CN113201556B - pSOY19-ZM2 vector, preparation method and application thereof - Google Patents

Abstract

The invention relates to the technical field of transgenic soybeans and discloses a pSOY19-ZM2 vector, wherein the pSOY19-ZM2 vector is formed by connecting a green tissue specific promoter PGmCRB1 and a pSOY19 vector with a 35S promoter cut off; also discloses a preparation method of the carrier; also discloses the application of the carrier. The vector of the invention uses the specific promoter of the green tissue of the soybean to start the expression of the herbicide-resistant gene G10-EPSPS gene, so that the herbicide-resistant protein is expressed in the green tissue of soybean leaves and the like, and is low-expressed or zero-expressed in the seeds, thereby reducing the public worry about the safety of transgenic soybeans, improving the acceptance of the public to the transgenic soybeans, simultaneously improving the herbicide-resistant capability of the soybeans and improving the yield of the soybeans.

Description

pSOY19-ZM2 vector, preparation method and application thereof

Technical Field

The invention relates to the technical field of transgenic soybean, and particularly relates to a pSOY19-ZM2 vector, and a preparation method and application thereof.

Background

Soybean (GLycine max. Merr.) is an important protein source for oil crops and people, and is of great significance in agricultural production. In the process of soybean growth, the yield and quality of soybeans are seriously influenced by diseases, pests and weeds, and compared with the production of soybeans in foreign countries, the soybean production competitiveness in China is very weak, more than 85 percent of soybeans depend on import, and the soybean is a neck-clamped problem. Therefore, it is urgently needed to improve the yield and quality of soybeans in China and improve the international competitiveness of soybean production by breeding high-quality resistant strains.

The previously obtained herbicide-resistant transgenic soybeans are all constitutively expressed, namely EPSPS protein is accumulated in the generated transgenic soybean seeds, and the accumulated amount is high, so that the public cannot fully accept the edible safety of the transgenic soybeans, therefore, the pSOY19-ZM2 vector, the preparation method and the application thereof are developed by the inventor, and the content of the herbicide-resistant protein in the seeds is reduced under the condition of ensuring high-efficiency herbicide resistance.

Disclosure of Invention

Based on the above problems, the present invention provides a pSOY19-ZM2 vector, a preparation method and an application thereof, wherein the herbicide-resistant protein is expressed in green tissues such as leaves of soybean, and is low or zero expressed in seeds.

In order to solve the above technical problems, the present invention provides a pSOY19-ZM2 vector, wherein the pSOY19-ZM2 vector is formed by connecting a green tissue specific promoter PGmCRB1 and a pSOY19 vector from which a 35S promoter is excised.

In order to solve the above technical problems, the present invention also provides a method for preparing a carrier, comprising the steps of:

s1: PCR amplification is carried out on the 2171bp promoter sequence at the upstream of the initiation codon of the GmCRB1 gene, and amplification primers are as follows:

PGmCRB1-F：

cccgggtaccgagctcGAATTCTCTTATAATAACCCTGTTAAC，

PGmCRB1-R：

gagagaactggtgatgaattcgtttccacacagtgc; obtaining an amplified PGmCRB1 fragment for later use;

s2: cutting off the 35S promoter in the plant expression vector pSOY19 vector by EcoRI and NcoI double enzymes for later use;

s3: and (3) connecting the PGmCRB1 fragment in the step S1 with the pSOY19 vector with 35S cut out in the step S2 to obtain the pSOY19-ZM2 vector.

In order to solve the technical problems, the invention also provides the application of the carrier in the products for increasing the herbicide resistance of the soybeans and reducing the content of herbicide-resistant protein in the soybean seeds.

Compared with the prior art, the invention has the beneficial effects that: the vector of the invention uses the specific promoter of the green tissue of the soybean to start the expression of the herbicide-resistant gene G10-EPSPS gene, so that the herbicide-resistant protein is expressed in the green tissue of soybean leaves and the like, and is low-expressed or zero-expressed in the seeds, thereby reducing the public worry about the safety of transgenic soybeans, improving the acceptance of the public to the transgenic soybeans, simultaneously improving the herbicide-resistant capability of the soybeans and improving the yield of the soybeans.

Drawings

FIG. 1 is a map of the pSOY19-ZM2 vector of the present invention;

FIG. 2 is a diagram showing the results of PCR identification of the G10-EPSPS gene of the T0 generation of the transformed strain pSOY19-ZM2 according to an embodiment of the present invention;

FIG. 3 is a graph showing the results of a T0 generation G10-EPSPS protein rapid test strip of a pSOY19-ZM2 transformation strain in an example of the present invention;

FIG. 4 is a diagram showing the results of PCR identification of the G10-EPSPS gene from T1 generation plants of the pSOY19-ZM2 transformation line of the example of the present invention.

Detailed Description

In order to make the objects, technical solutions and advantages of the present invention more apparent, the present invention is further described in detail below with reference to examples and accompanying drawings, and the exemplary embodiments and descriptions thereof are only used for explaining the present invention and are not meant to limit the present invention.

The embodiment is as follows:

in this example, pSOY19-ZM2 vector was first constructed, pSOY19-ZM2 vector can increase the herbicide resistance of soybean and decrease the amount of herbicide resistant protein in soybean seeds, and pSOY19-ZM2 vector can be used in products that increase the herbicide resistance of soybean and decrease the amount of herbicide resistant protein in soybean seeds.

In this example, a 2171bp promoter sequence upstream of the initiation codon of the GmCRB1 gene was subjected to PCR amplification using the following amplification primers:

PGmCRB1-F：

cccgggtaccgagctcGAATTCTCTTATAATAACCCTGTTAAC，

PGmCRB1-R：

gagagaactggtgatgaattcgtttccacacagtgc; obtaining the amplified PGmCRB1 fragment, wherein the nucleotide sequence of the PGmCRB1 is shown in SEQ ID NO:1, standby; cutting 35S promoter in the plant expression vector pSOY19 vector by EcoRI and NcoI; the PGmCRB1 fragment was then ligated with the pSOY19 vector from which the 35S promoter was excised, using a seamlessly assembled enzyme, available from Novomedium, to finally obtain the pSOY19-ZM2 vector, the nucleotide sequence of which is shown in SEQ ID NO:2.

the pSOY19-ZM2 vector map is shown in FIG. 1, the pSOY19-ZM2 vector has a full length of 4508bp from the right Border (T-Border-RB) to the left Border (T-Border-LB) of the T-DNA region, which is composed of 3 parts except for the multiple cloning site: 1) A promoter (PGmCRB 1) which produces green tissue-specific expression in plants, a signal peptide Ch-L from Arabidopsis thaliana which directs the transport of the protein encoded by its same expression cassette into the chloroplasts (sequence as described previously); 2) The G10-EPSPS glyphosate-tolerant gene from Deinococcus radiodurans R1 (sequence as described above), which is in frame with Ch-L; 3) A terminator of the CaMV35S gene; LB and RB are boundaries of T-DNA. The information on the names, sizes and functions of the various elements in the pSOY19-ZM2 vector is shown in the following table:

information Table of various elements in the pSOY19-ZM2 vector

To verify the success of the construction of the pSOY19-ZM2 vector, the pSOY19-ZM2 vector was transformed into Agrobacterium strain LBA4404 by cold shock and genetic transformation of soybean Williams 82 was performed with Agrobacterium carrying the pSOY19-ZM2 vector plasmid.

The pSOY19-ZM2 vector was transformed into Agrobacterium LBA4404 by cold shock:

(1) Preparation of Agrobacterium Strain LBA4404 competent cells

Selecting a single colony of Agrobacterium LBA4404, inoculating the single colony into 3mL YEP liquid culture medium, and performing shake culture at 220rpm and 28 ℃ to OD ₆₀₀ Is approximately equal to 0.5, 0.5mL of bacterial liquid is absorbed and inoculated in 50mL of YEP culture medium, and the shaking culture is carried out at 300rpm and 30 ℃ until OD is reached ₆₀₀ Approximately closing to 1.0, and carrying out ice bath for 10min;3000g at 4 ℃ ionCentrifuging for 10min, discarding supernatant, adding 50mL of pre-cooled sterile 10% glycerol, resuspending the precipitate, adding sterile 10% glycerol to 500mL, centrifuging at 3000g and 4 deg.C for 10min, and discarding supernatant; repeating the above washing steps once; resuspending the cell pellet in 25mL of pre-cooled sterile 10% glycerol, centrifuging at 3000g4 deg.C for 5min, discarding the supernatant, and resuspending the cell pellet in 0.5mL of pre-cooled sterile 10% glycerol to give a cell concentration of 5 × 10 ¹⁰ Obtaining agrobacterium tumefaciens competent cells per milliliter, and subpackaging 100 mu L of competent cells per tube at the temperature of-70 ℃ for cryopreservation;

(2) Transforming agrobacterium tumefaciens competent cells by a cold shock method: 400ng of the above pSOY19-ZM2 vector plasmid was added to a centrifuge tube, and the mixture was placed on ice for 5 minutes, liquid nitrogen-quenched, coagulated, placed in a 37 ℃ water bath, and placed on ice for 5 minutes, 0.5mL of YEP broth was added thereto for 2 minutes, and shaking-cultured at 250rpm and 28 ℃ for 4 hours, and the broth was applied to a YEP solid medium containing 50mg/L of kanamycin and 50mg/L of streptomycin and cultured at 28 ℃ for 2 days to obtain recombinant Agrobacterium harboring the pSOY19-ZM2 expression vector.

Preparing a transgenic explant: the seed of the soybean Williams 82 is disinfected by chlorine, and the specific method comprises the following steps: placing the seeds in a single layer in a culture dish of 90mm, pouring 100mL of disinfectant (adding 3.5mL of 12N concentrated hydrochloric acid into 10% bleaching water), and sealing for disinfection overnight; opening the culture dish in a super clean bench the next day, and blowing for 30min to remove the redundant chlorine; the soybean explant for transgenosis is cotyledonary node, and the specific preparation process is as follows: adding sterilized soybean seeds into sterile deionized water, and soaking the seeds overnight at room temperature in the dark; taking out the seed from the culture dish, removing excessive water on the surface, separating cotyledon and seed coat longitudinally along the hilum with a scalpel, and removing embryo at the joint of cotyledon node.

Activating agrobacterium: the recombinant Agrobacterium carrying the pSOY19-ZM2 expression vector prepared above was inoculated into YEP solid medium supplemented with 50mg/L kanamycin +25mg/L streptomycin, cultured at 28 ℃ for 2 days, then inoculated into 2mL YEP liquid medium containing 50mg/L kanamycin +25mg/L streptomycin, cultured with shaking at 28 ℃ and 250rpm for 1 day, from which 0.25mL was inoculated into 250mL YEP liquid medium containing 50mg/L kanamycin +25mg/L streptomycin, at 28 ℃ and 250rpm shake culture to OD ₆₅₀ =0.8-1.0, centrifuging the bacterial liquid at 4000rpm for 10min at room temperature, collecting the bacterial pellet, suspending in 25mL multiplied by 5 tube infection culture medium to make the final density of the bacterial reach 0.5 multiplied by 10 ⁸ cell/mL to obtain agrobacterium infection solution; before use, the agroinfection liquid is shaken for more than 30min at the temperature of 28 ℃ and the speed of 60 rpm.

And (3) agrobacterium infection: about 60 soybean explants treated by the method are placed in a 90mm culture dish, 30mL of agrobacterium-mediated staining solution is added to completely immerse the explants in the liquid, and the explants are placed at room temperature for 20-30 minutes and often gently shaken.

Co-culturing agrobacterium with explants: after the agrobacterium infection is completed, the seeds are placed on sterile filter paper with the ventral side facing upwards to suck dry the bacterial liquid, then the half-seed explants are transferred to a culture dish containing a co-culture medium (after the culture medium is solidified in the culture dish, the surface is covered with a layer of sterile filter paper), and the ventral side contacts the filter paper downwards. The culture dish was sealed with a sealing film, and cultured at 24 ℃ under 1400Lux for 16 hours of light/8 hours of dark environment for 3-5 days.

And (3) bud induction culture: after the co-culture stage is finished, taking out the seeds from the co-culture medium, placing the seeds on a sterile paper towel to suck redundant liquid, then placing the seeds into a bud induction medium, enabling cotyledonary nodes to enter the medium and form an angle of 30-45 degrees with the surface, and enabling a regeneration area to be flush with the surface of the medium; the explants were cultured in a 16-hour light/8-hour dark environment at 24 ℃ for 14 days, and then subcultured once in a shoot induction medium, shoots growing from cotyledonary nodes and apices were excised, the hypocotyls were trimmed to 3 mm long, the newly generated wounds were placed in a shoot induction medium with the meristematic region flush with the medium surface, and culture was continued for 14 days, and after two weeks, subcultured once again in the same medium.

Bud elongation culture and rooting: transferring the explant formed by the existing buds subjected to secondary transfer twice into a bud elongation culture medium, carrying out secondary transfer once every two weeks, and horizontally cutting a new plane at the base part of a bud pad every time so as to be beneficial to absorption of nutrients in the culture medium; when the length of the grown buds reaches more than 3 cm, the buds are cut off from the bud pad and transferred to a rooting culture medium, the bud base is inserted into the culture medium to be 0.5 cm deep, and the buds are cultured for 1 to 2 weeks at 24 ℃ under 16-hour illumination/8-hour.

Planting of transgenic seedlings: when more than 2 roots grow out from the buds in the rooting culture medium, gently taking out the seedlings from the rooting culture medium, washing off the redundant culture medium by using tap water, transplanting the seedlings into small pot soil, covering the tops of the seedlings for moisturizing, and hardening the seedlings for at least 1 week in an environment of 16 hours at 24 ℃ and 8 hours; when the seedlings grow at least two three compound leaves, transplanting the seedlings into a large pot, and placing the large pot in a greenhouse for culturing to obtain PGmCRB1: G10-EPSPS transgenic soybean.

The formulation of the various media used in the transgenic process was as follows:

YEP liquid medium composition: 5g/L yeast extract, 10g/L tryptone and 5g/L sodium chloride, and adjusting the pH value to 7.0, wherein the solvent is deionized water.

YEP solid medium is YEP liquid medium added with 12g/L bacterial agar.

B5 macroelements: KNO3 2500mg/L, mgSO4 & 7H2O2 50mg/L, caCl2 & 2H2O150mg/L, (NH 4) 2SO4 134mg/L, naH2PO4 & H2O150 mg/L.

B5, trace elements: KI 0.75mg/L, H3BO 3.0mg/L, mnSO4 & 4H2O 10mg/L, znSO4 & 7H2O 2.0mg/L, na2MoO4 & 2H2O 0.25mg/L, coCL2 & 6H2O 0.025mg/L, and CuSO4 & 5H2O 0.025mg/L.

MS macroelements: NH4NO3 1650mg/L, KNO3 1900mg/L, mgSO4 & 7H2O2 370mg/L, caCl2 & 2H2O440mg/L, KH2PO4 & H2O 170mg/L.

MS trace elements: KI 0.83mg/L, H3BO 3.2 mg/L, mnSO4 & 4H2O 22.3mg/L, znSO4 & 7H2O 8.6mg/L, na2MoO4 & 2H2O 0.25mg/L, coCL2 & 6H2O 0.025mg/L, and CuSO4 & 5H2O 0.025mg/L.

B5, iron salt: na disodium ethylenediamine tetraacetate (Na 2-EDTA) 37.3mg/L and FeSO4 & 7H2O 27.8mg/L.

B5 vitamin mixed liquor: 100mg/L inositol, 1.0mg/L nicotinic acid, 1.0mg/L pyridoxine hydrochloride and 10mg/L thiamine hydrochloride.

The infection culture medium comprises the following components: macroelement 1/10 B5, microelement 1/10 B5, vitamin 1/10 mixed solution 1/10 B5, iron salt 1/10 B5, sucrose 30g/L, 2- (N-morpholino) ethanesulfonic acid (MES) 3.9g/L and deionized water as solvent, pH 5.4, filtering sterilized gibberellin (GA 3,0.25 mg/L), benzylaminopurine (BAP, 1.67 mg/L) and acetosyringone 40mg/L after autoclaving and cooling.

Co-culture medium composition: 1/10 B5 major elements, 1/10 B5 trace elements, 1/10 B5 vitamin mixed solution, 1/10 B5 ferric salt, 30g/L sucrose, 3.9g/L MES,4.25g/L agar and deionized water as a solvent, wherein the pH is 5.4. After autoclaving, suction-filtered and sterilized GA3 (0.25 mg/L), BAP 1.67mg/L, cysteine 400mg/L, dithiothreitol 154.2mg/L,40mg/L acetosyringone were added.

Shoot induction medium composition: 1X B5 bulk salt, 1X B5 trace element, 1X B5 vitamin mixed solution, 1XB5 ferric salt, 30g/L sucrose, 0.59g/L MES,7g/L agar, deionized water as solvent and pH 5.7. The components are sterilized at high pressure and cooled, and then 1.11mg/L of BAP sterilized by suction filtration, 50mg/L of timentin, 100mg/L of cefotaxime and 5mg/L of glyphosate are added.

Composition of shoot elongation medium: 1X MS of a large amount of salt, 1X MS of trace elements, 1X B5 vitamin mixed liquor, 1XB5 iron salt, 30g/L of sucrose, 0.59g/L of MES,7g/L of agar and deionized water as a solvent, wherein the pH value is 5.7. After autoclaving and cooling, adding 50mg/L of asparagine, 50mg/L of glutamine, 100 mu g/L of auxin (IAA), 500 mu g/L of gibberellin (GA 3), 1mg/L of zeatin, 50mg/L of timentin, 100mg/L of cefotaxime and 5mg/L of glyphosate which are sterilized by suction filtration.

The composition of the rooting medium is as follows: 1XMS mass salt, 1XMS trace element, 1X B5 vitamin mixed solution, 1XB5 ferric salt, 30g/L sucrose, 0.59g/L MES,7g/L agar, deionized water as solvent and pH 5.7. After autoclaving and cooling, 50mg/L asparagine and 50mg/L glutamine were added.

Next, this example performed genetic identification of the obtained transgenic soybean plants.

Identifying a pSOY19-ZM2 vector transgenic plant, and quickly extracting plant DNA: taking a proper amount of the obtained resistant transgenic soybean plant leaves (50 mg) in a 2mL centrifuge tube, adding 200 μ L of TPS extract (100 mM Tris-HCL,10mM EDTA,1M KCL, pH = 8.0), shaking and grinding, centrifuging at 65 ℃ in water bath for 20min and 12000rpm for 5min, transferring the supernatant to a new 1.5mL centrifuge tube, adding isopropanol with the same volume, reversing and mixing uniformly, standing at room temperature for 10min and 1 minCentrifuging at 2000rpm for 5min, discarding supernatant, adding 1mL 75% ethanol to wash precipitate, centrifuging at 3500rpm for 5min, discarding supernatant, standing at room temperature for 10min to evaporate ethanol, adding 30mL ddH ₂ And dissolving the precipitate by using O.

And (3) PCR identification: mu.L of the above DNA solution was taken as a template, and G10-EPSPS gene-specific primers G10-EPSPS-F (5-prime TCTAAGGTCATCGGAGGCAGTAGCT-3') and G10-EPSPS-R (5-prime TAGAGCAGCCATCCAAGACTAC-3') were subjected to PCR amplification at an annealing temperature of 57 ℃ for 3 minutes, at 94 ℃ for 30 seconds, at 57 ℃ for 30 seconds, at 72 ℃ for 30 seconds, for 32 cycles, at 72 ℃ for 10 minutes, while transgenic Wilms 82 genomic DNA of soybean was used as a negative control and the size of the target PCR product obtained by amplification with the above gene-specific primers was 604bp.

Referring to FIG. 2, FIG. 2 shows the results of PCR detection of T0 generation G10-EPSPS of soybean transformant pSOY19-ZM2 vector transformant, wherein #2 is pSOY19-ZM2 vector transformant, #1, #3-4 are other vector strains, +: positive control, -: negative control, results show that the pSOY19-ZM2 vector successfully transforms soybean.

See FIG. 4, in which FIG. 4 is a diagram showing the results of PCR identification of T1 generation plants of the pSOY19-ZM2 transformation line, wherein the positive strains: 2,+: positive control, -: negative control; the results show that the pSOY19-ZM2 vector successfully transforms soybean.

The G10-EPSPS gene sequence is as follows:

GAGAAGGGATCCGACGCTCTTCCAGCTACCTTCGACGTTATCGTGCATCCAGCTAGAGAACTCAGAGGTGAACTTAGAGCACAGCCATCCAAGAACTACACCACTAGATACCTCCTCGCCGCTGCTCTCGCTGAGGGTGAAACCAGAGTTGTTGGTGTGGCTACCTCTGAGGATGCCGAAGCTATGCTCAGATGCCTCAGAGATTGGGGTGCTGGTGTTGAGCTTGTTGGTGATGACGCCGTGATCAGAGGTTTCGGTGCTAGACCACAGGCTGGTGTTACCCTTAACCCAGGTAACGCTGCTGCGGTGGCCAGACTCCTTATGGGTGTTGCTGCTCTCACCTCTGGTACAACTTTCGTTACCGATTACCCTGATTCCCTTGGTAAGAGACCTCAGGGTGACCTTCTTGAAGCCCTCGAAAGACTTGGTGCTTGGGTGTCCTCCAACGATGGTAGACTCCCTATCTCCGTTTCCGGTCCAGTTAGAGGTGGTACAGTGGAGGTTTCCGCCGAAAGATCCTCCCAGTACGCTTCCGCCCTTATGTTCCTCGGTCCTCTTCTTCCTGACGGACTCGAACTTAGACTCACCGGTGATATCAAGTCCCACGCTCCTCTTAGACAGACACTTGACACCCTCTCTGATTTCGGTGTTAGAGCTACTGCCTCCGATGACCTTAGAAGAATCTCCATCCCTGGTGGTCAGAAGTACAGACCAGGTAGAGTGCTCGTTCCTGGTGATTACCCTGGTTCCGCTGCTATCCTTACCGCCGCTGCTCTTCTCCCAGGTGAGGTTAGACTTTCTAACCTTAGAGAACACGACCTCCAGGGTGAGAAGGAAGCTGTGAACGTTCTTAGAGAGATGGGTGCTGATATCGTTAGAGAAGGTGATACCCTTACCGTGAGAGGTGGTAGACCTCTCCACGCTGTTACTAGAGATGGTGATTCCTTCACCGACGCCGTGCAAGCTCTTACCGCTGCTGCTGCCTTCGCTGAGGGTGATACCACCTGGGAAAACGTTGCTACTCTTAGACTCAAGGAATGCGATAGAATCTCTGACACCAGAGCTGAGCTTGAAAGACTTGGTCTTAGAGCAAGAGAGACCGCCGATTCTCTCTCCGTTACTGGTTCTGCTCACCTTGCTGGTGGTATCACCGCTGATGGTCACGGTGACCACAGAATGATCATGCTTCTCACCCTTCTTGGTCTCAGAGCAGATGCTCCACTTAGAATCACCGGTGCACACCACATCAGAAAGTCCTACCCTCAGTTCTTCGCTCACCTTGAAGCTCTTGGTGCTAGATTCGAATACGCTGAGGCTACCGCC。

and (3) identifying the G10-EPSPS protein rapid test strip: a proper amount of the obtained resistant transgenic soybean plant leaves (50 mg) is put into a 2mL centrifuge tube, 200 mu L of TPS extracting solution (100 mM Tris-HCL,10mM EDTA,1M KCL, pH = 8.0) is added and then shaken and ground, the lower end of a G10-EPSPS protein quick test strip is inserted below the liquid level, meanwhile, soybean Williams 82 is used as a negative control, and a transgenic strain ZU33 before a laboratory is used as a positive control. The results were observed after 5 minutes and recorded by photography, and are shown in FIG. 3, FIG. 3 is a graph of the results of the G10-EPSPS protein rapid test strip, in which #2 is the pSOY19-ZM2 transformant, #1, #3, #4 are other vector strains, +: positive control, -: negative control, results show that pSOY19-ZM2 vector transgenic plants are successfully transformed.

The amino acid sequence of the coded herbicide-resistant protein G10-EPSPS is as follows:

EKGSDALPATFDVIVHPARELRGELRAQPSKNYTTRYLLAAALAEGETRVVGVATSEDAEAMLRCLRDWGAGVELVGDDAVIRGFGARPQAGVTLNPGNAAAVARLLMGVAALTSGTTFVTDYPDSLGKRPQGDLLEALERLGAWVSSNDGRLPISVSGPVRGGTVEVSAERSSQYASALMFLGPLLPDGLELRLTGDIKSHAPLRQTLDTLSDFGVRATASDDLRRISIPGGQKYRPGRVLVPGDYPGSAAILTAAALLPGEVRLSNLREHDLQGEKEAVNVLREMGADIVREGDTLTVRGGRPLHAVTRDGDSFTDAVQALTAAAAFAEGDTTWENVATLRLKECDRISDTRAELERLGLRARETADSLSVTGSAHLAGGITADGHGDHRMIMLLTLLGLRADAPLRITGAHHIRKSYPQFFAHLEALGARFEYAEATA。

determining the content of G10-EPSPS protein in the pSOY19-ZM2 vector transgenic plant, and determining the content of herbicide-resistant protein in the pSOY19-ZM2 vector transgenic plant by using a G10-EPSPS enzyme-linked immunosorbent assay quantitative detection kit (Shanghai Youlong Biotech limited): taking 0.05g of leaves, putting the leaves into a 1.5mL centrifuge tube for mashing, adding 0.5mL of sample extracting solution, uniformly mixing the sample extracting solution by oscillation for 5 minutes, centrifuging the mixture for 3 minutes at 4000rpm, and taking 100 mu L of supernatant for analysis; adding 100 mu L of sample extracting solution (blank control)/standard substance/sample into the corresponding micropore, lightly shaking and uniformly mixing, and reacting for 45 minutes at 25 ℃ in a dark place; spin-drying the liquid in the holes, fully washing with 200 μ L/hole of washing working solution for 4-5 times at an interval of 10s each time, and patting dry with absorbent paper; adding 100 mu L/hole of enzyme-labeled working solution, lightly shaking and uniformly mixing, reacting for 30 minutes at 25 ℃ in a dark place, and repeatedly washing the plate; adding 100 mu L of color developing agent/hole, and reacting for 15 minutes in a dark place at 25 ℃; adding 100 mu L of stop solution into each hole, slightly oscillating and uniformly mixing, setting the position of 450nm of an enzyme labeling instrument, measuring the OD value of each hole, and simultaneously measuring the content of the G10-EPSPS protein in the seeds, wherein the extraction method of the G10-EPSPS protein in the seeds is the same as the extraction method of the leaves.

The results of the quantitative analysis of G10-EPSPS protein of pSOY19-ZM2 are shown in the following table:

expression level of G10-EPSPS protein (μ G/G fresh weight) of different tissues at different periods

Data are shown as mean ± standard deviation ", notdetected: not detected; NA; no analysis was performed

From the results of quantitative analysis, in the T0 generation, the G10-EPSPS promoted by the promoter is highly expressed in leaves and is extremely low in expression amount in seeds.

The above is an embodiment of the present invention. The embodiments and specific parameters in the embodiments are only for the purpose of clearly illustrating the verification process of the invention and are not intended to limit the scope of the invention, which is defined by the claims, and all equivalent structural changes made by using the contents of the specification and the drawings of the present invention should be covered by the scope of the present invention.

Sequence listing

<110> Zhejiang university

<120> pSOY19-ZM2 vector, preparation method and application thereof

<130> 20201212

<160> 2

<170> SIPOSequenceListing 1.0

<210> 1

<211> 2171

<212> DNA

<213> PGmCRB1

<400> 1

tcttataata accctgttaa cccaaaaaac cccaatttac aggttgtaat ttgaaagcaa 60

caaatacaag aatgcagttt aaaatgcatc aataatcata atatcctaca aaggtatagt 120

ggcatctact gctttgacct ggatatcgtg acccaaccac aagagttgag gcctaatatc 180

gcccatcaca atgaacaatg aactctaaac acgtattgca tagaatcccc atatgagaaa 240

ccgatgctat cagataattt gctccgattt caactcttga agatgacata ttatttgtat 300

gttaataata taatgaatta atttatgttg ggagaatggt ggtaaattag agtgagcaag 360

tcctcacttg gagctgaaaa cttcagtatc tctttatttc cagcaataga ccccacctta 420

aaccaatatt attagcaatt tcagaagata tgatttcaag accatcaaca aactaaagta 480

cctatttggc atttggtaaa accaacaata tttgcaatac tgagggtcaa acaaactcca 540

acaactagga ggtaatcagc ttgaagcctt atgagtgaga atattgccag catagtccat 600

gcaactgcct ataaaagaat acacaaaaaa aattatttac cagagaccgt actttttggt 660

gaggggttat acaaaatgta agcaatggca gaacccaatg attctatgtc ctacctcccc 720

ctcccccctc ttttgatttt ccgaaaaata tcatgcatat tcaaaggata ttaagaaaaa 780

actggaatgc catcacatgc tctaatgtgt aaccaatcga tgttttctta ctgtaaggta 840

aagcgttcac cagaaaagcc atgaatcttt cttgttcatc cgggcgaatg actggaggaa 900

aaacaaacaa catatgtaag atgcaagtac cttcatagca tttggattgc aatcttatgc 960

aactcagaag agacattaca agacagagag ttaataattg attatttaaa aagtaagata 1020

acaacatgca agttgcaact gagcaaaaga agcaattcac acctgctgat caagacactc 1080

aaatttccaa acactctcac ccagatcatt gatttaattc caccacctca aaccaactaa 1140

aattctccca ctcgcattct tcactaacca aaaatcaaga gcggcaagaa ggacagtcat 1200

cacaaaaatg atgacaaagt tatcaataaa gagggcggag agaatgtaaa atgacaaagc 1260

cgcagcctgc cagacacaaa aactgaaaaa cgttacttat aagaataaag aattggcaaa 1320

tagagaatga tacgagatat tcaaacagtg caataaatta aactgaacct tgaagagaac 1380

atgaaagaag caagtatttg gattgtcata gttttcacgt acagagtaca atttgatgaa 1440

ttaacaatct aaacaaaggg aacaataata cgaacaaacc aacgaaatgg gccatgcata 1500

ttgctagccc atttttatga ggcatgtccg ctttaatttt ttttttgaca aaaatgactt 1560

tcccttaata tttttttaaa aagaaaaaaa gattcatttt gtgagggatt ttttcgtcaa 1620

aagaacagac agtgcgaaga gtaaaaagga aagtatatat agcaaggccc gatttatatt 1680

tttcttgata tcattatata tgggccgggc ccacctataa atgtttagtc tgtttttcac 1740

ttaccagacc cgaaagctat tgtactaatg actaatttat tatgatttgg tcttgtcttt 1800

ggtttgtgtt gttcttggct aggaatctca atcagaaaaa ttttcttgca taggcacaag 1860

tgtttccagt tacattcacg tcacatgagt agaggtgagc aatagtataa gtggtggaat 1920

tttatcttat aaaagaatga atggattaat aaacaaaaaa aaataaaaat gaatgaatgt 1980

tagagaggga gggaaatgag aggctgtgga tggaggtggg tcgttttctt atcataagca 2040

aagaagaggt ggggagttag ttagtttagt tgggtgaggg aaagaaaagc cacttcaaat 2100

ttcagcccca taccatactc attaaagtcc acacacacag agcaacactg cactgtgtgg 2160

aaacgaaaca c 2171

<210> 2

<211> 10741

<212> DNA

<213> pSOY19-ZM2

<400> 2

tcttataata accctgttaa cccaaaaaac cccaatttac aggttgtaat ttgaaagcaa 60

caaatacaag aatgcagttt aaaatgcatc aataatcata atatcctaca aaggtatagt 120

ggcatctact gctttgacct ggatatcgtg acccaaccac aagagttgag gcctaatatc 180

gcccatcaca atgaacaatg aactctaaac acgtattgca tagaatcccc atatgagaaa 240

ccgatgctat cagataattt gctccgattt caactcttga agatgacata ttatttgtat 300

gttaataata taatgaatta atttatgttg ggagaatggt ggtaaattag agtgagcaag 360

tcctcacttg gagctgaaaa cttcagtatc tctttatttc cagcaataga ccccacctta 420

aaccaatatt attagcaatt tcagaagata tgatttcaag accatcaaca aactaaagta 480

cctatttggc atttggtaaa accaacaata tttgcaatac tgagggtcaa acaaactcca 540

acaactagga ggtaatcagc ttgaagcctt atgagtgaga atattgccag catagtccat 600

gcaactgcct ataaaagaat acacaaaaaa aattatttac cagagaccgt actttttggt 660

gaggggttat acaaaatgta agcaatggca gaacccaatg attctatgtc ctacctcccc 720

ctcccccctc ttttgatttt ccgaaaaata tcatgcatat tcaaaggata ttaagaaaaa 780

actggaatgc catcacatgc tctaatgtgt aaccaatcga tgttttctta ctgtaaggta 840

aagcgttcac cagaaaagcc atgaatcttt cttgttcatc cgggcgaatg actggaggaa 900

aaacaaacaa catatgtaag atgcaagtac cttcatagca tttggattgc aatcttatgc 960

aactcagaag agacattaca agacagagag ttaataattg attatttaaa aagtaagata 1020

acaacatgca agttgcaact gagcaaaaga agcaattcac acctgctgat caagacactc 1080

aaatttccaa acactctcac ccagatcatt gatttaattc caccacctca aaccaactaa 1140

aattctccca ctcgcattct tcactaacca aaaatcaaga gcggcaagaa ggacagtcat 1200

cacaaaaatg atgacaaagt tatcaataaa gagggcggag agaatgtaaa atgacaaagc 1260

cgcagcctgc cagacacaaa aactgaaaaa cgttacttat aagaataaag aattggcaaa 1320

tagagaatga tacgagatat tcaaacagtg caataaatta aactgaacct tgaagagaac 1380

atgaaagaag caagtatttg gattgtcata gttttcacgt acagagtaca atttgatgaa 1440

ttaacaatct aaacaaaggg aacaataata cgaacaaacc aacgaaatgg gccatgcata 1500

ttgctagccc atttttatga ggcatgtccg ctttaatttt ttttttgaca aaaatgactt 1560

tcccttaata tttttttaaa aagaaaaaaa gattcatttt gtgagggatt ttttcgtcaa 1620

aagaacagac agtgcgaaga gtaaaaagga aagtatatat agcaaggccc gatttatatt 1680

tttcttgata tcattatata tgggccgggc ccacctataa atgtttagtc tgtttttcac 1740

ttaccagacc cgaaagctat tgtactaatg actaatttat tatgatttgg tcttgtcttt 1800

ggtttgtgtt gttcttggct aggaatctca atcagaaaaa ttttcttgca taggcacaag 1860

tgtttccagt tacattcacg tcacatgagt agaggtgagc aatagtataa gtggtggaat 1920

tttatcttat aaaagaatga atggattaat aaacaaaaaa aaataaaaat gaatgaatgt 1980

tagagaggga gggaaatgag aggctgtgga tggaggtggg tcgttttctt atcataagca 2040

aagaagaggt ggggagttag ttagtttagt tgggtgaggg aaagaaaagc cacttcaaat 2100

ttcagcccca taccatactc attaaagtcc acacacacag agcaacactg cactgtgtgg 2160

aaacgaaaca cgaattcatc accagtctct ctctacaaat ctatctctct cgagtcaaca 2220

caacatatac aaaacaaacg aatctcaagc aatcaagcat tctacttcta ttgcagcaat 2280

ttaaatcatt tcttttaaag caaaagcaat tttctgaaaa ttttcaccat ttacgaacga 2340

tagccatggc tcaagttagc agaatctgca atggtgtgca gaacccatct cttatctcca 2400

atctctctaa atccagtcaa aggaaatctc ccttatcggt ttctctgaag actcagcagc 2460

atccacgagc ttatccaatt tcttcatctt ggggattgaa gaagagtggg atgactttaa 2520

ttggctctga gcttcgtcct cttaaggtca tgtcttctgt ttccacggcg gagaagggat 2580

ccgacgctct tccagctacc ttcgacgtta tcgtgcatcc agctagagaa ctcagaggtg 2640

aacttagagc acagccatcc aagaactaca ccactagata cctcctcgcc gctgctctcg 2700

ctgagggtga aaccagagtt gttggtgtgg ctacctctga ggatgccgaa gctatgctca 2760

gatgcctcag agattggggt gctggtgttg agcttgttgg tgatgacgcc gtgatcagag 2820

gtttcggtgc tagaccacag gctggtgtta cccttaaccc aggtaacgct gctgcggtgg 2880

ccagactcct tatgggtgtt gctgctctca cctctggtac aactttcgtt accgattacc 2940

ctgattccct tggtaagaga cctcagggtg accttcttga agccctcgaa agacttggtg 3000

cttgggtgtc ctccaacgat ggtagactcc ctatctccgt ttccggtcca gttagaggtg 3060

gtacagtgga ggtttccgcc gaaagatcct cccagtacgc ttccgccctt atgttcctcg 3120

gtcctcttct tcctgacgga ctcgaactta gactcaccgg tgatatcaag tcccacgctc 3180

ctcttagaca gacacttgac accctctctg atttcggtgt tagagctact gcctccgatg 3240

accttagaag aatctccatc cctggtggtc agaagtacag accaggtaga gtgctcgttc 3300

ctggtgatta ccctggttcc gctgctatcc ttaccgccgc tgctcttctc ccaggtgagg 3360

ttagactttc taaccttaga gaacacgacc tccagggtga gaaggaagct gtgaacgttc 3420

ttagagagat gggtgctgat atcgttagag aaggtgatac ccttaccgtg agaggtggta 3480

gacctctcca cgctgttact agagatggtg attccttcac cgacgccgtg caagctctta 3540

ccgctgctgc tgccttcgct gagggtgata ccacctggga aaacgttgct actcttagac 3600

tcaaggaatg cgatagaatc tctgacacca gagctgagct tgaaagactt ggtcttagag 3660

caagagagac cgccgattct ctctccgtta ctggttctgc tcaccttgct ggtggtatca 3720

ccgctgatgg tcacggtgac cacagaatga tcatgcttct cacccttctt ggtctcagag 3780

cagatgctcc acttagaatc accggtgcac accacatcag aaagtcctac cctcagttct 3840

tcgctcacct tgaagctctt ggtgctagat tcgaatacgc tgaggctacc gcctatagga 3900

gctcgagttt ctccataata atgtgtgagt agttcccaga taagggaatt agggttccta 3960

tagggtttcg ctcatgtgtt gagcatataa gaaaccctta gtatgtattt gtatttgtaa 4020

aatacttcta tcaataaaat ttctaattcc taaaaccaaa atccagtact aaaatccaga 4080

tcccccgaat taattcggcg ttaattcagt acattaaaaa cgtccgcaat gtgttattaa 4140

gttgtctaag cgtcaatttg tttacaccac aatatatcct gccaccagcc agccaacagc 4200

tccccgaccg gcagctcggc acaaaatcac cactcgatac aggcagccca tcagtccggg 4260

acggcgtcag cgggagagcc gttgtaaggc ggcagacttt gctcatgtta ccgatgctat 4320

tcggaagaac ggcaactaag ctgccgggtt tgaaacacgg atgatctcgc ggagggtagc 4380

atgttgattg taacgatgac agagcgttgc tgcctgtgat caccgcggtt tcaaaatcgg 4440

ctccgtcgat actatgttat acgccaactt tgaaaacaac tttgaaaaag ctgttttctg 4500

gtatttaagg ttttagaatg caaggaacag tgaattggag ttcgtcttgt tataattagc 4560

ttcttggggt atctttaaat actgtagaaa agaggaagga aataataaat ggctaaaatg 4620

agaatatcac cggaattgaa aaaactgatc gaaaaatacc gctgcgtaaa agatacggaa 4680

ggaatgtctc ctgctaaggt atataagctg gtgggagaaa atgaaaacct atatttaaaa 4740

atgacggaca gccggtataa agggaccacc tatgatgtgg aacgggaaaa ggacatgatg 4800

ctatggctgg aaggaaagct gcctgttcca aaggtcctgc actttgaacg gcatgatggc 4860

tggagcaatc tgctcatgag tgaggccgat ggcgtccttt gctcggaaga gtatgaagat 4920

gaacaaagcc ctgaaaagat tatcgagctg tatgcggagt gcatcaggct ctttcactcc 4980

atcgacatat cggattgtcc ctatacgaat agcttagaca gccgcttagc cgaattggat 5040

tacttactga ataacgatct ggccgatgtg gattgcgaaa actgggaaga agacactcca 5100

tttaaagatc cgcgcgagct gtatgatttt ttaaagacgg aaaagcccga agaggaactt 5160

gtcttttccc acggcgacct gggagacagc aacatctttg tgaaagatgg caaagtaagt 5220

ggctttattg atcttgggag aagcggcagg gcggacaagt ggtatgacat tgccttctgc 5280

gtccggtcga tcagggagga tatcggggaa gaacagtatg tcgagctatt ttttgactta 5340

ctggggatca agcctgattg ggagaaaata aaatattata ttttactgga tgaattgttt 5400

tagtacctag aatgcatgac caaaatccct taacgtgagt tttcgttcca ctgagcgtca 5460

gaccccgtag aaaagatcaa aggatcttct tgagatcctt tttttctgcg cgtaatctgc 5520

tgcttgcaaa caaaaaaacc accgctacca gcggtggttt gtttgccgga tcaagagcta 5580

ccaactcttt ttccgaaggt aactggcttc agcagagcgc agataccaaa tactgtcctt 5640

ctagtgtagc cgtagttagg ccaccacttc aagaactctg tagcaccgcc tacatacctc 5700

gctctgctaa tcctgttacc agtggctgct gccagtggcg ataagtcgtg tcttaccggg 5760

ttggactcaa gacgatagtt accggataag gcgcagcggt cgggctgaac ggggggttcg 5820

tgcacacagc ccagcttgga gcgaacgacc tacaccgaac tgagatacct acagcgtgag 5880

ctatgagaaa gcgccacgct tcccgaaggg agaaaggcgg acaggtatcc ggtaagcggc 5940

agggtcggaa caggagagcg cacgagggag cttccagggg gaaacgcctg gtatctttat 6000

agtcctgtcg ggtttcgcca cctctgactt gagcgtcgat ttttgtgatg ctcgtcaggg 6060

gggcggagcc tatggaaaaa cgccagcaac gcggcctttt tacggttcct ggccttttgc 6120

tggccttttg ctcacatgtt ctttcctgcg ttatcccctg attctgtgga taaccgtatt 6180

accgcctttg agtgagctga taccgctcgc cgcagccgaa cgaccgagcg cagcgagtca 6240

gtgagcgagg aagcggaaga gcgcctgatg cggtattttc tccttacgca tctgtgcggt 6300

atttcacacc gcatatggtg cactctcagt acaatctgct ctgatgccgc atagttaagc 6360

cagtatacac tccgctatcg ctacgtgact gggtcatggc tgcgccccga cacccgccaa 6420

cacccgctga cgcgccctga cgggcttgtc tgctcccggc atccgcttac agacaagctg 6480

tgaccgtctc cgggagctgc atgtgtcaga ggttttcacc gtcatcaccg aaacgcgcga 6540

ggcagggtgc cttgatgtgg gcgccggcgg tcgagtggcg acggcgcggc ttgtccgcgc 6600

cctggtagat tgcctggccg taggccagcc atttttgagc ggccagcggc cgcgataggc 6660

cgacgcgaag cggcggggcg tagggagcgc agcgaccgaa gggtaggcgc tttttgcagc 6720

tcttcggctg tgcgctggcc agacagttat gcacaggcca ggcgggtttt aagagtttta 6780

ataagtttta aagagtttta ggcggaaaaa tcgccttttt tctcttttat atcagtcact 6840

tacatgtgtg accggttccc aatgtacggc tttgggttcc caatgtacgg gttccggttc 6900

ccaatgtacg gctttgggtt cccaatgtac gtgctatcca caggaaagag accttttcga 6960

cctttttccc ctgctagggc aatttgccct agcatctgct ccgtacatta ggaaccggcg 7020

gatgcttcgc cctcgatcag gttgcggtag cgcatgacta ggatcgggcc agcctgcccc 7080

gcctcctcct tcaaatcgta ctccggcagg tcatttgacc cgatcagctt gcgcacggtg 7140

aaacagaact tcttgaactc tccggcgctg ccactgcgtt cgtagatcgt cttgaacaac 7200

catctggctt ctgccttgcc tgcggcgcgg cgtgccaggc ggtagagaaa acggccgatg 7260

ccgggatcga tcaaaaagta atcggggtga accgtcagca cgtccgggtt cttgccttct 7320

gtgatctcgc ggtacatcca atcagctagc tcgatctcga tgtactccgg ccgcccggtt 7380

tcgctcttta cgatcttgta gcggctaatc aaggcttcac cctcggatac cgtcaccagg 7440

cggccgttct tggccttctt cgtacgctgc atggcaacgt gcgtggtgtt taaccgaatg 7500

caggtttcta ccaggtcgtc tttctgcttt ccgccatcgg ctcgccggca gaacttgagt 7560

acgtccgcaa cgtgtggacg gaacacgcgg ccgggcttgt ctcccttccc ttcccggtat 7620

cggttcatgg attcggttag atgggaaacc gccatcagta ccaggtcgta atcccacaca 7680

ctggccatgc cggccggccc tgcggaaacc tctacgtgcc cgtctggaag ctcgtagcgg 7740

atcacctcgc cagctcgtcg gtcacgcttc gacagacgga aaacggccac gtccatgatg 7800

ctgcgactat cgcgggtgcc cacgtcatag agcatcggaa cgaaaaaatc tggttgctcg 7860

tcgcccttgg gcggcttcct aatcgacggc gcaccggctg ccggcggttg ccgggattct 7920

ttgcggattc gatcagcggc cgcttgccac gattcaccgg ggcgtgcttc tgcctcgatg 7980

cgttgccgct gggcggcctg cgcggccttc aacttctcca ccaggtcatc acccagcgcc 8040

gcgccgattt gtaccgggcc ggatggtttg cgaccgtcac gccgattcct cgggcttggg 8100

ggttccagtg ccattgcagg gccggcagac aacccagccg cttacgcctg gccaaccgcc 8160

cgttcctcca cacatggggc attccacggc gtcggtgcct ggttgttctt gattttccat 8220

gccgcctcct ttagccgcta aaattcatct actcatttat tcatttgctc atttactctg 8280

gtagctgcgc gatgtattca gatagcagct cggtaatggt cttgccttgg cgtaccgcgt 8340

acatcttcag cttggtgtga tcctccgccg gcaactgaaa gttgacccgc ttcatggctg 8400

gcgtgtctgc caggctggcc aacgttgcag ccttgctgct gcgtgcgctc ggacggccgg 8460

cacttagcgt gtttgtgctt ttgctcattt tctctttacc tcattaactc aaatgagttt 8520

tgatttaatt tcagcggcca gcgcctggac ctcgcgggca gcgtcgccct cgggttctga 8580

ttcaagaacg gttgtgccgg cggcggcagt gcctgggtag ctcacgcgct gcgtgatacg 8640

ggactcaaga atgggcagct cgtacccggc cagcgcctcg gcaacctcac cgccgatgcg 8700

cgtgcctttg atcgcccgcg acacgacaaa ggccgcttgt agccttccat ccgtgacctc 8760

aatgcgctgc ttaaccagct ccaccaggtc ggcggtggcc catatgtcgt aagggcttgg 8820

ctgcaccgga atcagcacga agtcggctgc cttgatcgcg gacacagcca agtccgccgc 8880

ctggggcgct ccgtcgatca ctacgaagtc gcgccggccg atggccttca cgtcgcggtc 8940

aatcgtcggg cggtcgatgc cgacaacggt tagcggttga tcttcccgca cggccgccca 9000

atcgcgggca ctgccctggg gatcggaatc gactaacaga acatcggccc cggcgagttg 9060

cagggcgcgg gctagatggg ttgcgatggt cgtcttgcct gacccgcctt tctggttaag 9120

tacagcgata accttcatgc gttccccttg cgtatttgtt tatttactca tcgcatcata 9180

tacgcagcga ccgcatgacg caagctgttt tactcaaata cacatcacct ttttagacgg 9240

cggcgctcgg tttcttcagc ggccaagctg gccggccagg ccgccagctt ggcatcagac 9300

aaaccggcca ggatttcatg cagccgcacg gttgagacgt gcgcgggcgg ctcgaacacg 9360

tacccggccg cgatcatctc cgcctcgatc tcttcggtaa tgaaaaacgg ttcgtcctgg 9420

ccgtcctggt gcggtttcat gcttgttcct cttggcgttc attctcggcg gccgccaggg 9480

cgtcggcctc ggtcaatgcg tcctcacgga aggcaccgcg ccgcctggcc tcggtgggcg 9540

tcacttcctc gctgcgctca agtgcgcggt acagggtcga gcgatgcacg ccaagcagtg 9600

cagccgcctc tttcacggtg cggccttcct ggtcgatcag ctcgcgggcg tgcgcgatct 9660

gtgccggggt gagggtaggg cgggggccaa acttcacgcc tcgggccttg gcggcctcgc 9720

gcccgctccg ggtgcggtcg atgattaggg aacgctcgaa ctcggcaatg ccggcgaaca 9780

cggtcaacac catgcggccg gccggcgtgg tggtgtcggc ccacggctct gccaggctac 9840

gcaggcccgc gccggcctcc tggatgcgct cggcaatgtc cagtaggtcg cgggtgctgc 9900

gggccaggcg gtctagcctg gtcactgtca caacgtcgcc agggcgtagg tggtcaagca 9960

tcctggccag ctccgggcgg tcgcgcctgg tgccggtgat cttctcggaa aacagcttgg 10020

tgcagccggc cgcgtgcagt tcggcccgtt ggttggtcaa gtcctggtcg tcggtgctga 10080

cgcgggcata gcccagcagg ccagcggcgg cgctcttgtt catggcgtaa tgtctccggt 10140

tctagtcgca agtattctac tttatgcgac taaaacacgc gacaagaaaa cgccaggaaa 10200

agggcagggc ggcagcctgt cgcgtaactt aggacttgtg cgacatgtcg ttttcagaag 10260

acggctgcac tgaacgtcag aagccgactg cactatagca gcggaggggt tggatcaaag 10320

tactttgatc ccgaggggaa ccctgtggtt ggcatgcaca tacaaatgga cgaacggata 10380

aaccttttca cgccctttta aatatccgtt attctaataa acgctctttt ctcttaggtt 10440

tacccgccaa tatatcctgt caaacactga tagtttaaac tgaaggcggg aaacgacaat 10500

ctgatccaag ctcaagctgc tctagcattc gccattcagg ctgcgcaact gttgggaagg 10560

gcgatcggtg cgggcctctt cgctattacg ccagctggcg aaagggggat gtgctgcaag 10620

gcgattaagt tgggtaacgc cagggttttc ccagtcacga cgttgtaaaa cgacggccag 10680

tgccaagctt gcatgcctgc aggtcgactc tagaggatcc ccgggtaccg agctcgaatt 10740

c 10741

Claims (3)

1. The pSOY19-ZM2 vector is characterized in that the pSOY19-ZM2 vector is formed by connecting a green tissue specific promoter PGmCRB1 and a pSOY19 vector with a 35S promoter cut off, wherein the nucleotide sequence of the green tissue specific promoter PGmCRB1 is shown in SEQ ID NO:1, the nucleotide sequence of the pSOY19-ZM2 vector is shown in SEQ ID NO:2.
2. 2. the method for preparing pSOY19-ZM2 vector of claim 1, comprising the steps of:

   s1: PCR amplification is carried out on the 2171bp promoter sequence at the upstream of the initiation codon of the GmCRB1 gene, and amplification primers are as follows:

   PGmCRB1-F：

   cccgggtaccgagctcGAATTCTCTTATAATAACCCTGTTAAC，

   PGmCRB1-R：

   gagagaactggtgatgaattcgtttccacacagtgc; obtaining an amplified PGmCRB1 fragment for later use;

   s2: cutting off the 35S promoter in the plant expression vector pSOY19 vector by EcoRI and NcoI double enzymes for later use;

   s3: and (3) connecting the PGmCRB1 fragment in the step S1 with the pSOY19 vector with 35S cut out in the step S2 to obtain the pSOY19-ZM2 vector.
3. 3. Use of the pSOY19-ZM2 vector of claim 1 in a product that increases the herbicide resistance of soybeans and reduces the herbicide resistant protein content in soybean seeds.

Images