CN113201060B - Recombinant polypeptide and vaccine for preventing and treating eimeria brunetti - Google Patents

Abstract

The invention relates to the field of biological products for livestock, and particularly relates to a recombinant polypeptide and a vaccine for preventing and treating eimeria brunetti. By immunizing the eimeria brunetti recombinant polypeptide vaccine EB-GYYYYF protein, the infection of the eimeria brunetti by chicken bodies can be effectively controlled, the using amount of anticoccidial drugs in chicken farms is greatly reduced, and the coccidiosis of the chicken is effectively controlled.

Description

Recombinant polypeptide and vaccine for preventing and treating eimeria brunetti

Technical Field

The invention relates to the field of biological products for livestock, and particularly relates to a recombinant polypeptide and a vaccine for preventing and treating eimeria brunetti.

Background

Eimeria brunetti (e.brunetti) is an obligate intracellular parasitic apicomplexa, which can cause coccidiosis in chickens that seriously jeopardize the production of intensive poultry. Under the condition of no preventive measures or failure of prevention (such as drug ineffectiveness caused by drug resistance problems), the morbidity of the chickens can reach 30-100%, and the mortality can reach 80%. The global economic loss caused by the coccidiosis of the chickens exceeds more than 30 billion dollars each year. At present, the prevention and control of chicken coccidiosis are still mainly implemented by technical methods of adding various anticoccidial drugs into feed for drug prevention and control and vaccine prevention and control of live oocyst vaccines. However, the wide and serious drug resistance of chicken coccidia and the potential virus-dispersing risk of live oocyst vaccine make the prevention and control of chicken coccidia face a serious challenge, and new anticoccidial drugs and vaccines are developed as problems to be solved urgently. However, the detailed interaction mechanism between coccidia and host cells is not systematically known so far, and the development of novel anticoccidial drugs and molecular vaccines is faced with great difficulty.

The microline protein is a microline secretory protein highly conserved in the phylum apicomplexa, can form a 'Moving Junction' together with a neck protein secreted by a rod-shaped body, completes the adhesion of polypide and host cells together, and is a key substance for assisting polypide to enter the host cells.

In view of the above, the present invention is particularly proposed.

Disclosure of Invention

The first aspect of the present invention relates to a recombinant polypeptide whose amino acid sequence is shown in SEQ ID NO. 3.

A second aspect of the invention relates to an isolated nucleic acid encoding a recombinant polypeptide as described above.

A third aspect of the present invention relates to a vector having a nucleic acid as described above.

A fourth aspect of the invention relates to a host cell, the genome of which incorporates a nucleic acid as described above, or a vector as described above.

A fifth aspect of the present invention relates to a method for producing a recombinant polypeptide as described above, comprising:

culturing the host cell under proper conditions, collecting the culture solution and/or the lysate of the host cell, and separating and purifying to obtain the recombinant polypeptide.

A sixth aspect of the invention relates to a vaccine comprising a recombinant polypeptide as described above, a nucleic acid as described above or a vector as described above.

A seventh aspect of the invention relates to a kit of parts comprising a vaccine as described above, and a container for vaccination of said vaccine.

An eighth aspect of the invention relates to the use of a recombinant polypeptide as described above, a nucleic acid as described above or a vector as described above for the preparation of a medicament for the control of eimeria brunetti.

The invention has the beneficial effects that:

by immunizing the eimeria brunetti recombinant polypeptide vaccine EB-GYYYYF protein, the infection of the eimeria brunetti by chicken bodies can be effectively controlled, the using amount of anticoccidial drugs in chicken farms is greatly reduced, and the coccidiosis of the chicken is effectively controlled.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the embodiments or the prior art descriptions will be briefly described below, and it is obvious that the drawings in the following description are some embodiments of the present invention, and other drawings can be obtained by those skilled in the art without creative efforts.

FIG. 1 is a WB analysis of Eimeria brunetti recombinant polypeptide vaccine EB-GYYYYF eukaryotic expression plasmid expressed in DF-1 cells in one embodiment of the present invention (M. protein molecular mass standard; 1. non-induced bacterial liquid; 2.37 ℃ induced bacterial liquid; 3-4. purified recombinant expression protein);

FIG. 2 is an SDS-PAGE electrophoretic analysis chart of an Eimeria brunetti recombinant polypeptide vaccine EB-GYYYYF expression product in one embodiment of the present invention (M. protein molecular mass standard; 1. non-induced bacterial liquid; 2.37 ℃ induced bacterial liquid; 3-4. purified recombinant expression protein);

FIG. 3 is a WB diagram of an Eimeria brunetti recombinant polypeptide vaccine EB-GYYYYF expression product (M. protein molecular mass standard; 1-2.pET30 a-EB-GYYYYYYF 2 recombinant purified protein).

Detailed Description

Reference will now be made in detail to embodiments of the invention, one or more examples of which are described below. Each example is provided by way of explanation, not limitation, of the invention. In fact, it will be apparent to those skilled in the art that various modifications and variations can be made in the present invention without departing from the scope or spirit of the invention. For instance, features illustrated or described as part of one embodiment, can be used on another embodiment to yield a still further embodiment.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. The terminology used in the description of the invention herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention. As used herein, the term "and/or" includes any and all combinations of one or more of the associated listed items.

The invention relates to a recombinant polypeptide, the amino acid sequence of which is shown in SEQ ID NO. 3.

The invention also relates to an isolated nucleic acid encoding a recombinant polypeptide as described above.

The nucleic acid may be DNA or RNA.

In some embodiments, the nucleic acid is codon optimized for the host.

In some embodiments, the nucleotide sequence of the nucleic acid is set forth in SEQ ID NO 1 or SEQ ID NO 2.

Furthermore, the amino acid sequence of the recombinant polypeptide may also be compared to a sequence selected from the group consisting of SEQ ID NO:3 is substantially similar in amino acid sequence. The nucleotide sequence of the nucleic acid may also be identical to a nucleotide sequence selected from SEQ ID NO:1 or SEQ ID NO. 2 is substantially similar in nucleotide sequence. By "substantially similar" is meant that a given nucleic acid or amino acid sequence shares at least 95% identity, e.g., 96%, 97%, 98%, 98.5%, 99%, 99.5%, with a reference sequence. Alternatively, it is intended that a given nucleic acid or amino acid sequence differs from a reference sequence by 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 nucleic acids or amino acids, preferably by amino acid substitution or deletion, for polypeptides. Preferably, the substantially similar sequence also retains the unique activity of the polypeptide that is capable of detecting endogenous antibodies with high efficiency. Substitutions are generally regarded as conservative substitutions, for example in the aliphatic amino acids Ala, Val, Leu and Ile for one another, for the hydroxyl residues Ser and Thr, for the acidic residues Asp and Glu, for the amide residues Asn and Gln, for the basic residues Lys and Arg and for the aromatic residues Phe, Tyr.

The invention also relates to a vector having a nucleic acid as described above.

The term "vector" refers to a nucleic acid delivery vehicle into which a polynucleotide can be inserted. When a vector is capable of expressing a protein encoded by an inserted polynucleotide, the vector is referred to as an expression vector. The vector may be introduced into a host cell by transformation, transduction, or transfection, and the genetic material elements carried thereby are expressed in the host cell. Vectors are well known to those skilled in the art and include, but are not limited to: a plasmid; phagemid; a cosmid; artificial chromosomes such as Yeast Artificial Chromosomes (YACs), Bacterial Artificial Chromosomes (BACs), or artificial chromosomes (PACs) derived from P1; bacteriophage such as lambda phage or M13 phage, animal virus, etc. Animal viruses that may be used as vectors include, but are not limited to, retroviruses (including lentiviruses), adenoviruses, adeno-associated viruses, herpes viruses (e.g., herpes simplex virus), poxviruses, baculoviruses, papilloma viruses, papilloma polyoma vacuolatum viruses (e.g., SV 40). In some embodiments, regulatory elements commonly used in genetic engineering, such as enhancers, promoters, Internal Ribosome Entry Sites (IRES), and other expression control elements (e.g., transcription termination signals, or polyadenylation signals and poly-U sequences, etc.) are included in the vectors of the present invention.

The invention also relates to a host cell into the genome of which a nucleic acid as described above, or a vector as described above, is incorporated.

The term "host cell" refers to a cell which can be used for introducing a vector, and includes, but is not limited to, prokaryotic cells such as Escherichia coli or Bacillus subtilis, fungal cells such as yeast cells or Aspergillus, insect cells such as S2 Drosophila cells or Sf9, or animal cells such as fibroblast, CHO cells, COS cells, NSO cells, HeLa cells, BHK cells, HEK 293 cells or human cells. The host cell is preferably a eukaryotic cell, more preferably an avian animal cell. Host cells are generally animal cells (preferably avian cells, e.g., chicken cells) that are not totipotent, e.g., do not include fertilized eggs, embryos, germ stem cells, embryonic stem cells, and the like.

The present invention also relates to a process for the preparation of a recombinant polypeptide as described above, comprising:

culturing the host cell under proper conditions, collecting the culture solution and/or the lysate of the host cell, and separating and purifying to obtain the recombinant polypeptide.

The invention also relates to a vaccine comprising a recombinant polypeptide as described above, a nucleic acid as described above or a vector as described above.

In some embodiments, the vaccine further comprises an adjuvant and/or a pharmaceutically acceptable carrier.

As used herein, an "adjuvant" is a substance that is capable of favoring or amplifying an immunological cascade of events, ultimately leading to a better immune response, i.e., an integrated physical response against an antigen. Adjuvants are generally not required for the immune response to occur, but facilitate or amplify the response.

The adjuvant may also be at least one of aluminum salt, liposome, incomplete Freund's adjuvant, complete Freund's adjuvant, alum adjuvant, MF59, monophosphoryl lipid A, flagellin, CpG-ODN, and Poly (I: C). In some embodiments, the aluminum salt is selected from the group consisting of aluminum phosphate, potassium aluminum phosphate, and aluminum hydroxide. Other well known adjuvants include hydrocarbon oils, polymers, saponins and/or adjuvants composed of gelled particles of sodium acrylate in water, for example, montanide m PET GEL ATM (Seppic, Paris France). A low molecular weight copolymer adjuvant may form crosslinks in solution to become a high molecular weight gel, such as POLYGENTM (mvp polymers, Omaha). When added, the amount of adjuvant in the vaccine is typically between about 1% and 20% (v/v). In particular embodiments, the amount of adjuvant is between about 2% and 10% (v/v). In a more specific embodiment, the amount of adjuvant is between about 3% and 6% (v/v).

In some embodiments, the vaccine is a water-in-oil emulsion having an aqueous phase and an oil phase.

In some embodiments, the vaccine is an oil-in-water emulsion having an aqueous phase and an oil phase.

Vaccines are typically formulated for parenteral administration. Typical immunizations are achieved by Subcutaneous (SC) or Intramuscular (IM) injection, but the invention also contemplates vaccinations by the nasal route, or oral, Intravenous (IV), Intraperitoneal (IP), or Intradermal (ID) injection. Alternatively, the vaccine may also be administered via a skin patch, in a delayed release implant, scarification or topical application. Administration can also be via drinking water and/or food of the recipient bird.

The vaccines are administered in a manner compatible with the dosage formulation, and in amounts such as a therapeutically effective amount and an immunogenically effective amount. The amount administered will depend on the subject being treated, the ability of the subject's immune system to synthesize antibodies, and the degree of protection desired. The exact amount of active ingredient to be administered will depend on the judgment of the practitioner, and will vary from individual to individual. Suitable regimens for initial administration and booster vaccination may also vary, but are typically 1 injection or otherwise administered after a certain interval of time (weeks or months) after the first administration.

A "pharmaceutically acceptable carrier" is intended to aid in the stabilization and administration of the vaccine, while being harmless and well tolerated by the target. Such carriers may be, for example, sterile water or sterile physiological saline solution. In a more complex form, the carrier may for example be a buffer, which may contain further additives, such as stabilisers or preservatives. Aqueous or aqueous solutions saline solutions and aqueous solutions of sugars (e.g., dextrose and/or glycerol) may be employed as carriers, particularly for injectable solutions. Furthermore, the carrier may be and/or comprise a hydrocolloid and/or polymer solution, for example, to thicken the avian vaccine to be sprayed on the avian.

In some embodiments, the vaccine further comprises an inactivated virus and/or an inactivated bacterium (e.g., a bacterin) and/or an antigen of a bacterin. This may be derived from the microorganism pathogenic to the bird in any suitable manner, for example as a "live" attenuated, inactivated or subunit antigen.

The additional antigen derived from a microorganism pathogenic to avians is preferably derived from one or more microorganisms selected from the group consisting of:

-virus: infectious bronchitis virus, NDV, egg drop syndrome virus, IBDV, chicken anemia virus, avian encephalomyelitis virus, fowlpox virus, turkey rhinotracheitis virus, pigeon pox virus, MDV, avian leukemia virus, ILTV, avian pneumovirus and reovirus;

-a bacterium; escherichia coli, Salmonella (Salmonella), Ornitobacter rhinotracheale (Ornitobacterium rhinotracheale), Haemophilus paragallinarum (Haemophilus paragallinarum), Pasteurella multocida (Pasteurella multocida), Erysipelothrix rhusiopathiae (Erysipelothrix), Salvia species (Erysipelas), Mycoplasma (Mycoplasma) and Clostridium (Clostridium);

-parasites: eimeria (Eimeria); and

-fungi: aspergillus (Aspergillus).

According to a further aspect of the invention, it also relates to a kit of parts comprising a vaccine as described above, and a container for vaccination of said vaccine.

The inoculation container is preferably a medical syringe or a nasal dropper.

According to a further aspect of the invention, the invention also relates to the application of the recombinant polypeptide as described above, the nucleic acid as described above or the vector as described above in the preparation of a medicament for preventing and treating eimeria brunetti.

The invention further provides a method for protecting birds against infection by eimeria brunetti comprising administering to said animal a prophylactically/therapeutically effective amount of a vaccine according to the invention.

The term "avian" refers to wild or domesticated chickens, ducks, geese, swans, wild geese, pigeons, quails and the like, and particularly to chickens.

Factors affecting the preferred dosage regimen can include, for example, the species or breed of the subject (e.g., avian species or breed), age, weight, diet, activity, lung size, and condition; the route of administration; efficacy, safety and immune duration profiles of the particular vaccine used; whether a delivery system is used; and whether the vaccine is administered as part of a medicament and/or vaccine combination. Thus, the dosage actually employed may vary for a particular animal, and thus may deviate from the typical dosages described above. Determination of such dosage adjustments is generally within the skill of those in the art of vaccine development using conventional methods.

Embodiments of the present invention will be described in detail with reference to examples.

Examples

Preparation of 1 EB-GYYYYF coding gene

1.1 optimization of the encoding Gene

Bioinformatics analysis is carried out according to the eimeria brunetti microline protein obtained by an applicant team and related genes coded by the clavicle neck protein, and screening microline protein 1(139 amino acids), microline protein 2(206 amino acids) and clavicle neck protein 2(109 amino acids) as candidate tandem polypeptides, wherein the amino acid sequences are shown as SEQ ID NO 3, codon optimization is carried out on different hosts by using online codon optimization software, and prokaryotic expression coding gene sequences are respectively obtained and are shown as SEQ ID NO 1, and eukaryotic expression coding gene sequences are obtained and are shown as SEQ ID NO 2.

1.2 Synthesis of the encoding Gene

EB-GYYYF prokaryotic coding gene (SEQ ID NO:1) and eukaryotic coding gene (SEQ ID NO:2) are respectively prepared by using a whole gene synthesis technology, and T vector plasmids (pMD 18-T-EB-GYYYF 1 and pMD 18-T-EB-GYYYYYYYF 2) are respectively prepared.

Preparation of 2 EB-GYYYYYF eukaryotic plasmid

2.1 primer design

Designing primer sequences aiming at the upstream and the downstream of a target gene:

an upstream primer EB-GYYYYF-ZF:

GAAAAGCTTGGATATTATTTTCCTACAGTG (HindIII cleavage site underlined);

a downstream primer EB-GYYYYF-ZR:

GAAGGATCCTTAGTAGTAAGCTTCATGGGCG (BamHI cleavage site underlined).

2.2 Gene amplification

(1) PCR reaction system and amplification conditions

A pMD 18-T-EB-GYYYF 1 plasmid is used as a template, PrimeSTAR high fidelity enzyme is used for amplifying a gene target fragment, and a specific reaction system and conditions are as follows:

TABLE 1 PCR reaction System of EA-GYYYF 1 (unit: μ L)

PCR reaction procedure:

pre-denaturation at 94 ℃ for 5min → denaturation at 94 ℃ for 30sec → annealing at 55 ℃ for 30sec → extension at 72 ℃ for 2min → extension at 72 ℃ for 10min → 4 ℃; for a total of 30 cycles.

(2) Electrophoresis

And (3) carrying out 1% agarose gel electrophoresis on the PCR product, and observing the result under an ultraviolet detector. The size of the product was approximately 1400bp, consistent with the expected product size.

(3) PCR product recovery

The target fragment was recovered with a DNA gel recovery kit and subjected to an enzyme digestion reaction (Table 2):

TABLE 2 EB-GYYYYF 1 digestion reaction system (Unit:. mu.L)

After incubation for 3h at 37 ℃, 1% agarose gel electrophoresis is carried out, and the target fragment after enzyme digestion is recovered by a DNA gel recovery kit.

2.3 treatment of expression vectors

mu.L (1. mu.g/. mu.L) of pCDNA3.1 plasmid was digested with BamHI and HindIII to establish the following digestion reactions:

TABLE 3 digestion reaction System of plasmid (unit: μ L)

After incubation at 37 ℃ for 3h, electrophoresis was performed on a 1% agarose gel. Recovering the plasmid after enzyme digestion by using a DNA gel recovery kit;

2.4 ligation of the digestion vector to the digestion fragment

The digested EB-GYYYF 1 and pCDNA3.1 are combined according to the composition in Table 4 to establish a connection reaction, and a pCDNA3.1-EB-GYYYF 1 recombinant eukaryotic expression plasmid is constructed.

TABLE 4 ligation reaction System of enzyme digestion vector and fragment (Unit:. mu.L)

2.5 ligation product transformation E.coli DH 5. alpha

(1) mu.L of the ligation was added to 100. mu.L of E.coli DH 5. alpha. competent cells in an ice bath. Mix by gentle rotation and ice-bath for 30 min.

(2) Placing the centrifuge tube into a water bath preheated to 42 ℃, and standing for 90 s.

(3) The tube was quickly transferred to an ice bath to cool the cells for 1-2 min.

(4) Add 800. mu.L SOC medium to each tube, incubate 45min at 37 ℃ with slow shaking.

(5) The culture was spread on LB agar plates (containing 100. mu.g/mL Amp), the plates were left at room temperature until the liquid was absorbed, the plates were inverted and incubated overnight at 37 ℃ (about 12-16 h).

2.6 colony PCR method for identifying transformed clones

Several colonies were picked and inoculated into 10ml of LB medium (containing 100. mu.g/ml ampicillin), and after overnight culture at 37 ℃ with shaking, the culture was used to screen for positive clones by the following PCR reaction:

TABLE 5 PCR reaction System (unit: μ L) for identifying transformed clones

PCR reaction procedure: as above.

Taking 10 mu L of PCR reaction product, carrying out 1% agarose gel electrophoresis, selecting positive bacterial colony, shaking bacteria, and sequencing.

2.7 Positive clone sequencing verification

And (3) sending the positive clone obtained by colony PCR identification to a sequencing company for sequencing verification, after sequencing is completed, comparing sequencing results by software, wherein sequencing primers are shown in the following table:

TABLE 6 sequencing primers

2.8 plasmid petiole

The positive clone is verified by sequencing, and the plasmid is arranged to be extracted in small scale.

2.9 verification of expression of EB-GYYYF 1 eukaryotic plasmid

2.9.1 cell transfection

(1) One day prior to transfection, DF-1 cells were digested and counted at 1.0X 10 ⁶ The cell amount of cells/hole is inoculated to a 6-hole plate, the confluence degree of the cells after 24 hours is between 70% and 90%, and 2ml of complete culture medium is cultured in each hole;

(2) on the day of transfection, cells were changed to double-antibody-free complete medium at 37 ℃ with 5% CO ₂ Incubating in an incubator;

(3) preparation before transfection: a. diluting the plasmid DNA with 250 mu L of serum-free DMEM, and gently mixing; b. uniformly mixing lipofectamin reagent, taking a proper amount of lipofectamin reagent, diluting the lipofectamin reagent by 250 mu L of serum-free DMEM, slightly and uniformly mixing, and standing for 5 minutes at room temperature; c. mixing the DNA diluted in the first two steps with a lipofectamin reagent, lightly mixing uniformly, and standing for 20-30 minutes at room temperature;

(4) adding the mixed solution obtained in the step 3 into each hole of the cells;

(5) after transfection for 4-6 h, replacing a complete culture medium;

(6) cells in 5% CO ₂ And (3) incubating for 48-72 h at 37 ℃ in an incubator, and detecting after transfection.

2.9.2Western blot validation

2.9.2.1 sample preparation

(1) Removing the cell culture medium, gently washing the cells with PBS, scraping the cells from the culture dish with a scraper, transferring the cells into a 1.5ml EP tube, centrifuging for 5min at 1000rpm, washing for 3 times with PBS, centrifuging for 5min at 1000rpm, and discarding the supernatant;

(2) adding 100 μ L of lysis solution into each tube, and performing lysis on ice for 10 min;

(3) centrifuge at 12000rpm for 10min at 4 ℃ and transfer the supernatant to a new 1.5ml EP tube.

2.9.2.2 quantification of protein

A standard curve was prepared from 5 (1. mu.L), 10 (2. mu.L), 15 (3. mu.L), 20 (4. mu.L), 25 (5. mu.L), 30 (6. mu.L) and 35 (7. mu.L) of BSA (5 ug/. mu.L), and 2. mu.L of sample was taken, and the measurement was carried out in a triple tube, and the mean value was obtained. Adding 1mL of Bradford into each branch pipe for dyeing, and performing vortex oscillation for 20s to ensure that the Bradford is fully mixed and mixed, so that the light absorption value can be measured, and the operation interval between two samples during measurement should be about 20 s. The liquid is injected uniformly to avoid the generation of bubbles.

2.9.2.3SDS-PAGE gel electrophoresis

According to the quantification, 20ug of each sample was taken and ddH was added ₂ The amount of O was adjusted to 18. mu.L, and then 6. mu.L of 4 Xloading buffer was added, and the mixture was boiled at 100 ℃ for 5min, centrifuged at 12000rpm at 4 ℃ for 3min, and subjected to electrophoresis. Constant pressure 130V/gel electrophoresis, until bromophenol blue runs out of the bottom of the gel, laminated gel concentration is 4%, and separation gel is 10%.

2.9.2.4 electrophoretic transfer film

(1) NC membrane is prepared, and gloves are worn when membrane cutting is carried out.

(2) The clamp is opened to keep the black side horizontal. A sponge cushion is arranged on the upper surface of the bag body, and a glass rod is used for rolling for several times to roll away air bubbles inside. Two layers of filter paper are padded on the sponge pad, the filter paper is fixed by one hand, and air bubbles in the filter paper are rolled away by a glass rod by the other hand.

(3) The sample glue and the film are put into a film rotating clamping plate marked with a positive electrode and a negative electrode: from the cathode side, the sponge pad → 2 layers of filter paper → sample gel → NC membrane → 2 layers of filter paper (note: air bubble removal) → sponge pad were fastened to the transfer nip plate, and the transfer nip plate was placed in a transfer electrophoresis tank containing a transfer buffer.

(4) The membrane transfer time is 1 hour and 30 minutes, and the constant current is as follows: 300 mA.

2, 9.2.5 sealing

5% skimmed milk powder was dissolved in 1 XTSST and blocked for 1h at room temperature.

2.9.2.6 incubation antibodies

(1) The primary antibody (rabbit anti-EB-GYYYYYYF polyclonal antibody, No. KHD2019112, Shanghai Biotech) was diluted to appropriate concentration with 1 XTBST and incubated at 4 ℃ overnight.

(2) After incubating the primary antibody overnight, the membranes were washed three times with TBST on a shaker for 5min each.

(3) The secondary antibody (goat anti-rabbit, code A0277, from Biyunyan) was diluted to the appropriate concentration with 1 XTSST and incubated with the membrane for 2h at room temperature, and the membrane was washed three times with 1 XTSST 5min each time on a shaker.

2.9.2.7 chemiluminescence, development, fixation

(1) Firstly, the liquid on the membrane is sucked dry by filter paper

(2) The two luminescent reagents A and B were mixed in equal volumes in an EP tube, the luminescent reagents were applied to a glass plate, the membrane was facing down, leveled with a gun and timed for 2 min.

(3) And uniformly dispensing the prepared ECL chemiluminescence liquid on an NC film, and exposing by using a chemiluminescence gel imaging system after 10-30 s. The results are shown in FIG. 1.

Preparation of 3 EB-GYYYYYYF protein

3.1 primer design

Designing primer sequences aiming at the upstream and the downstream of a target gene:

upstream primer EB-GYYFYF-YF

GAAGGATCCGGCTACTATTTTCCGACTGTTG (BamHI cleavage site underlined);

a downstream primer EB-GYYYYF-YR:

GAAAAGCTTTTAGTAATACGCTTCATGCGCG (HindIII cleavage sites are underlined).

3.2 Gene amplification

(1) PCR reaction system and amplification conditions: a pMD 18-T-EB-GYYYF 2 plasmid is used as a template, PrimeSTAR high fidelity enzyme is used for amplifying a gene target fragment, and a specific reaction system and conditions are as follows:

TABLE 7 PCR reaction System (unit: μ L) of EB-GYYYYF 2

PCR reaction procedure:

pre-denaturation at 94 ℃ for 5min → denaturation at 94 ℃ for 30sec → annealing at 55 ℃ for 30sec → extension at 72 ℃ for 2min → extension at 72 ℃ for 10min → 4 ℃; for a total of 30 cycles.

(2) Electrophoresis: and (3) carrying out 1% agarose gel electrophoresis on the PCR product, and observing the result under an ultraviolet detector. The product size was approximately 1000bp, consistent with the expected product size.

(3) And (3) recovering a PCR product: the target fragment was recovered with a DNA gel recovery kit and subjected to an enzymatic cleavage reaction (Table 8):

TABLE 8 EB-GYYYYF 2 digestion reaction System (Unit:. mu.L)

After incubation for 3h at 37 ℃, 1% agarose gel electrophoresis is carried out, and the target fragment after enzyme digestion is recovered by a DNA gel recovery kit.

3.3 treatment of the expression vector

mu.L (1. mu.g/. mu.L) of pET30a plasmid was digested with BamHI and Hind III to create the following digestion reactions, which digested the plasmid:

TABLE 9 digestion reaction System of plasmid (unit: μ L)

After incubation at 37 ℃ for 3h, electrophoresis was performed on a 1% agarose gel. Recovering the plasmid after enzyme digestion by using a DNA gel recovery kit;

3.4 ligation of the digestion vector to the digestion fragment

The digested EB-GYYYF 2 and pET30a form a connection reaction according to the composition in Table 10, and pET30 a-EB-GYYYYF 2 recombinant prokaryotic expression plasmid is constructed.

TABLE 10 ligation reaction System of digestion vector and fragment (Unit:. mu.L)

3.5 ligation product transformation E.coli DH 5. alpha

(1) Add 10 μ L of ligation product to 100 μ L e.coli DH5 α competent cells in an ice bath. Mix by gentle rotation and ice-bath for 30 min.

(2) Placing the centrifuge tube into a water bath preheated to 42 ℃, and standing for 90 s.

(3) The tube was quickly transferred to an ice bath to cool the cells for 1-2 min.

(4) Add 800. mu.L SOC medium to each tube, incubate 45min at 37 ℃ with slow shaking.

(5) The culture was spread on LB agar plates (containing 50. mu.g/mL kanamycin sulfate), the plates were left at room temperature until the liquid was absorbed, the plates were inverted, and cultured overnight at 37 ℃ (about 12-16 h).

3.6 colony PCR method for identifying transformed clones

Several colonies were picked and inoculated into 10mL of LB medium (containing 50. mu.g/mL kanamycin sulfate), and after overnight culture at 37 ℃ with shaking, the culture was used to screen for positive clones by the following PCR reaction:

TABLE 11 PCR reaction System (unit: μ L) for identifying transformed clones

PCR reaction procedure: as above.

Taking 10 mu L of PCR reaction product, carrying out 1% agarose gel electrophoresis, selecting positive bacterial colony, shaking bacteria, and sequencing.

3.7 plasmid petiole

The accurate positive clone is verified by sequencing, and the plasmid miniextraction is arranged, and the specific steps are shown in the specification of a plasmid miniextraction kit.

3.8 inducible expression of pET30 a-EB-GYYYYF 2 in expression bacteria

3.8.1 transformation and induction of expression by expression vector

The constructed pET30 a-EB-GYYYF 2 plasmid was transformed into BL21(DE3) competent cells, which were then spread evenly onto LB plates (containing 50. mu.g/mL kanamycin sulfate), followed by being placed upside down in an incubator at 37 ℃ overnight.

Single colonies were picked from the transformed plates, inoculated into 4L of LB medium (containing 50. mu.g/mL kanamycin sulfate), and cultured to OD ₆₀₀ 0.5 to 0.8, 0.1mM IPTG was added to the culture medium at the final concentration, and then the culture medium was allowed to stand at 15 ℃ and 37 ℃ respectively for induction of expression.

3.8.2SDS-PAGE analysis to identify induced expression results

Centrifuging induced culture solution at 12000rpm for 5min, removing supernatant, adding PBS solution to resuspend and precipitate, adding SDS-PAGE sample buffer, heating the sample at 100 deg.C for 10min, centrifuging, and collecting supernatant for electrophoresis. And (3) performing 100V stabilized voltage electrophoresis 10min before electrophoresis, after the bromophenol blue indicator enters the separation gel, performing 200V stabilized voltage electrophoresis until the bromophenol blue band moves to 1cm away from the bottom of the gel, taking out the gel, dyeing the gel with Coomassie brilliant blue dyeing solution, and then transferring the gel into a decoloring solution, and decoloring until the background is clear. The results are shown in FIG. 2.

3.8.3 protein purification

After the inclusion bodies were washed with 20mM PBS (pH7.2), 150mM NaCl containing 1% Triton X-100, 2mM EDTA, and 2mM DTT, the inclusion bodies were solubilized with 20mM PB (pH7.2), 150mM NaCl, 8M Urea, and 20mM Imidazole buffer while equilibrating the Ni-IDA column, and finally the target protein was eluted with equilibration buffer containing different concentrations of Imidazole, and each eluted fraction was collected for SDS-PAGE analysis. The results are shown in FIG. 2.

Purifying and analyzing by Ni-IDA affinity chromatography, collecting Lane 5-11 with high purity, adding into treated dialysis bag, dialyzing at 4 deg.C into buffer solution 1 XPBS (pH7.4), 4mM GSH, 0.4mM GSSG, 2mM EDTA, 0.4M L-Arginine for renaturation, and finally dialyzing EB-GYYYYYF protein into storage solution 1 XPBS (pH7.4) and 10% Glycerol solution for about 6-8 h. After the renaturation by dialysis, the supernatant was filtered through a 0.22 μm filter and dispensed, and was frozen to-80 ℃.

3.9 immunoblot (Western blot) analysis of recombinant proteins

And (3) carrying out immune activity identification on the recombinant EB-GYYYYF 2 protein by adopting an immunoblotting (Western blot) method. The primary antibody was murine his monoclonal antibody (Sigma) and the secondary antibody was goat anti-mouse IgG-HRP (Sigma). The results are shown in FIG. 3.

Immunoprotective assay for 4 EB-GYYYYYF

4.1 materials

Coccidian oocysts: eimeria brunetti Huizhou strain sporulated oocysts were stored in the zoological research institute of animal health institute of Guangdong academy of agricultural sciences and rejuvenated in coccidiless chicks before use.

Chicks: the green south yellow chicks are provided by animal science research institute of agriculture academy of sciences of Guangdong province and are raised in a sterilized special animal house; the chicken coop and the utensils are strictly disinfected, and the chicken coop can freely eat and drink purified water; before the experiment, the chicks are observed to have clinical symptoms and whether coccidian oocysts exist in the excrement is continuously checked for 3 days for later use.

Feed: the chick breeding material is customized by the animal science research institute of the Guangdong province academy of agricultural sciences, and does not contain any anticoccidial drugs.

4.2 test methods

Grouping: weighing 180 test chicks of 1 day old one by one, removing lean or overweight chicks, selecting healthy chickens with individual weight difference within 10g, and randomly dividing into 6 groups of 30 chicks each.

And (3) treatment:

emulsifying EB-GYYF2 recombinant protein: and taking the EB-GYYYYF 2 recombinant protein obtained after 3.9 purification and Freund's adjuvant (FCA) according to the ratio of 1: 1, uniformly mixing; repeatedly sucking with No. 7 needle syringe until no diffusion occurs within 5 min.

Test chickens were immunized with pcdna3.1-EB-GYYF1 eukaryotic plasmid (leg intramuscular injection) or pET30a-EB-GYYF2 recombinant protein (subcutaneous injection) at 1, 7, and 14 days old, respectively, and a non-immune infected group and a non-immune non-infected group were used as controls. Oral infection at 21 days of age 4X 10 ⁴ Fresh e.brunetti sporulated oocysts. Observing and recording the mental state, feed intake, excrement condition and the like of the chicken flocks every day; weighing dead chicks, performing a necropsy, and if the chicks die due to Eimeria brunetti infection, scoring the lesion as +4 points; all chicks were weighed one by one on day 7 post-infection, necropsied, and small intestinal mid-section lesion scored. Specific test groupings are detailed in table 12:

table 12 experimental group design

Anticoccidial index evaluation criteria:

relative rate of weight gain: the weight of the chickens is weighed at the beginning and the end of the test respectively, and the average weight gain and the relative weight gain rate are calculated. Relative weight gain rate (weight gain rate in each group/weight gain rate in non-immune non-infected group) × 100%.

Survival rate: the number of dead chickens in each group is recorded, and the death cause is determined by autopsy and the survival rate is calculated. Survival rate (number of surviving chickens/number of chickens in test group at end of test) × 100%.

The lesion value is: slaughtering the chickens 7 days after infection, performing intestinal lesion scoring of each chicken according to a lesion scoring method designed by Johnson and Reid (1970), and converting the lesion scoring into lesion values;

rectum was dissected 7 days post infection.

Bleeding points and white spots with scattered needle tips can be seen on the serosal surface of rectum for 1 minute, a small amount of orange contents can be seen in the intestinal cavity, and the intestinal wall is slightly thickened.

+2 branch of intestine wall thickens, the serosal surface has a large number of bleeding points and white points, and the intestinal cavity is locally mixed with clotted blood.

The +3 plasma separating membrane surface is full of red bleeding points and white points, the intestinal wall is obviously thickened, the whole intestinal content contains a large amount of blood clots and necrotic and desquamated epithelial tissues, the intestinal mucosal surface is rough, and normal intestinal content is absent.

The middle section of the small intestine with the division of +4 is highly swollen, the intestine section is atrophied and obviously shortened, the content of the intestine contains soy sauce color or brown mucus, and the intestinal mucosa is hemorrhagic and necrotic. Chickens killed by this coccidia were scored as + 4.

The lesion value (0-40) is the average lesion score (0-4). times.10 for each test group.

Oocyst value: fecal oocysts were counted by the Macmester counting method, and the number of fecal Oocysts (OPG) per group was determined, and the number of oocysts was calculated and converted from Table 13 to obtain an oocyst value.

TABLE 13 conversion of oocyst count to oocyst value

Anticoccidial index (ACI): ACI is calculated as (relative rate of weight gain + survival) × 100- (lesion value + oocyst value).

Judging the immune effect standard: ACI >180 is highly effective; 160< ACI <180 is intermediate; 120< ACI <160 is less potent; ACI <120 was not effective against coccidia.

4.3 test results

Observation of clinical symptoms:

the non-immune infected control group test chickens gradually showed reactions such as decreased feed intake, poor spirit and the like after being infected with sporulated oocysts. On the 4 th day after infection, a small amount of brownish red pasty excrement is discharged from the pCDNA3.1 group, the pET30a group and the non-immune infection control group, the water intake is reduced, the group is more serious on the 5 th day and the 6 th day, rectal lesions are observed through autopsy, bleeding points and white points with scattered needle tip shapes can be seen on the mucosa surface and the serosa surface, a small amount of orange red contents can be seen in the intestinal cavity, and no lesions can be observed on other organs; the plasmid + recombinant protein immune group, the recombinant protein + plasmid immune group and the non-immune non-infection control group have no blood dung, and are fed with normal drinking water.

The test results show that the coccidian resistance indexes of the pCDNA3.1 group and the pET30a group are both lower than 120, and the coccidian resistance indexes all present ineffective coccidian resistance effects; the plasmid + recombinant protein immune anticoccidial index is 160.25, and the recombinant protein + plasmid immune group anticoccidial index is 176.30, and has a medium-efficacy anticoccidial effect. The results are detailed in Table 14.

TABLE 14 evaluation of immunoprotection Effect of EB-GYYYF

The technical features of the embodiments described above may be arbitrarily combined, and for the sake of brevity, all possible combinations of the technical features in the embodiments described above are not described, but should be considered as being within the scope of the present specification as long as there is no contradiction between the combinations of the technical features.

The above-mentioned embodiments only express several embodiments of the present invention, and the description thereof is more specific and detailed, but not construed as limiting the scope of the invention. It should be noted that, for a person skilled in the art, several variations and modifications can be made without departing from the inventive concept, which falls within the scope of the present invention. Therefore, the protection scope of the present patent shall be subject to the appended claims.

Sequence listing

<110> animal health institute of academy of agricultural sciences, Guangdong province

<120> recombinant polypeptide and vaccine for preventing and treating eimeria brunetti

<160> 3

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1395

<212> DNA

<213> artificial sequence

<400> 1

ggatattatt ttcctacagt gggaccgaac cagcccaaat caggagggac ggggatgaat 60

tttgccagct tttaccctca ttctgaatgc gtgctttctt cttcgattcc cacctgcttg 120

gtcccgctca agggggcagc tgcctataca gcgctggggg gcttggaaga agaagaagcc 180

ccttgcgata ggtccaatgc tatggtgatt ggcttagcag cagcaggagg catcttgctg 240

ctgctgctga cagtgggagg gattgctgtc taccgaggga gagcggcagc agcaaagcag 300

cagcagcagc agcagcagca gcaacaccag cagcagcagc agcagcagca gcaggtagaa 360

atagaaaaca gcagcagctg caagggaata aggactagtg cctttaatga atccaaagaa 420

gcggcggcta aattcctaac cattaactct gctatcgcca tcgtggttaa ccagtccaag 480

acactcatgc gtcttcagat gtgcttggga tcagccatct ccagactgct gcggagaggg 540

atgaactcgt tctcacgaat ccgggagtac ttcagaaaac gccggtctgt gaaacgtgtt 600

atgctccagc gggctgtcgc tggcatgaag gccggctcaa ccgcagcagc catgagcaac 660

tcagaagccc tagaagcagc ggatagtctc cttgatagcc tcgttagcac aagtcgttct 720

agctctctaa aatctactgg aggaaagtct ctgttgaagg aagcggcggc taaactggct 780

accctatggc ccgtgggggc cctcggagaa gaccagccgg actcccgagg ggtgggcatc 840

aattacgcca actggtccag tggtgacggc acctgcgaaa tgtttgacac cattcccacc 900

tgcctcctcc ccgccccaca agccctcagt ttcacctccc tgggatcggc cgatcccaac 960

gatgcagaac tacccccctg cactgctgcg tctgagggat ggaaagtgcc ccgcttctgt 1020

gaatgcgatg aagcccagca aaacccttgg gtttgtgaaa atggggaatg gacggggggc 1080

agtgaagagt gcgaatgcag caacgccttg cccctggcct tgggcctcag cgtgggcctt 1140

ttagttcccg ttgcagcgat tgctgcttac ttcttcttca ggcgacaaag gcagaatagc 1200

ccttctcggc cttcagaaaa gaaacggctg ctcagtgaag acagagggga agaagaattc 1260

tcaaaagttg agcaaagaag aaaccataaa agaagcgatt tgctgcagga ggcagaacct 1320

tcattttggg gcgaaacaca acaagaccaa acaaatgtag taatagacga aaacgcccat 1380

gaagcttact actaa 1395

<210> 2

<211> 1395

<212> DNA

<213> artificial sequence

<400> 2

ggctactatt ttccgactgt tggtccgaac cagccaaaaa gcggcggcac tggcatgaac 60

ttcgcgagct tctacccgca cagcgagtgc gttctgtctt cctctatccc gacgtgtctg 120

gttcctctga aaggtgctgc agcgtacact gcactgggtg gcctggaaga agaagaagct 180

ccgtgcgacc gttctaacgc tatggttatc ggtctggctg ctgcaggcgg tatcctgctg 240

ctgctgctga ccgttggtgg tattgcagtt taccgtggtc gcgctgcagc agcgaaacag 300

cagcagcagc agcagcaaca gcagcaccag caacagcagc aacagcagca gcaggttgaa 360

atcgaaaact cctctagctg caaaggtatt cgcacttccg cgttcaacga atctaaagaa 420

gccgcggcga aattcctgac catcaactcc gcgatcgcta ttgtggtcaa ccagtccaaa 480

accctgatgc gcctgcagat gtgcctgggt tccgctatct ctcgcctgct gcgtcgtggc 540

atgaactcct tttctcgtat ccgcgagtac tttcgtaagc gtcgctctgt taaacgtgtt 600

atgctgcagc gtgcagtggc gggtatgaaa gctggtagca ctgcggctgc gatgtctaat 660

agcgaggctc tggaagctgc cgactctctg ctggacagcc tggtttccac ctcccgttcc 720

tcctctctga aatctactgg tggcaaaagc ctgctgaaag aagcggctgc taaactggca 780

accctgtggc cagttggtgc actgggtgaa gaccagccgg atagccgtgg cgttggcatt 840

aattacgcta actggtccag cggtgacggt acttgtgaaa tgtttgatac tattccaact 900

tgtctgctgc cggcaccaca ggcactgtct tttacctccc tgggttccgc agacccgaac 960

gatgcagaac tgccgccgtg caccgcagct tctgaaggtt ggaaagtgcc acgtttctgt 1020

gaatgtgatg aagcgcaaca gaacccgtgg gtgtgtgaaa atggcgaatg gactggtggt 1080

tccgaggaat gtgaatgttc taacgctctg cctctggctc tgggtctgtc cgttggtctg 1140

ctggttccgg ttgcggccat tgcagcatac ttctttttcc gtcgtcagcg tcagaactcc 1200

ccgtctcgtc cgtccgaaaa aaagcgtctg ctgtccgaag accgcggtga agaagagttc 1260

tccaaagttg agcagcgccg taaccacaaa cgttctgacc tgctgcagga agctgaaccg 1320

tctttctggg gtgaaaccca gcaggaccag acgaacgttg tgattgatga aaacgcgcat 1380

gaagcgtatt actaa 1395

<210> 3

<211> 464

<212> PRT

<213> artificial sequence

<400> 3

Gly Tyr Tyr Phe Pro Thr Val Gly Pro Asn Gln Pro Lys Ser Gly Gly

1 5 10 15

Thr Gly Met Asn Phe Ala Ser Phe Tyr Pro His Ser Glu Cys Val Leu

20 25 30

Ser Ser Ser Ile Pro Thr Cys Leu Val Pro Leu Lys Gly Ala Ala Ala

35 40 45

Tyr Thr Ala Leu Gly Gly Leu Glu Glu Glu Glu Ala Pro Cys Asp Arg

50 55 60

Ser Asn Ala Met Val Ile Gly Leu Ala Ala Ala Gly Gly Ile Leu Leu

65 70 75 80

Leu Leu Leu Thr Val Gly Gly Ile Ala Val Tyr Arg Gly Arg Ala Ala

85 90 95

Ala Ala Lys Gln Gln Gln Gln Gln Gln Gln Gln Gln His Gln Gln Gln

100 105 110

Gln Gln Gln Gln Gln Gln Val Glu Ile Glu Asn Ser Ser Ser Cys Lys

115 120 125

Gly Ile Arg Thr Ser Ala Phe Asn Glu Ser Lys Glu Ala Ala Ala Lys

130 135 140

Phe Leu Thr Ile Asn Ser Ala Ile Ala Ile Val Val Asn Gln Ser Lys

145 150 155 160

Thr Leu Met Arg Leu Gln Met Cys Leu Gly Ser Ala Ile Ser Arg Leu

165 170 175

Leu Arg Arg Gly Met Asn Ser Phe Ser Arg Ile Arg Glu Tyr Phe Arg

180 185 190

Lys Arg Arg Ser Val Lys Arg Val Met Leu Gln Arg Ala Val Ala Gly

195 200 205

Met Lys Ala Gly Ser Thr Ala Ala Ala Met Ser Asn Ser Glu Ala Leu

210 215 220

Glu Ala Ala Asp Ser Leu Leu Asp Ser Leu Val Ser Thr Ser Arg Ser

225 230 235 240

Ser Ser Leu Lys Ser Thr Gly Gly Lys Ser Leu Leu Lys Glu Ala Ala

245 250 255

Ala Lys Leu Ala Thr Leu Trp Pro Val Gly Ala Leu Gly Glu Asp Gln

260 265 270

Pro Asp Ser Arg Gly Val Gly Ile Asn Tyr Ala Asn Trp Ser Ser Gly

275 280 285

Asp Gly Thr Cys Glu Met Phe Asp Thr Ile Pro Thr Cys Leu Leu Pro

290 295 300

Ala Pro Gln Ala Leu Ser Phe Thr Ser Leu Gly Ser Ala Asp Pro Asn

305 310 315 320

Asp Ala Glu Leu Pro Pro Cys Thr Ala Ala Ser Glu Gly Trp Lys Val

325 330 335

Pro Arg Phe Cys Glu Cys Asp Glu Ala Gln Gln Asn Pro Trp Val Cys

340 345 350

Glu Asn Gly Glu Trp Thr Gly Gly Ser Glu Glu Cys Glu Cys Ser Asn

355 360 365

Ala Leu Pro Leu Ala Leu Gly Leu Ser Val Gly Leu Leu Val Pro Val

370 375 380

Ala Ala Ile Ala Ala Tyr Phe Phe Phe Arg Arg Gln Arg Gln Asn Ser

385 390 395 400

Pro Ser Arg Pro Ser Glu Lys Lys Arg Leu Leu Ser Glu Asp Arg Gly

405 410 415

Glu Glu Glu Phe Ser Lys Val Glu Gln Arg Arg Asn His Lys Arg Ser

420 425 430

Asp Leu Leu Gln Glu Ala Glu Pro Ser Phe Trp Gly Glu Thr Gln Gln

435 440 445

Asp Gln Thr Asn Val Val Ile Asp Glu Asn Ala His Glu Ala Tyr Tyr

450 455 460

Claims (11)

1. The amino acid sequence of the recombinant polypeptide is shown as SEQ ID NO. 3.

2. An isolated nucleic acid encoding the recombinant polypeptide of claim 1.

3. The nucleic acid of claim 2, which is codon optimized for a host.

4. The nucleic acid of claim 3, having a nucleotide sequence as set forth in SEQ ID NO 1 or SEQ ID NO 2.

5. A vector having the nucleic acid according to any one of claims 2 to 4.

6. A host cell having incorporated in its genome the nucleic acid of any one of claims 2 to 4, or the vector of claim 5.

7. A method of producing the recombinant polypeptide of claim 1, comprising:

culturing the host cell of claim 6 under suitable conditions, collecting the culture fluid and/or the lysate of the host cell, and isolating and purifying to obtain the recombinant polypeptide.

8. A vaccine comprising the recombinant polypeptide of claim 1, the nucleic acid of any one of claims 2 to 4, or the vector of claim 5.

9. The vaccine of claim 8, further comprising an adjuvant and/or a pharmaceutically acceptable carrier.

10. A kit of parts comprising the vaccine of claim 8 or 9, and a container for vaccination of the vaccine.

11. Use of the recombinant polypeptide of claim 1, the nucleic acid of any one of claims 2-4, or the vector of claim 5 in the preparation of a medicament for the control of eimeria brunetti.

Images