CN113201543A - Promoter of Pteria penguin Tyr gene and application thereof - Google Patents
Promoter of Pteria penguin Tyr gene and application thereof Download PDFInfo
- Publication number
- CN113201543A CN113201543A CN202110492284.0A CN202110492284A CN113201543A CN 113201543 A CN113201543 A CN 113201543A CN 202110492284 A CN202110492284 A CN 202110492284A CN 113201543 A CN113201543 A CN 113201543A
- Authority
- CN
- China
- Prior art keywords
- tyr
- promoter
- pteria penguin
- cell line
- recombinant vector
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/43504—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2830/00—Vector systems having a special element relevant for transcription
- C12N2830/34—Vector systems having a special element relevant for transcription being a transcription initiation element
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A40/00—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production
- Y02A40/80—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production in fisheries management
- Y02A40/81—Aquaculture, e.g. of fish
Abstract
The invention discloses a promoter of a Tyr gene of pteria penguin and application thereof. In particular discloses a promoter of a Tyr gene of Pteria penguin, a corresponding recombinant vector and a recombinant 293T cell line. On the basis, the invention also provides a method for identifying the Tyr transcription factor of the pteria penguin. The method can determine whether other melanin related genes of the pteria penguin are transcription factors of the melanin synthesis key gene Tyr by cotransfecting the constructed Tyr-promoter-luc recombinant vector and an expression vector containing a transcription factor gene sequence to be identified into a 293T cell line and determining the luciferase activity in the cell. The invention overcomes the defect that a promoter and a plasmid for screening and identifying the Tyr transcription factor of the pteria penguin are unavailable, and has important significance for identifying the Tyr transcription factor and constructing a melanin synthesis signal path of the pteria penguin.
Description
Technical Field
The invention belongs to the technical field of aquatic science and genetic engineering, and particularly relates to a promoter of a Tyr gene of Pteria penguin and application thereof.
Background
Pteria penguin is a high-quality mother shell for cultivating large seawater pearls, and natural pearls produced by the Pteria penguin are mainly bronze or blue-green. The content of melanin in the penguin pearl oyster is rich, the content of the melanin in the penguin pearl oyster is reduced by regulation, the color of the pearl is expected to be optimized, golden series pearls and rainbow pearls which are advocated by the production industry break through the industrial bottleneck of low quality and single color of seawater pearls in China, and the research on the forming mechanism of the color of the pearl is a precondition for color regulation.
The synthesis of melanin of pteria penguin has a complex signal path, wherein tyrosinase (Tyr) is a key rate-limiting enzyme and plays a decisive role in the synthesis of melanin, and the expression quantity of the tyrosinase can influence the melanin content. Tyr may be regulated by a plurality of transcription factors, and the Tyr transcription factor can regulate the synthesis of melanin by regulating the expression of Tyr, so that the screening and identification of the Tyr transcription factor is an important part for constructing a melanin synthesis signal path of Pteria penguin and realizing the regulation of the synthesis of melanin. Chinese patent CN110184323A discloses an identification method of a transcription factor of a banana aquaporin gene promoter, but at present, no promoter and plasmid which can be used for screening and identifying a Tyr transcription factor of Pteria penguin are available, which seriously hinders the identification of the Tyr transcription factor and the construction of a signal path.
Disclosure of Invention
The invention aims to overcome the defects and shortcomings of the prior art and provide a promoter of a Tyr gene of pteria penguin and application thereof.
The first purpose of the invention is to provide a promoter of Tyr gene of Pteria penguin.
The second purpose of the invention is to provide a method for identifying Tyr transcription factor of Pteria penguin.
The third purpose of the invention is to provide the application of the Tyr gene promoter of the Pteria penguin in the identification of Tyr transcription factors.
The above purpose of the invention is realized by the following technical scheme:
the invention firstly clones the Tyr promoter region sequence by constructing the Walker library of the Pteria penguin genome and analyzing to obtain the promoter sequence. And then, by constructing a luciferase reporter gene recombinant vector driven by the Tyr promoter, transfecting the constructed recombinant vector to a 293T cell line, and verifying the function of the obtained promoter sequence, the result shows that the obtained promoter is a Tyr strong promoter.
The present application thus claims the following:
a promoter of Tyr gene of Pteria penguin has a sequence shown in SEQ ID NO. 1.
A recombinant vector contains a sequence shown as SEQ ID NO. 1.
A recombinant cell line comprising the above recombinant vector.
Preferably, the expression vector of the recombinant vector is pGL3-Basic fluorescein reporter gene vector.
Preferably, the cell line is the 293T cell line.
The method for determining luciferase activity in cells by cotransfecting the Tyr-promoter-luc recombinant vector constructed by the invention and an expression vector containing a transcription factor gene sequence to be identified into a 293T cell line can determine whether other melanin related genes of the Pteria penguin are transcription factors of a melanin synthesis key gene Tyr. Therefore, the invention also applies to protect the promoter, the recombinant vector and the application of the recombinant cell line in identifying the Tyr transcription factor of the Pteria penguin.
The invention also provides a method for identifying Tyr transcription factor of Pteria penguin, which comprises the following steps:
s1, constructing a target gene recombinant vector;
s2, transfecting cells by the vector obtained in the step S1 and the recombinant vector together, and collecting the cells to perform dual-luciferase report analysis;
s3, if the luciferase activity of the cell over expressing the target gene is higher than that of the control, the identified target gene is the Tyr transcription factor of the pteria penguin.
Preferably, the expression vector of step S1 is pcdna3.1.
Preferably, the cells of step S2 are 293T cell line.
Preferably, the 293T cell line cotransfected with pcDNA3.1 and the recombinant vector of claim 2 is used as a negative control in the determination of the result of step S3.
The invention has the following beneficial effects:
the invention firstly provides a Tyr gene promoter of Pteria penguin, a luciferase reporter gene recombinant vector driven by the Tyr promoter and a recombinant 293T cell line. On the basis, a method for identifying Tyr transcription factor of Pteria penguin is also provided. The method can determine whether other melanin related genes of the pteria penguin are transcription factors of the melanin synthesis key gene Tyr by cotransfecting the constructed Tyr-promoter-luc recombinant vector and an expression vector containing a transcription factor gene sequence to be identified into a 293T cell line and determining the luciferase activity in the cell. The invention overcomes the defect that a promoter and a plasmid for screening and identifying the Tyr transcription factor of the pteria penguin are unavailable, and has important significance for identifying the Tyr transcription factor and constructing a melanin synthesis signal path of the pteria penguin.
Drawings
FIG. 1 shows the results of the analysis of the promoter sequence of the Tyr gene
FIG. 2 shows the results of the dual luciferase activity assays in examples 3 and 4.
Detailed Description
The invention is further described with reference to the drawings and the following detailed description, which are not intended to limit the invention in any way. Reagents, methods and apparatus used in the present invention are conventional in the art unless otherwise indicated.
Unless otherwise indicated, reagents and materials used in the following examples are commercially available.
Example 1 amplification of promoters
The invention firstly utilizes an E.Z.N.A. tissue DNA kit of Omega company to extract genome DNA from Pteria penguin to construct a genome Walker library, and the DNA extraction step is carried out according to the instruction of the kit. The promoter region of Tyr was then cloned using the Genome Walker Kit from Takara.
The invention designs three primers (Tyr-SP1, Tyr-SP2 and Tyr-SP3) to amplify a single DNA fragment of a Tyr promoter, and uses Tyr-pro-F and Tyr-pro-R to verify the amplified sequence, and the sequence is shown in Table 1.
TABLE 1 primers for cloning the Tyr promoter region
| Primer and method for producing the same | Sequence (5 '-3') | Use of |
| Tyr-SP1 | CAGTATAGTTAAGTCTGTACTGC | Genome walking |
| Tyr-SP2 | GTAGATATTTGCAGGTATGAAAG | Genome walking |
| Tyr-SP3 | GATCTGTGAGAGATATAAACTTC | Genome walking |
| Tyr-pro-F | GAAGAGCTCAAGACAGAATG | Promoter validation |
| Tyr-pro-R | CAGTATAGTTAAGTCTGTACTGC | Promoter validation |
| Tyr-pro-luc-F | CTTGCTAGCACTAATGGGACTCTAGCAGG | Luciferase Activity assay |
| Tyr-pro-luc-R | CGCAAGCTTAATCAAATTCCTAAAGCACT | Luciferase Activity assay |
| Mitf-F | ATGATGCAGGACTCTGGAATC | Gene amplification |
| Mitf-R | TAATCACAGCAAATCGTTCGA | Gene amplification |
The PCR amplification system is shown in Table 2. Wherein Tyr-SP1/2/3 is a downstream primer of three PCR and AP1 (random degenerate primer) is an upstream primer.
TABLE 2 PCR System for Gene promoter amplification (50. mu.L)
| Composition of | Volume of |
| Genomic DNA template | 5μL |
| dNTP Mixture(2.5mM each) | 8μL |
| 10×LA PCR Buffer II(Mg2+plus) | 5μL |
| TaKaRaLA Taq(5U/μl) | 0.5μL |
| Tyr-SP1/Tyr-SP2/Tyr-SP3 Primer | 1μL |
| AP1 Primer(100pmol/μl) | 1μL |
| Sterilized water | 29.5μL |
The first round of nested PCR amplification procedure was: pre-denaturation at 94 ℃ for 1 min; denaturation at 94 ℃ for 30s, annealing at 60 ℃ for 1min, extension at 72 ℃ for 2min for 30s, and performing 5 reaction cycles; denaturation at 94 deg.C for 30s, annealing at 25 deg.C for 3min, and extension at 72 deg.C for 2min for 30 s; denaturation at 94 ℃ for 30s, annealing at 60 ℃ for 1min, extension at 72 ℃ for 2min for 30s, denaturation at 94 ℃ for 30s, annealing at 44 ℃ for 1min, and extension at 72 ℃ for 2min for 30s, and performing 15 reaction cycles; extension at 72 ℃ for 10 min.
The second and third nested PCRs both used the previous PCR reaction solution as a DNA template and Tyr-SP2 Primer and Tyr-SP3 Primer as downstream primers, respectively. Two rounds of nested PCR amplification procedures were: denaturation at 94 ℃ for 30s, annealing at 60 ℃ for 1min, extension at 72 ℃ for 2min for 30s, denaturation at 94 ℃ for 30s, annealing at 44 ℃ for 1min, extension at 72 ℃ for 2min for 30s, and performing 15 reaction cycles; extension at 72 ℃ for 10 min. The PCR amplification product was separated by electrophoresis on 1.5% agarose gel to obtain a band of about 2100bp in size.
Using the pMD-18T vector of Takara, the amplification products were mixed with the vector according to the ligation system shown in the following table, reacted at 16 ℃ for 30min, and the ligation products were transformed with E.coli DH 5. alpha. competent cells of Shanghai Biotech.
TABLE 3 Tyr promoter and pMD-18T vector ligation System
Taking out the competent Escherichia coli preserved at-80 deg.C, and immediately standing in ice; adding the total amount of ligation product into 100 μ L of competent cells, gently mixing, and standing on ice for 30 min; heat shock at 42 deg.C for 45s, and then standing on ice for 1 min; adding 900 mu L of LB liquid culture medium (without antibiotics), and carrying out shaking culture at 37 ℃ and 150rpm for 1-1.5 h; after completion of the culture, the cells were centrifuged at 5000rpm for 3min, and the supernatant was discarded, followed by resuspending the cells in 100. mu.L of LB liquid medium. And (3) coating the heavy suspension on an LB plate containing ampicillin resistance, and carrying out inverted culture at 37 ℃ for 12-20 h. Selecting a single colony, carrying out colony PCR identification by using Tyr-pro-F and Tyr-pro-R primers, extracting a recombinant vector in qualified bacteria liquid, and sequencing the obtained Tyr-promoter-pMD-18T recombinant vector.
The sequencing result showed that the genome sequence of 1959bp upstream of the initiation codon (ATG) was obtained. The transcription start site of the Tyr gene is located 16bp upstream of the ATG and is designated as position + 1. The 1943bp sequence upstream of the transcription start site was considered a putative promoter.
The results of promoter sequence analysis are shown in FIG. 1, and show that two typical E-box (CATGTG) elements recognized by bHLH-LZ transcription factor are located at positions 1767-1762 and 1613-1608, respectively. In addition, the tyrosinase promoter contains 6 putative CAMP Response Elements (CRE) and 3 putative activated protein 2(AP-2) binding sites.
Example 2 construction of Tyr promoter-Luciferase recombinant vector
In order to verify the function of the obtained Tyr promoter, the invention constructs a luciferase reporter gene recombinant vector (Tyr promoter-Luc) driven by the Tyr promoter.
And (2) amplifying a Tyr complete promoter sequence by using Tyr-pro-luc-F and Tyr-pro-luc-R primers, carrying out enzyme cutting on the Tyr promoter sequence and pGL3-Basic vector simultaneously by using pGL3-Basic vector, and recovering the fragment after enzyme cutting, wherein the enzyme cutting site at the 5 'end of the promoter sequence is MluI, and the enzyme cutting site at the 3' end is NheI. pGL3-Basic vector from Takara was used, and the ligation system shown in Table 3 was mixed, ligated in a water bath at 50 ℃ for 15min, and the ligation product was transformed into E.coli DH 5. alpha. competent cells from Shanghai Biotech.
TABLE 4 Tyr promoter and pGL3-Basic vector connection System
Taking out the competent Escherichia coli preserved at-80 deg.C, and immediately standing in ice; gently mixing appropriate volume of ligation product (50 ng DNA per 100. mu.L of competent cells, volume not more than 5% of competent cell volume) with competent cells, and standing on ice for 20 min; thermally shocking for 90s at 42 ℃, and then placing on ice for 2-3 min; adding 900 mu L of LB liquid culture medium (without antibiotics), and carrying out shaking culture at 37 ℃ and 150rpm for 1-1.5 h; after completion of the culture, the cells were centrifuged at 5000rpm for 3min, and the supernatant was discarded, followed by resuspending the cells in 100. mu.L of LB liquid medium. And (3) coating the heavy suspension on an LB plate containing ampicillin resistance, and carrying out inverted culture at 37 ℃ for 12-20 h. Selecting a single colony, carrying out colony PCR identification by using primers Tyr-pro-luc-F and Tyr-pro-luc-R, extracting a recombinant vector in a qualified bacterial liquid, and sequencing the obtained Tyr-promoter-luc recombinant vector, wherein a sequencing result shows that the sequence of the Tyr promoter in the obtained recombinant expression vector is correct.
Example 3293 expression of Luciferase in T cells
The activity of the PpTyr promoter was determined using the dual-luciferase reporter method. 293T cells were first cultured in DMEM medium supplemented with 10% Fetal Calf Serum (FCS) at 37 ℃, and then 0.4. mu.g of Tyr-promoter-luc recombinant vector and 0.04. mu.g of pRL-cmv vector were mixed with 1. mu.l of Lipofectamine 2000(Invitrogen), and transfected into cells in a 24-well plate, while pGL3-Basic empty vector and pRL-cmv vector were transfected as negative controls. After 48h, cells were harvested and lysed using the dual luciferase reporter assay System (Promega) according to the protocol, fluorescence intensity measured using a Junior-LB9509 luminometer, and luciferase activity expressed as relative light units of firefly fluorescence to Renilla fluorescence (RLU).
The results of luciferase activity assay are shown in FIG. 2, where the cells transfected with pGL3-Basic empty vector showed low level of luciferase activity, while the cells transfected with Tyr-promoter-luc recombinant vector showed high luciferase activity, indicating that it is a strong promoter.
Example 4 identification of Tyr transcription factor
The following description will explain the application of the Tyr promoter in identifying Tyr transcription factor by taking the example of identifying whether Mitf is the Tyr transcription factor.
And (3) amplifying a Mitf sequence by using primers Mitf-F and Mitf-R by taking cDNA obtained by reverse transcription of total RNA of the Pteria penguin as a template. Then the amplified target fragment is connected with plasmid pcDNA3.1 to construct a Mitf-pcDNA3.1 recombinant expression vector. The upstream restriction enzyme site of the Mitf sequence is Nhe I, and the downstream restriction enzyme site is EcoRI. Subsequently, the Mitf-pcDNA3.1 recombinant vector and the Tyr-promoter-luc recombinant vector were co-transfected into 293T cell line, and in addition, the Mitf-pcDNA3.1 and the Tyr-promoter-luc recombinant vector were co-transfected into 293T cell line as negative control. After 48h, cells were harvested and lysed using a dual luciferase reporter assay system. The reagents and methods for detecting dual luciferases are the same as in example 3.
The luciferase activity detection result is shown in FIG. 2, the cell over-expressing Mitf-pcDNA3.1 shows high luciferase activity, which is 3.02 times that of the pcDNA3.1 negative control cell and is significantly higher than that of the pcDNA3.1 cell (P < 0.05). This shows that Mitf has obvious regulation and control effect on Tyr, and proves that Mitf is an upstream transcription factor of Tyr and can activate the expression of Tyr.
Using a similar method, it can be identified whether other melanin-related genes of Pteria penguin are transcription factors of the key gene Tyr for melanin synthesis.
The above embodiments are preferred embodiments of the present invention, but the present invention is not limited to the above embodiments, and any other changes, modifications, substitutions, combinations, and simplifications which do not depart from the spirit and principle of the present invention should be construed as equivalents thereof, and all such changes, modifications, substitutions, combinations, and simplifications are intended to be included in the scope of the present invention.
Sequence listing
<120> promoter of Pteria penguin Tyr gene and application thereof
<160> 1
<170> SIPOSequenceListing 1.0
<210> 1
<211> 1943
<212> DNA
<213> Pteria penguin
<400> 1
actaatggga ctctagcagg attcgaactc ggacattccc gaatctaaca cttggaccac 60
agtaaggctt aacttcagta acattcgttt ttgatcacat gaaacagtgt tatacagggt 120
gtttttcata tatttattca ttatcataat acaattatga gcatgaatat gaagtacatg 180
tgtatataca ttcaaagttt tcatactctc ttgtgttcta gaatttaact tttgtcacaa 240
aaacggtggt gttataatct ttttgaaagt tttactcttc agtaacgtta tccaattgtc 300
ccataagact taaagctgtc gtaaatgtcc catgtgtttt gtttctgttt gaatttaaga 360
taatcttgtt tccactaact aacctatgta taagagggat ggacctaatg atgtatagtc 420
ctcatttaat gaattgtcat tgtccgtgaa tccactctag cactttgttg ttagtgccat 480
tatcgttgga caccgcttac ttttgtattt tacattgtat aatttaacat acgttgagat 540
ttactaagac ggtttcggtc tttgcaatct ttggcggcga gcaagatttc tgaaatcatc 600
acataacccg aggtcgtcgt tagatatctg acactgcatt gagttcaatg ttttttgttt 660
ttttttcgat agagaatttc attatataca caactatgaa attccagtca gagtgtgcat 720
accaaatatg aagtttatat ctctcacaga tcaatagttg gcaaaagaca cacaaaataa 780
acaaacagat atgccaaatc caacatgccc ccgatctatc tataagaatt aattattatt 840
tatcaataca caagtgcatt ttcgataatt ataatgtttg ataaagtata actgttgatt 900
actgcaacat ctcgccataa aacccatata aatacatgat tatactgtta ttaatgctac 960
agaactcagc tttacataaa gtcgtccccc tacattaagg ctgagtgaaa gttaagtttg 1020
agaacatatt acatttctga cgaattcctt aattactata tcattgtcgt ttctatacgt 1080
ctaattccta ttattcttat ttcttaattg catttatgtt gtgttgtgat gtctaatgag 1140
ggcataattg ttaaattact agttataacc atgcacattt ttattgaaga gctcaagaca 1200
gaatgtaaat tgtggattcc cgaataacat gaacttctcc tcggataatc gaaagtaaaa 1260
tcttgttcgc gacaattatt agaattgaac aaaactcgtg caggaaatct ttcatacctg 1320
caaatatcta cgttaatgtg ttatcaaatg gaattgtttt aattggcgat cattgtaaaa 1380
ctggcctctg aacattacaa ctggcttaag gaaaaaatag atttagattt agagcagtcg 1440
acagctcgag aaaacagtct gagagtgtaa aaccatgttg cgaatctgtg tttttttact 1500
cgccgagacg aaagttcgga gatctattgt catatcctcg gtattgttat cgtcatccgt 1560
agacaaacac gttcacctga aaaataactt cagaaccatt agagacaggg ctttaatatt 1620
ttcacatatt ccttgtgctc tcgcttttca ttaggtacca attgtttttt accttatgat 1680
tttgaagttt gacctacttc ttggtcatat cgtaataaca gtaagggata gggcttaaat 1740
atatctttgt gcattccttg tgaaacgacc tttccttacg catcattttt ttttttgttt 1800
tgaccttgaa gattgactta tttacaaaag gccttttcta tttaaatttg attgccaccg 1860
gcgagttctg ttgtcttctg acaattcttg ttacaaatac ctattaccgt ttcattggta 1920
acatttactt ttattataat att 1943
Claims (10)
1. The promoter of the Tyr gene of the pteria penguin is characterized in that the sequence of the promoter is shown as SEQ ID NO. 1.
2. A recombinant vector comprising the promoter sequence of claim 1.
3. The recombinant vector of claim 2, wherein the recombinant vector is pGL3-Basic fluorescein reporter gene vector.
4. A recombinant cell line comprising the recombinant vector of claim 2 or 3.
5. The recombinant cell line of claim 4, wherein the cell line is a 293T cell line.
6. The promoter of claim 1, the recombinant vector of claim 2 or 3, and the recombinant cell line of claim 4 or 5, for identifying Tyr transcription factor of Pteria penguin.
7. A method for identifying Tyr transcription factor of Pteria penguin is characterized by comprising the following steps:
s1, constructing a recombinant vector containing a target gene to be identified;
s2, co-transfecting the vector obtained in the step S1 and the recombinant vector as claimed in claim 2 to obtain cells, and collecting the cells to perform dual-luciferase report analysis;
and S3, judging results, if the luciferase activity of the cell over-expressing the target gene is higher than that of a control, indicating that the identified target gene is a Tyr transcription factor of the pteria penguin.
8. The method of claim 7, wherein the expression vector of step S1 is pcDNA3.1.
9. The method of claim 7, wherein the cells of step S2 are 293T cell line.
10. The method of claim 7, wherein the 293T cell line cotransfected with pcDNA3.1 and the recombinant vector of claim 2 is used as a negative control in the determination of the result of step S3.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110492284.0A CN113201543B (en) | 2021-05-06 | 2021-05-06 | Promoter of Pteria penguin Tyr gene and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110492284.0A CN113201543B (en) | 2021-05-06 | 2021-05-06 | Promoter of Pteria penguin Tyr gene and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN113201543A true CN113201543A (en) | 2021-08-03 |
| CN113201543B CN113201543B (en) | 2022-11-08 |
Family
ID=77030072
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202110492284.0A Active CN113201543B (en) | 2021-05-06 | 2021-05-06 | Promoter of Pteria penguin Tyr gene and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN113201543B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114517199A (en) * | 2022-03-21 | 2022-05-20 | 广东海洋大学 | Promoter of Pteria penguin Mitf gene and application thereof |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2007148723A1 (en) * | 2006-06-23 | 2007-12-27 | Kinki University | Gene that regulates color of shell of pearl oyster and pearl and protein encoded by the same |
-
2021
- 2021-05-06 CN CN202110492284.0A patent/CN113201543B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2007148723A1 (en) * | 2006-06-23 | 2007-12-27 | Kinki University | Gene that regulates color of shell of pearl oyster and pearl and protein encoded by the same |
Non-Patent Citations (5)
| Title |
|---|
| FEIFEI YU等: "Identification of a tyrosinase gene and its functional analysis in melanin synthesis of Pteria penguin", 《GENE》 * |
| 于非非等: "丙戊酸通过Mitf通路促进企鹅珍珠贝黑色素合成", 《水生生物学报》 * |
| 周小龙等: "海洋贝类功能基因的研究进展", 《海洋科学》 * |
| 杨佳敏等: "长牡蛎MITF基因表达及与壳色的关联", 《水产学报》 * |
| 潘珍妮: "企鹅珍珠贝黑色素相关基因Tyr、Bcl2和Creb的克隆、表达及功能分析", 《中国优秀博硕士学位论文全文数据库(硕士) 农业科技辑 (月刊)》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114517199A (en) * | 2022-03-21 | 2022-05-20 | 广东海洋大学 | Promoter of Pteria penguin Mitf gene and application thereof |
| CN114517199B (en) * | 2022-03-21 | 2023-07-28 | 广东海洋大学 | Promoter of Mitf gene of penguin pearl shell and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN113201543B (en) | 2022-11-08 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102643852B (en) | Optical controllable gene expression system | |
| CN110041416B (en) | Application of GmABCA9 gene in improving soybean protein content and grain weight | |
| CN105734138B (en) | Method for detecting chloroplast promoter activity based on tetracycline regulation and control system | |
| CN113201543B (en) | Promoter of Pteria penguin Tyr gene and application thereof | |
| CN110004144B (en) | PGC promoter expressed by porcine small intestine epithelial cells and application thereof | |
| CN112980848B (en) | Rice sugar-induced promoter SRN1 and application thereof | |
| Rudi et al. | Restriction cutting independent method for cloning genomic DNA segments outside the boundaries of known sequences | |
| JP6960409B2 (en) | promoter | |
| CN106399352B (en) | Folding factor for regulating expression of target protein and application thereof | |
| CN106831975B (en) | Application of heat shock transcription factor 1 in regulation and control of expression of 15kDa selenoprotein | |
| WO2005090562A1 (en) | Sequence capable of accelerating gene expression at moderately low temperature | |
| Tsuchiva et al. | Activation of the erythropoietin promoter by a point mutation from GATA to TATA in the-30 region | |
| CN108384790A (en) | The method of the identification regulation and control active controlling element of FATP1 gene promoter transcriptions | |
| CN112779262B (en) | Application of pig RagC gene | |
| CN114517199B (en) | Promoter of Mitf gene of penguin pearl shell and application thereof | |
| CN112877332A (en) | Method for detecting activity of chicken RIPK2 promoter by using dual-luciferase reporter gene | |
| CN102978202A (en) | Over-expression vector for muscle specific expression of pig IGF1 gene | |
| CN106701764B (en) | Promoter of 15kDa selenoprotein gene, core region and application thereof | |
| CN108517365B (en) | Sp100 molecular marker breeding method for improving natural immunity of pigs and application thereof | |
| CN114134174A (en) | Method for targeted regulation and control of hsa-miR-4638-3p by LncRNA TUG1 | |
| CN101864419B (en) | Mouse Miwi promoter as well as carrier and application thereof | |
| Hilson et al. | Fos and Jun oncogenes transactivate chimeric or native promoters containing AP1/GCN4 binding sites in plant cells. | |
| CN113403318B (en) | Method for cloning full-length segment of pig BRS3 gene CDs sequence | |
| CN114891789B (en) | Synthesis method and application of plutella xylostella dsRNA | |
| Takahashi et al. | Cis-element of the rice PDIL2-3 promoter is responsible for inducing the endoplasmic reticulum stress response |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |