serum, and then activated with 10% serumThe RMIP1640 culture medium is used for culture and passage once, and the sample to be detected can be used for detection after the spreading rate reaches 70-80%. (2) Taking a sterile 96-well plate, taking a No.1 hole as a blank, taking a No.2 hole as a contrast, taking a No.3 hole as a sample to be detected (namely the supernatant in the step 1), adding 50 microliters of RMIP1640 culture medium into each hole, and adding 3 parallel groups of each sample; adding 50 microliters of samples to be detected into the No.1 hole and the No.3 hole respectively, and diluting the samples in half right from the No.3 hole; selecting one bottle of cells in logarithmic growth phase, digesting with trypsin, collecting cells, washing with RMIP1640 medium containing 0.5% serum once, counting blood cells, adjusting cell number to desired concentration with RMIP1640 medium containing 0.5% serum, adding 50. mu.l of cell suspension to each well (adding 50. mu.l of RMIP1640 medium to each well of control group), and adding 5% CO at 37 deg.C²Culturing in an incubator for 48 hours; freshly prepared 20. mu.l of MTS/PMS solution, 5% CO at 37 ℃ was added to each well₂The cells were incubated in an incubator for 1to 4 hours, and OD was measured using a microplate reader (Bio-Rad, model 550). And calculating the activity of EGF in the sample to be detected according to the OD value.

TABLE 6 EGF and LYZ Activity assay of transgenic Rice seed EGL

	EGF activity	LYZ Activity
			EGL	100％	100％
rEGF standard	100％	0％
			rLYZ standard	0％	100％

Remarking: assuming that the activity of the rEGF standard is 100% and the activity of the rLYZ standard is 100%.

Example 8 fusion protein stability assay

The fusion proteins EGL, ERGF and rEGF prepared in example 4 were respectively dissolved in PBS (pH7.4) and placed at 4 ℃ and 28 ℃ respectively, and EGF activities at different temperatures and for different periods of time were measured according to the method of example 7.

TABLE 7 Activity of proteins left at different temperatures for different periods of time

Example 9 obtaining of corn expressing epidermal growth factor-lysozyme fusion protein

The transformation technology of corn is mature. References such as Vladimir Sidorov&David Duncan(in M.Pa ul Scott(ed.),Methods in MolecularBiology:Transgenic Maize,vol:526；Yuji Ishida,Yukoh Hiei&Nature Protocols 2: 1614-. The basic method is as follows: collecting Hi-II corn ear 8-10 days after pollination, and collecting all immature embryos (with size of 1.0-1.5 mm). Agrobacterium containing the T-DNA vectors pCambia1300-CP4-EGL and pCambia1300-CP4-EGF prepared in example 5 were co-cultured with immature embryos on co-culture medium (MS +2mg/L2,4-D +30g/L sucrose +3g/L agar (sigma 7921) +40mg/L acetosyringone) for 2-3 days (22 ℃). Transfer immature embryos onto callus induction Medium (MS +2mg/L2,4-D +30g/L sucrose +2.5g/L gelrite +5mg/L AgNO)₃+200mg/L acetosyringone), dark culture at 28 ℃ for 10-14 days. All calli were transferred to selection medium (same as callus induction medium) with 2mM glyphosate, 2Dark culture at 8 ℃ for 2-3 weeks. All tissues were transferred to fresh glyphosate-containing selection medium and incubated in the dark at 28 ℃ for 2-3 weeks. Then, all the screened viable embryonic tissues were transferred to a regeneration medium (MS +30g/L sucrose +0.5mg/L kinetin +2.5g/L gelrite +200mg/L acetosyringone) and cultured in the dark at 28 ℃ for 10-14 days, one strain per dish. Transferring the embryonic tissue to a fresh regeneration medium, and culturing for 10-14 days at 26 ℃ by illumination. All fully developed plants were transferred to rooting medium (1/2MS +20g/L sucrose +2.5g/L gelrite +200mg/L acetosyringone) and cultivated with light at 26 ℃ until the roots were fully developed. Transgenic maize plants containing the transformation vectors pCambia1300-CP4-EGL and pCambia1300-CP4-EGF were obtained, and designated as transgenic maize EGL and transgenic maize EGF, respectively.

Example 10 identification of expression amount and Activity of fusion protein expressed in maize

1 transgenic maize EGL seed prepared by example 9 was removed and ground thoroughly in 1ml Phosphate Buffered Saline (PBS) with 0.35M NaCl in a pre-cooled mortar and pestle. The slurry was then poured into centrifuge tubes and centrifuged at 14000rpm for 10 minutes at 4 ℃ to collect the supernatant.

(1) Expression level of EGF

The supernatant was applied with 12% pre-gel (SurePAGE)^TMKinseri) was subjected to SDS-PAGE. The expression level of the fusion protein was measured using the rabbit polyclonal antibody against EGL prepared in example 4 as a primary antibody in the same manner as in example 7, and the results are shown in Table 8. it can be seen from Table 8 that the expression level of EGF was significantly increased after fusion expression of EGF in corn seeds.

TABLE 8 expression levels of EGF in transgenic maize seeds

	Expression level (μ g/g)
		EGL	143.7±15.2
Corn seed EGF	48.7±9.8

Remarking: 3 replicates were measured for each sample.

(2) EGF activity

The human lysozyme activity of the corn seed EGL was determined as in example 7 and the results are shown in Table 9.

(3) LYZ Activity

The activity of human epidermal growth factor of EGL from corn seeds was determined as in example 7, and the results are shown in Table 9.

TABLE 9 EGF and LYZ Activity assay of transgenic maize seed EGL

	EGF activity	LYZ Activity
			Corn seed EGL	100％	100％
rEGF standard	100％	0％
			rLYZ standard	0％	100％

Remarking: the EGF activity of the rEGF standard was assumed to be 100% and the LYZ activity of the rLYZ standard was assumed to be 100%.

As can be seen from Table 9, EGL fusion proteins expressed in maize seeds have both EGF and LYZ activity.

Example 11 transformation of transgenic maize expressing EGL fusion protein into sweet maize

The transgenic corn EGL prepared by the method of example 9 is hybridized with the sweet bt 1-11 of the sweet corn inbred line, the sweet bt 1-11 is used as a recurrent parent, the inbred line is continuously backcrossed for 6 generations and then inbred for two generations, and after stabilization, the inbred line is hybridized with the sweet bt 1-15 to obtain a hybrid.

EXAMPLE 12 use of corn expressing epidermal growth factor-lysozyme fusion protein for ulcer or/and wound healing

EGL-expressing sweet maize hybrids were obtained by example 9 and example 11 in this order. The corn kernels 22-25 days after harvest and flowering are juiced for subsequent use. A24-rabbit oral ulcer model is established and randomly divided into a corn juice treatment group for expressing epidermal growth factor-lysozyme fusion protein, a Bingpeng powder group and a blank control group, wherein the first two groups are applied for 2 times/d and 10 ml/time, and the blank group is not treated. The results show that the healing time of the corn juice group (5.14 +/-0.87) d, the healing time of the Bingpeng powder group (6.69 +/-1.51) d and the healing time of the blank group (8.79 +/-1.87) d are obviously superior to that of the control group, and the difference has statistical significance.

The wound of the white mouse scratched is treated by corn powder obtained by crushing corn juice expressing the epidermal growth factor-lysozyme fusion protein or freeze-dried corn kernels, and the wound recovery speed is obviously higher than that of a control group.

Example 13 obtaining of soybeans expressing epidermal growth factor-lysozyme fusion protein

The procedure used here to obtain transgenic soybeans was from the established art (Deng et al, 1998, Plant Physiology communication)ons 34: 381-387; ma et al, 2008, Scientia Agrichtura Si 41:661- "668; zhou et al, 2001, Journal of North Agricultural University 32: 313-. Healthy, full and ripe soybeans are selected, sterilized with 80% ethanol for 2 minutes, washed with sterile water, and then placed in a desiccator filled with chlorine gas (generated by the reaction of 50ml of NaClO and 2ml of concentrated HCl) for sterilization for 4-6 hours. The sterilized semen glycines is sowed in B5 culture medium in clean bench, and cultured at 25 deg.C for 5 days with optical density of 90-150 μmol photon/m²S level. When the cotyledon turns green and breaks the seed coat, the aseptic bean sprouts grow. The bean sprouts with the hypocotyl removed were cut into five-five pieces in length so that both explants had cotyledons and epicotyls. The explants are cut at about 7-8 of the node of the cotyledon and epicotyl and can be used as the target tissue to be infected.

The monoclonal Agrobacterium containing the vectors pCambia1300-CP4-EGL and pCambia1300-CP4-EGF, respectively, prepared in example 5 were grown separately and used. The prepared explants are immersed in the Agrobacterium suspension with OD value of 0.4-0.8 for co-cultivation for about 30 minutes. Then, the excess cell suspension on the infected tissue was absorbed up with absorbent paper, transferred to 1/10B5 co-culture medium, and cultured in the dark at 25 ℃ for 3-5 days.

The co-cultured plant tissue was washed with B5 liquid medium to remove excess Agrobacterium, and then placed in B5 solid medium for 5 days at 25 ℃ until it germinated. The induced germ tissue was transferred to B5 selection medium containing 0.1-0.5mM glyphosate and incubated at 25 ℃ with light for 4 weeks, during which the medium was changed every two weeks. Transferring the selected embryo tissue to a solid culture medium, culturing at 25 deg.C, and growing into plantlet. Subsequently, the transgenic shoots were transferred to 1/2B5 medium for rooting induction. Finally, the grown plantlets are washed to remove agar and planted in a greenhouse to obtain transgenic soybean EGL and transgenic soybean EGF respectively.

Example 14 use of prokaryotically expressed epidermal growth factor-lysozyme recombinant fusion proteins (EGL and ERGL) for ulcer or/and wound healing

Prokaryotic expression of recombinant proteins EGL and ERGL were obtained by example 3. Establishing 24 rabbit oral ulcer models, randomly dividing into a prokaryotic expression EGL treatment group, a prokaryotic expression ERGL treatment group, a Bingpeng powder group and a blank control group, wherein the first two groups are applied for 2 times/d and 1 ml/time, the concentrations of the prokaryotic expression EGL or ERGL are both 1mg/ml, and the blank group is not processed. The results show that the healing time of the prokaryotic expression EGL group (5.66 +/-0.89) d, the healing time of the prokaryotic expression ERGL treatment group (5.75 +/-0.92) d, the healing time of the Bingpeng powder group (6.71 +/-1.47) d and the healing time of the blank group (8.83 +/-1.85) d are obviously superior to those of the control group, and the difference has statistical significance.

When the EGL or ERGL expressed by pronucleus is used for treating the scratched wound of a white mouse, the wound recovery speed is obviously higher than that of a control group.

Finally, it should also be noted that the above-mentioned list is only a specific embodiment of the invention. It is obvious that the invention is not limited to the above embodiments, but that many variations are possible. All modifications which can be derived or suggested by a person skilled in the art from the disclosure of the present invention are to be considered within the scope of the invention.

Sequence listing

<110> Hangzhou aromatic rhyme Biotechnology Co., Ltd

<120> epidermal growth factor-lysozyme fusion protein and application thereof

<160> 11

<170> SIPOSequenceListing 1.0

<210> 1

<211> 45

<212> DNA

<213> Unknown (Unknown)

<400> 1

gaggctgctg cgaaggaggc tgccgccaag gaggccgctg ccaag 45

<210> 2

<211> 45

<212> DNA

<213> Unknown (Unknown)

<400> 2

ggaggtggcg ggtccggcgg tggctccgca ccagctccgg ctccg 45

<210> 3

<211> 594

<212> DNA

<213> Unknown (Unknown)

<400> 3

aacagcgaca gcgagtgccc gctgagccac gacggctact gcctgcacga cggcgtgtgc 60

atgtacatcg aggccctgga caagtacgcc tgcaactgcg tggtgggcta catcggcgag 120

aggtgccagt acagggacct gaagtggtgg gagctgaggg aggctgctgc gaaggaggct 180

gccgccaagg aggccgctgc caagaaggtg ttcgagcgct gcgagctggc ccgcaccctc 240

aagcgcctcg gcatggacgg ctaccgcggc atctccctcg ccaactggat gtgcctcgcc 300

aagtgggagt ccggctacaa cacccgcgcc accaactaca acgccggcga ccgctccacc 360

gactacggca tcttccagat caactcccgc tactggtgca acgacggcaa gaccccgggc 420

gccgtgaacg cctgccacct ctcctgctcc gccctcctcc aggacaacat cgccgacgcc 480

gtggcctgcg ccaagcgcgt ggtgcgcgac ccgcagggca tccgcgcctg ggtggcctgg 540

cgcaaccgct gccagaaccg cgacgtgcgc cagtacgtgc agggctgcgg cgtg 594

<210> 4

<211> 594

<212> DNA

<213> Unknown (Unknown)

<400> 4

aacagcgaca gcgagtgccc gctgagccac gacggctact gcctgcacga cggcgtgtgc 60

atgtacatcg aggccctgga caagtacgcc tgcaactgcg tggtgggcta catcggcgag 120

aggtgccagt acagggacct gaagtggtgg gagctgaggg gaggtggcgg gtccggcggt 180

ggctccgcac cagctccggc tccgaaggtg ttcgagcgct gcgagctggc ccgcaccctc 240

aagcgcctcg gcatggacgg ctaccgcggc atctccctcg ccaactggat gtgcctcgcc 300

aagtgggagt ccggctacaa cacccgcgcc accaactaca acgccggcga ccgctccacc 360

gactacggca tcttccagat caactcccgc tactggtgca acgacggcaa gaccccgggc 420

gccgtgaacg cctgccacct ctcctgctcc gccctcctcc aggacaacat cgccgacgcc 480

gtggcctgcg ccaagcgcgt ggtgcgcgac ccgcagggca tccgcgcctg ggtggcctgg 540

cgcaaccgct gccagaaccg cgacgtgcgc cagtacgtgc agggctgcgg cgtg 594

<210> 5

<211> 198

<212> PRT

<213> Unknown (Unknown)

<400> 5

Asn Ser Asp Ser Glu Cys Pro Leu Ser His Asp Gly Tyr Cys Leu His

1 5 10 15

Asp Gly Val Cys Met Tyr Ile Glu Ala Leu Asp Lys Tyr Ala Cys Asn

20 25 30

Cys Val Val Gly Tyr Ile Gly Glu Arg Cys Gln Tyr Arg Asp Leu Lys

35 40 45

Trp Trp Glu Leu Arg Glu Ala Ala Ala Lys Glu Ala Ala Ala Lys Glu

50 55 60

Ala Ala Ala Lys Lys Val Phe Glu Arg Cys Glu Leu Ala Arg Thr Leu

65 70 75 80

Lys Arg Leu Gly Met Asp Gly Tyr Arg Gly Ile Ser Leu Ala Asn Trp

85 90 95

Met Cys Leu Ala Lys Trp Glu Ser Gly Tyr Asn Thr Arg Ala Thr Asn

100 105 110

Tyr Asn Ala Gly Asp Arg Ser Thr Asp Tyr Gly Ile Phe Gln Ile Asn

115 120 125

Ser Arg Tyr Trp Cys Asn Asp Gly Lys Thr Pro Gly Ala Val Asn Ala

130 135 140

Cys His Leu Ser Cys Ser Ala Leu Leu Gln Asp Asn Ile Ala Asp Ala

145 150 155 160

Val Ala Cys Ala Lys Arg Val Val Arg Asp Pro Gln Gly Ile Arg Ala

165 170 175

Trp Val Ala Trp Arg Asn Arg Cys Gln Asn Arg Asp Val Arg Gln Tyr

180 185 190

Val Gln Gly Cys Gly Val

195

<210> 6

<211> 198

<212> PRT

<213> Unknown (Unknown)

<400> 6

Asn Ser Asp Ser Glu Cys Pro Leu Ser His Asp Gly Tyr Cys Leu His

1 5 10 15

Asp Gly Val Cys Met Tyr Ile Glu Ala Leu Asp Lys Tyr Ala Cys Asn

20 25 30

Cys Val Val Gly Tyr Ile Gly Glu Arg Cys Gln Tyr Arg Asp Leu Lys

35 40 45

Trp Trp Glu Leu Arg Gly Gly Gly Gly Ser Gly Gly Gly Ser Ala Pro

50 55 60

Ala Pro Ala Pro Lys Val Phe Glu Arg Cys Glu Leu Ala Arg Thr Leu

65 70 75 80

Lys Arg Leu Gly Met Asp Gly Tyr Arg Gly Ile Ser Leu Ala Asn Trp

85 90 95

Met Cys Leu Ala Lys Trp Glu Ser Gly Tyr Asn Thr Arg Ala Thr Asn

100 105 110

Tyr Asn Ala Gly Asp Arg Ser Thr Asp Tyr Gly Ile Phe Gln Ile Asn

115 120 125

Ser Arg Tyr Trp Cys Asn Asp Gly Lys Thr Pro Gly Ala Val Asn Ala

130 135 140

Cys His Leu Ser Cys Ser Ala Leu Leu Gln Asp Asn Ile Ala Asp Ala

145 150 155 160

Val Ala Cys Ala Lys Arg Val Val Arg Asp Pro Gln Gly Ile Arg Ala

165 170 175

Trp Val Ala Trp Arg Asn Arg Cys Gln Asn Arg Asp Val Arg Gln Tyr

180 185 190

Val Gln Gly Cys Gly Val

195

<210> 7

<211> 159

<212> DNA

<213> Unknown (Unknown)

<400> 7

aacagcgaca gcgagtgccc gctgagccac gacggctact gcctgcacga cggcgtgtgc 60

atgtacatcg aggccctgga caagtacgcc tgcaactgcg tggtgggcta catcggcgag 120

aggtgccagt acagggacct gaagtggtgg gagctgagg 159

<210> 8

<211> 390

<212> DNA

<213> Unknown (Unknown)

<400> 8

aaggtgttcg agcgctgcga gctggcccgc accctcaagc gcctcggcat ggacggctac 60

cgcggcatct ccctcgccaa ctggatgtgc ctcgccaagt gggagtccgg ctacaacacc 120

cgcgccacca actacaacgc cggcgaccgc tccaccgact acggcatctt ccagatcaac 180

tcccgctact ggtgcaacga cggcaagacc ccgggcgccg tgaacgcctg ccacctctcc 240

tgctccgccc tcctccagga caacatcgcc gacgccgtgg cctgcgccaa gcgcgtggtg 300

cgcgacccgc agggcatccg cgcctgggtg gcctggcgca accgctgcca gaaccgcgac 360

gtgcgccagt acgtgcaggg ctgcggcgtg 390

<210> 9

<211> 1606

<212> DNA

<213> Unknown (Unknown)

<400> 9

ctcgagaaca atggcggcga ccatggcgtc caacgctgcg gctgcggctg cggtgtccct 60

ggaccaggcc gtggctgcgt cggcagcgtt ctcgtcgcgg aagcagctgc ggctgcctgc 120

cgcagcgcgc ggagggatgc gggtgcgggt gcgggcgcgg ggtcggcggg aggcggtggt 180

ggtggcgtcc gcgtcgtcgt cgtcggtggc agcgccggcg gcgaaggctg agatgctaca 240

cggtgcaagc agccggccgg caaccgctcg caaatcttcc ggcctttcgg gaacggtcag 300

gattccgggc gataagtcca tatcccaccg gtcgttcatg ttcggcggtc ttgccagcgg 360

tgagacgcgc atcacgggcc tgcttgaagg tgaggacgtg atcaataccg ggaaggccat 420

gcaggctatg ggagcgcgta tccgcaagga aggtgacaca tggatcattg acggcgttgg 480

gaatggcggt ctgctcgccc ctgaggcccc tctcgacttc ggcaatgcgg cgacgggctg 540

caggctcact atgggactgg tcggggtgta cgacttcgat agcacgttca tcggagacgc 600

ctcgctcaca aagcgcccaa tgggccgcgt tctgaacccg ttgcgcgaga tgggcgtaca 660

ggtcaaatcc gaggatggtg accgtttgcc cgttacgctg cgcgggccga agacgcctac 720

cccgattacc taccgcgtgc caatggcatc cgcccaggtc aagtcagccg tgctcctcgc 780

cggactgaac actccgggca tcaccacggt gatcgagccc atcatgacca gggatcatac 840

cgaaaagatg cttcaggggt ttggcgccaa cctgacggtc gagacggacg ctgacggcgt 900

caggaccatc cgccttgagg gcaggggtaa actgactggc caagtcatcg atgttccggg 960

agacccgtcg tccacggcct tcccgttggt tgcggcgctg ctcgtgccgg ggagtgacgt 1020

gaccatcctg aacgtcctca tgaacccgac caggaccggc ctgatcctca cgcttcagga 1080

gatgggagcc gacatcgagg tgatcaaccc gcgcctggca ggcggtgaag acgttgcgga 1140

tctgcgcgtg cgctcctcta ccctgaaggg cgtgacggtc ccggaagatc gcgcgccgtc 1200

catgatagac gagtatccta ttctggccgt cgccgctgcg ttcgccgaag gggccacggt 1260

catgaacggt cttgaggaac tccgcgtgaa ggaatcggat cgcctgtcgg cggtggccaa 1320

tggcctgaag ctcaacggtg ttgactgcga cgagggtgag acctcactcg tggtccgtgg 1380

ccggcctgat ggcaagggcc tcggcaacgc cagtggagcg gccgtcgcca cgcacctcga 1440

tcatcgcatc gcgatgtcct tcttggtgat gggtctcgtc tcagagaacc cggtgaccgt 1500

cgatgacgcc acgatgatag cgacgagctt cccagagttc atggatctga tggcgggcct 1560

cggggccaag atcgaactgt ctgacacgaa ggccgcttga ctcgag 1606

<210> 10

<211> 985

<212> DNA

<213> Unknown (Unknown)

<400> 10

aagcttaaag gtgccgtgca gttcaaacaa ttagttagca gtagggtgtt ggtttttgct 60

cacagcaata agaagttaat catggtgtag gcaacccaaa taaaacacca aaatatgcac 120

aaggcagttt gttgtattct gtagtacaga caaaactaaa agtaatgaaa gaagatgtgg 180

tgttagaaaa ggaaacaata tcatgagtaa tgtgtgagca ttatgggacc acgaaataaa 240

aagaacattt tgatgagtcg tgtatcctcg atgagcctca aaagttctct caccccggat 300

aagaaaccct taagcaatgt gcaaagtttg cattctccac tgacataatg caaaataaga 360

tatcatcgat gacatagcaa ctcatgcatc atatcatgcc tctctcaacc tattcattcc 420

tactcatcta cataagtatc ttcagctaaa tgttagaaca taaacccata agtcacgttt 480

gatgagtatt aggcgtgaca catgacaaat cacagactca agcaagataa agcaaaatga 540

tgtgtacata aaactccaga gctatatgtc atattgcaaa aagaggagag cttataagac 600

aaggcatgac tcacaaaaat tcatttgcct ttcgtgtcaa aaagaggagg gctttacatt 660

atccatgtca tattgcaaaa gaaagagaga aagaacaaca caatgctgcg tcaattatac 720

atatctgtat gtccatcatt attcatccac ctttcgtgta ccacacttca tatatcatga 780

gtcacttcat gtctggacat taacaaactc tatcttaaca tttagatgca agagccttta 840

tcccactata aatgcacgat gatttctcat tgtttctcac aaaaagcatt cagttcatta 900

gtcctacaac aacatggcat ccataaatcg ccccatagtt ttcttcacag tttgcttgtt 960

cctcttgtgc gatggctccc tagcc 985

<210> 11

<211> 302

<212> DNA

<213> Unknown (Unknown)

<400> 11

tgataagagc tcattacagg tgaccagctc gaatttcccc gatcgttcaa acatttggca 60

ataaagtttc ttaagattga atcctgttgc cggtcttgcg atgattatca tataatttct 120

gttgaattac gttaagcatg taataattaa catgtaatgc atgacgttat ttatgagatg 180

ggtttttatg attagagtcc cgcaattata catttaatac gcgatagaaa acaaaatata 240

gcgcgcaaac taggataaat tatcgcgcgc ggtgtcatct atgttactag atcgggggta 300

cc 302

Claims

1. An epidermal growth factor-lysozyme fusion protein is characterized in that the fusion protein is formed by connecting epidermal growth factor EGF and lysozyme LYZ by using a connecting peptide.

2. The EGF-lysozyme fusion protein of claim 1, wherein the EGF nucleotide sequence is set forth in SEQ ID No. 7.

3. The epidermal growth factor-lysozyme fusion protein of claim 1, wherein the lysozyme LYZ nucleotide sequence is represented by SEQ ID No. 8.

4. The epidermal growth factor-lysozyme fusion protein of claim 1, wherein the connecting peptide has the amino acid sequence shown as SEQ ID No.1 or SEQ ID No. 2.

5. The epidermal growth factor-lysozyme fusion protein of claim 1, wherein when the amino acid sequence of the linker peptide is represented by SEQ ID No.1, the amino acid sequence of the epidermal growth factor-lysozyme fusion protein is represented by SEQ ID No. 5.

6. The epidermal growth factor-lysozyme fusion protein of claim 1, wherein when the amino acid sequence of the linker peptide is represented by SEQ ID No.2, the amino acid sequence of the epidermal growth factor-lysozyme fusion protein is represented by SEQ ID No. 6.

7. An expression vector comprising the gene encoding epidermal growth factor-lysozyme fusion protein of claim 1.

8. The use of the EGF-lysozyme fusion protein of claim 1 for increasing the expression level of EGF in plants.

9. Use according to claim 8, characterized in that the plants comprise rice, maize, soybean, tomato, cucumber.

10. Use of an epidermal growth factor-lysozyme fusion protein according to claim 1, for the preparation of a medicament for the treatment of ulcers or/and for wound healing.