CN113307856B - Recombinant polypeptide and vaccine for preventing and treating eimeria maxima - Google Patents

Abstract

The invention relates to the field of veterinary biological products, and in particular relates to a recombinant polypeptide and a vaccine for preventing and treating Eimeria maxima. By immunizing the recombinant polypeptide vaccine EM-ATEV protein of the Eimeria maxima, the chicken body can be effectively controlled to infect the Eimeria maxima, the using amount of the coccidiostat in a chicken farm is greatly reduced, and the chicken coccidiosis is effectively controlled.

Description

Recombinant polypeptide and vaccine for preventing and treating eimeria maxima

Technical Field

The invention relates to the field of veterinary biological products, and in particular relates to a recombinant polypeptide and a vaccine for preventing and treating Eimeria maxima.

Background

Eimeria maxima (e.maxima) is an obligate intracellular parasitic apicomplexa, which can cause coccidiosis in chickens that seriously jeopardize the production of intensive chicken breeders. Under the condition of no preventive measures or failure of prevention (such as drug ineffectiveness caused by drug resistance problems), the morbidity of the chickens can reach 30-100%, and the mortality can reach 80%. The global economic loss caused by the coccidiosis of the chickens exceeds more than 30 billion dollars each year. At present, the prevention and control of chicken coccidiosis are still mainly implemented by technical methods of adding various anticoccidial drugs into feed for drug prevention and control and vaccine prevention and control of live oocyst vaccines. However, the wide and serious drug resistance of chicken coccidia and the potential virus-dispersing risk of live oocyst vaccine make the prevention and control of chicken coccidia face a serious challenge, and new anticoccidial drugs and vaccines are developed as problems to be solved urgently. However, the detailed interaction mechanism between coccidia and host cells is not systematically known so far, and the development of novel anticoccidial drugs and molecular vaccines is faced with great difficulty.

The microline protein is a microline secretory protein highly conserved in the phylum apicomplexa, can form a 'Moving Junction' together with a neck protein secreted by a rod-shaped body, completes the adhesion of polypide and host cells together, and is a key substance for assisting polypide to enter the host cells.

In view of the above, the present invention is particularly proposed.

Disclosure of Invention

The first aspect of the present invention relates to a recombinant polypeptide whose amino acid sequence is shown in SEQ ID NO. 3.

A second aspect of the invention relates to an isolated nucleic acid encoding a recombinant polypeptide as described above.

A third aspect of the present invention relates to a vector having a nucleic acid as described above.

A fourth aspect of the invention relates to a host cell, the genome of which incorporates a nucleic acid as described above, or a vector as described above.

A fifth aspect of the present invention relates to a method for producing a recombinant polypeptide as described above, comprising:

culturing the host cell under proper conditions, collecting the culture solution and/or the lysate of the host cell, and separating and purifying to obtain the recombinant polypeptide.

A sixth aspect of the invention relates to a vaccine comprising a recombinant polypeptide as described above, a nucleic acid as described above or a vector as described above.

A seventh aspect of the invention relates to a kit of parts comprising a vaccine as described above, and a container for vaccination of said vaccine.

An eighth aspect of the invention relates to the use of a recombinant polypeptide as described above, a nucleic acid as described above or a vector as described above for the preparation of a medicament for the control of eimeria maxima.

The invention has the beneficial effects that:

by immunizing the recombinant polypeptide vaccine EM-ATEV protein of the Eimeria maxima, the chicken body can be effectively controlled to infect the Eimeria maxima, the using amount of the coccidiostat in a chicken farm is greatly reduced, and the chicken coccidiosis is effectively controlled.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the embodiments or the prior art will be briefly described below, and it is obvious that the drawings in the following description are some embodiments of the present invention, and other drawings can be obtained by those skilled in the art without creative efforts.

FIG. 1 is a WB analysis of the E.maxima recombinant polypeptide vaccine EM-ATEV eukaryotic expression plasmid expressed in DF-1 cell (M. protein molecular mass standard; 1.DF-1 cell total protein; 2. prokaryotic expression positive control; 3.pCDA3.1-EM-ATEV1 transfected expression product into DF-1 cell) in one embodiment of the present invention;

FIG. 2 is an SDS-PAGE electrophoretic analysis chart of the recombinant E.maxima polypeptide vaccine EM-ATEV expression product in one embodiment of the invention (M. protein molecular mass standard; 1. non-induced bacteria liquid; 2.37 ℃ induced bacteria liquid; 3-4. purified recombinant expression protein);

FIG. 3 is a WB diagram of the EM-ATEV expression product of the E.maxima recombinant polypeptide vaccine (M. protein molecular mass standard; 1-2.pET30a-EM-ATEV2 recombinant purified protein) in one embodiment of the present invention.

Detailed Description

Reference will now be made in detail to embodiments of the invention, one or more examples of which are described below. Each example is provided by way of explanation, not limitation, of the invention. In fact, it will be apparent to those skilled in the art that various modifications and variations can be made in the present invention without departing from the scope or spirit of the invention. For instance, features illustrated or described as part of one embodiment, can be used on another embodiment to yield a still further embodiment.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. The terminology used in the description of the invention herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention. As used herein, the term "and/or" includes any and all combinations of one or more of the associated listed items.

The invention relates to a recombinant polypeptide, the amino acid sequence of which is shown as SEQ ID NO. 3.

The invention also relates to an isolated nucleic acid encoding a recombinant polypeptide as described above.

The nucleic acid may be DNA or RNA.

In some embodiments, the nucleic acid is codon optimized for the host.

In some embodiments, the nucleotide sequence of the nucleic acid is set forth in SEQ ID NO 1 or SEQ ID NO 2.

Furthermore, the amino acid sequence of the recombinant polypeptide may also be compared to a sequence selected from the group consisting of SEQ ID NO:3 is substantially similar in amino acid sequence. The nucleotide sequence of the nucleic acid may also be identical to a nucleotide sequence selected from SEQ ID NO:1 or SEQ ID NO. 2 is substantially similar in nucleotide sequence. By "substantially similar" is meant that a given nucleic acid or amino acid sequence shares at least 95% identity, e.g., 96%, 97%, 98%, 98.5%, 99%, 99.5%, with a reference sequence. Alternatively, it is intended that a given nucleic acid or amino acid sequence differs from a reference sequence by 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 nucleic acids or amino acids, preferably by amino acid substitution or deletion, for polypeptides. Preferably, the substantially similar sequence also retains the unique activity of the polypeptide that is capable of detecting endogenous antibodies with high efficiency. Substitutions are generally regarded as conservative substitutions, for example in the aliphatic amino acids Ala, Val, Leu and Ile for one another, for the hydroxyl residues Ser and Thr, for the acidic residues Asp and Glu, for the amide residues Asn and Gln, for the basic residues Lys and Arg and for the aromatic residues Phe, Tyr.

The invention also relates to a vector having a nucleic acid as described above.

The term "vector" refers to a nucleic acid delivery vehicle into which a polynucleotide can be inserted. When a vector is capable of expressing a protein encoded by an inserted polynucleotide, the vector is referred to as an expression vector. The vector may be introduced into a host cell by transformation, transduction, or transfection, and the genetic material elements carried thereby are expressed in the host cell. Vectors are well known to those skilled in the art and include, but are not limited to: a plasmid; phagemid; a cosmid; artificial chromosomes such as Yeast Artificial Chromosomes (YACs), Bacterial Artificial Chromosomes (BACs), or artificial chromosomes (PACs) derived from P1; bacteriophage such as lambda phage or M13 phage, animal virus, etc. Animal viruses that may be used as vectors include, but are not limited to, retroviruses (including lentiviruses), adenoviruses, adeno-associated viruses, herpes viruses (e.g., herpes simplex virus), poxviruses, baculoviruses, papilloma viruses, papilloma polyoma vacuolatum viruses (e.g., SV 40). In some embodiments, regulatory elements commonly used in genetic engineering, such as enhancers, promoters, Internal Ribosome Entry Sites (IRES), and other expression control elements (e.g., transcription termination signals, or polyadenylation signals and poly-U sequences, etc.) are included in the vectors of the present invention.

The invention also relates to a host cell, the genome of which incorporates a nucleic acid as described above, or a vector as described above.

The term "host cell" refers to a cell which can be used for introducing a vector, and includes, but is not limited to, prokaryotic cells such as Escherichia coli or Bacillus subtilis, fungal cells such as yeast cells or Aspergillus, insect cells such as S2 Drosophila cells or Sf9, or animal cells such as fibroblast, CHO cells, COS cells, NSO cells, HeLa cells, BHK cells, HEK 293 cells or human cells. The host cell is preferably a eukaryotic cell, more preferably an avian animal cell. Host cells are generally animal cells (preferably avian cells, e.g., chicken cells) that are not totipotent, e.g., do not include fertilized eggs, embryos, germ stem cells, embryonic stem cells, and the like.

The present invention also relates to a process for the preparation of a recombinant polypeptide as described above, comprising:

culturing the host cell under proper conditions, collecting the culture solution and/or the lysate of the host cell, and separating and purifying to obtain the recombinant polypeptide.

The invention also relates to a vaccine comprising a recombinant polypeptide as described above, a nucleic acid as described above or a vector as described above.

In some embodiments, the vaccine further comprises an adjuvant and/or a pharmaceutically acceptable carrier.

As used herein, an "adjuvant" is a substance that is capable of favoring or amplifying an immunological cascade of events, ultimately leading to a better immune response, i.e., an integrated physical response against an antigen. Adjuvants are generally not required for the immune response to occur, but facilitate or amplify the response.

The adjuvant may also be at least one of aluminum salt, liposome, incomplete Freund's adjuvant, complete Freund's adjuvant, alum adjuvant, MF59, monophosphoryl lipid A, flagellin, CpG-ODN, and Poly (I: C). In some embodiments, the aluminum salt is selected from the group consisting of aluminum phosphate, potassium aluminum phosphate, and aluminum hydroxide. Other well known adjuvants include hydrocarbon oils, polymers, saponins and/or adjuvants composed of gelled particles of sodium acrylate in water, for example, montanide m PET GEL ATM (Seppic, Paris France). A low molecular weight copolymer adjuvant may form crosslinks in solution to become a high molecular weight gel, such as POLYGENTM (mvplabases, Omaha). When added, the amount of adjuvant in the vaccine is typically between about 1% and 20% (v/v). In particular embodiments, the amount of adjuvant is between about 2% and 10% (v/v). In a more specific embodiment, the amount of adjuvant is between about 3% and 6% (v/v).

In some embodiments, the vaccine is a water-in-oil emulsion having an aqueous phase and an oil phase.

In some embodiments, the vaccine is an oil-in-water emulsion having an aqueous phase and an oil phase.

Vaccines are typically formulated for parenteral administration. Typical immunizations are achieved by Subcutaneous (SC) or Intramuscular (IM) injection, but the invention also contemplates vaccinations by the nasal route, or oral, Intravenous (IV), Intraperitoneal (IP), or Intradermal (ID) injection. Alternatively, the vaccine may also be administered via a skin patch, in a delayed release implant, scarification or topical application. Administration can also be via drinking water and/or food of the recipient bird.

The vaccines are administered in a manner compatible with the dosage formulation, and in amounts such as a therapeutically effective amount and an immunogenically effective amount. The amount administered will depend on the subject being treated, the ability of the subject's immune system to synthesize antibodies, and the degree of protection desired. The exact amount of active ingredient to be administered will depend on the judgment of the practitioner, and will vary from individual to individual. Suitable regimens for initial administration and booster vaccination may also vary, but are typically 1 injection or otherwise administered after a certain interval of time (weeks or months) after the first administration.

A "pharmaceutically acceptable carrier" is intended to aid in the stabilization and administration of the vaccine, while being harmless and well tolerated by the target. Such carriers may be, for example, sterile water or sterile physiological saline solution. In a more complex form, the carrier may for example be a buffer, which may contain further additives, such as stabilisers or preservatives. Aqueous or aqueous solutions saline solutions and aqueous solutions of sugars (e.g., dextrose and/or glycerol) may be employed as carriers, particularly for injectable solutions. Furthermore, the carrier may be and/or comprise a hydrocolloid and/or polymer solution, for example, to thicken the avian vaccine to be sprayed on the avian.

In some embodiments, the vaccine further comprises an inactivated virus and/or an inactivated bacterium (e.g., a bacterin) and/or an antigen of a bacterin. This may be derived from the microorganism pathogenic to the bird in any suitable manner, for example as a "live" attenuated, inactivated or subunit antigen.

The additional antigen derived from a microorganism pathogenic to avians is preferably derived from one or more microorganisms selected from the group consisting of:

-virus: infectious bronchitis virus, NDV, egg drop syndrome virus, IBDV, chicken anemia virus, avian encephalomyelitis virus, fowlpox virus, turkey rhinotracheitis virus, pigeon pox virus, MDV, avian leukemia virus, ILTV, avian pneumovirus and reovirus;

-a bacterium; escherichia coli, Salmonella (Salmonella), Ornitobacter rhinotracheale (Ornitobacterium rhinotracheale), Haemophilus paragallinarum (Haemophilus paragallinarum), Pasteurella multocida (Pasteurella multocida), Erysipelothrix rhusiopathiae (Erysipelothrix), Salvia species (Erysipelas), Mycoplasma (Mycoplasma) and Clostridium (Clostridium);

-parasites: eimeria (Eimeria); and

-fungi: aspergillus (Aspergillus).

According to a further aspect of the invention, it also relates to a kit of parts comprising a vaccine as described above, and a container for vaccination of said vaccine.

The inoculation container is preferably a medical syringe or a nasal dropper.

According to a further aspect of the invention, the invention also relates to the use of the recombinant polypeptide as described above, the nucleic acid as described above or the vector as described above for the preparation of a medicament for the control of E.maxima.

The invention further provides a method of protecting an avian against infection by eimeria maxima comprising administering to the animal a prophylactically effective/therapeutically effective amount of a vaccine according to the invention.

The term "avian" refers to wild or domesticated chickens, ducks, geese, swans, wild geese, pigeons, quails and the like, and particularly to chickens.

Factors affecting the preferred dosage regimen can include, for example, the species or breed of the subject (e.g., avian species or breed), age, weight, diet, activity, lung size, and condition; the route of administration; efficacy, safety and immune duration profiles of the particular vaccine used; whether a delivery system is used; and whether the vaccine is administered as part of a medicament and/or vaccine combination. Thus, the dosage actually employed may vary for a particular animal, and thus may deviate from the typical dosages described above. Determination of such dosage adjustments is generally within the skill of those in the art of vaccine development using conventional methods.

Embodiments of the present invention will be described in detail with reference to examples.

Examples

Preparation of 1 EM-ATEV coding gene

1.1 optimization of the encoding Gene

Bioinformatics analysis is carried out according to the gene related to the giant Eimeria microwire protein and the clavicle neck protein coded by the giant Eimeria microwire protein obtained by an applicant team, microwire protein 2(210 amino acids), microwire protein 2(216 amino acids) and clavicle neck protein 2(109 amino acids) are screened to be used as candidate tandem polypeptides, the amino acid sequences are shown as SEQ ID NO. 3, codon optimization is carried out on different hosts by using online codon optimization software, and prokaryotic expression coding gene sequences are respectively obtained and are shown as SEQ ID NO. 1, and eukaryotic expression coding gene sequences are respectively obtained and are shown as SEQ ID NO. 2.

1.2 Synthesis of the encoding Gene

An EM-ATEV prokaryotic coding gene (SEQ ID NO:1) and an eukaryotic coding gene (SEQ ID NO:2) are respectively prepared by using a whole gene synthesis technology, and T vector plasmids (pMD18-T-EM-ATEV1 and pMD18-T-EM-ATEV2) are respectively prepared.

Preparation of 2 EM-ATEV eukaryotic plasmid

2.1 primer design

Designing primer sequences aiming at the upstream and the downstream of a target gene:

an upstream primer EM-ATEV-ZF:

GAAGGATCCGCAACTGAAGTTGTTGCCTCTA TG (HindIII cleavage site underlined);

the downstream primer EM-ATEV-ZR:

GAAAAGCTTTCACTTCAGCGGTGCTTTAACG (BamHI cleavage site underlined).

2.2 Gene amplification

(1) PCR reaction system and amplification conditions

A pMD18-T-EM-ATEV1 plasmid is used as a template, PrimeSTAR high fidelity enzyme is used for amplifying a gene target fragment, and a specific reaction system and conditions are as follows:

TABLE 1 PCR reaction System of EM-ATEV1 (unit: μ L)

PCR reaction procedure:

pre-denaturation at 94 ℃ for 5min → denaturation at 94 ℃ for 30sec → annealing at 55 ℃ for 30sec → extension at 72 ℃ for 2min → extension at 72 ℃ for 10min → 4 ℃; for a total of 30 cycles.

(2) Electrophoresis

And (3) carrying out 1% agarose gel electrophoresis on the PCR product, and observing the result under an ultraviolet detector. The product size was about 1600bp, consistent with the expected product size.

(3) PCR product recovery

The target fragment was recovered with a DNA gel recovery kit and subjected to an enzymatic cleavage reaction (Table 2):

TABLE 2 EM-ATEV1 enzyme digestion reaction system (unit: μ L)

After incubation for 3h at 37 ℃, 1% agarose gel electrophoresis is carried out, and the target fragment after enzyme digestion is recovered by a DNA gel recovery kit.

2.3 treatment of expression vectors

mu.L (1. mu.g/. mu.L) of pCDNA3.1 plasmid was digested with BamHI and HindIII to establish the following digestion reactions:

TABLE 3 digestion reaction System of plasmid (unit: μ L)

After incubation at 37 ℃ for 3h, electrophoresis was performed on a 1% agarose gel. Recovering the plasmid after enzyme digestion by using a DNA gel recovery kit;

2.4 ligation of the digestion vector to the digestion fragment

The enzyme-digested EM-ATEV1 and pCDNA3.1 are combined according to the composition in Table 4 to establish a connection reaction, and a pCDNA3.1-EM-ATEV1 recombinant eukaryotic expression plasmid is constructed.

TABLE 4 ligation reaction System of enzyme digestion vector and fragment (Unit:. mu.L)

2.5 ligation product transformation E.coli DH 5. alpha

(1) Add 10 μ L of ligation product to 100 μ L e.coli DH5 α competent cells in an ice bath. Mix by gentle rotation and ice-bath for 30 min.

(2) Placing the centrifuge tube into a water bath preheated to 42 ℃, and standing for 90 s.

(3) The tube was quickly transferred to an ice bath to cool the cells for 1-2 min.

(4) Add 800. mu.L SOC medium to each tube, incubate 45min at 37 ℃ with slow shaking.

(5) The culture was spread on LB agar plates (containing 100. mu.g/mL Amp), the plates were left at room temperature until the liquid was absorbed, the plates were inverted and incubated overnight at 37 ℃ (about 12-16 h).

2.6 colony PCR method for identifying transformed clones

Several colonies were picked and inoculated into 10ml of LB medium (containing 100. mu.g/ml ampicillin), and after overnight culture at 37 ℃ with shaking, the culture was used to screen for positive clones by the following PCR reaction:

TABLE 5 PCR reaction System (unit: μ L) for identifying transformed clones

PCR reaction procedure: as above.

Taking 10 mu L of PCR reaction product, carrying out 1% agarose gel electrophoresis, selecting positive bacterial colony, shaking bacteria, and sequencing.

2.7 Positive clone sequencing verification

And (3) sending the positive clone obtained by colony PCR identification to a sequencing company for sequencing verification, after sequencing is completed, comparing sequencing results by software, wherein sequencing primers are shown in the following table:

TABLE 6 sequencing primers

2.8 plasmid petiole

The positive clone is verified by sequencing, and the plasmid is arranged to be extracted in small scale.

2.9 verification of EM-ATEV1 eukaryotic plasmid expression

2.9.1 cell transfection

(1) One day before transfection, DF-1 cells were digested and counted at 1.0X 10⁶The cell amount of cells/hole is inoculated to a 6-hole plate, the confluence degree of the cells after 24 hours is between 70% and 90%, and 2ml of complete culture medium is cultured in each hole;

(2) on the day of transfection, cells were changed to double-antibody-free complete medium at 37 ℃ with 5% CO₂Incubating in an incubator;

(3) preparation before transfection: a. diluting the plasmid DNA with 250 mu L of serum-free DMEM, and gently mixing; b. uniformly mixing lipofectamin reagent, taking a proper amount of lipofectamin reagent, diluting the lipofectamin reagent by 250 mu L of serum-free DMEM, slightly and uniformly mixing, and standing for 5 minutes at room temperature; c. mixing the DNA diluted in the first two steps with a lipofectamin reagent, gently mixing the mixture uniformly, and standing the mixture for 20-30 minutes at room temperature;

(4) adding the mixed solution obtained in the step 3 into each hole of the cells;

(5) after transfection for 4-6 h, replacing a complete culture medium;

(6) cells in 5% CO₂And (3) incubating for 48-72 h at 37 ℃ in an incubator, and detecting after transfection.

2.9.2 Western blot validation

2.9.2.1 sample preparation

(1) Removing the cell culture medium, gently washing the cells with PBS, scraping the cells from the culture dish with a scraper, transferring the cells into a 1.5ml EP tube, centrifuging for 5min at 1000rpm, washing for 3 times with PBS, centrifuging for 5min at 1000rpm, and discarding the supernatant;

(2) adding 100 μ L of lysis solution into each tube, and performing lysis on ice for 10 min;

(3) centrifuge at 12000rpm for 10min at 4 ℃ and transfer the supernatant to a new 1.5ml EP tube.

2.9.2.2 quantification of protein

A standard curve was prepared from 5 (1. mu.L), 10 (2. mu.L), 15 (3. mu.L), 20 (4. mu.L), 25 (5. mu.L), 30 (6. mu.L) and 35 (7. mu.L) of BSA (5 ug/. mu.L), and 2. mu.L of sample was taken, and the measurement was carried out in a triple tube, and the mean value was obtained. Adding 1mL of Bradford into each branch pipe for dyeing, and performing vortex oscillation for 20s to ensure that the Bradford is fully mixed and mixed, so that the light absorption value can be measured, and the operation interval between two samples during measurement should be about 20 s. The liquid is injected uniformly to avoid the generation of bubbles.

2.9.2.3 SDS-PAGE gel electrophoresis

According to the quantification, 20ug of each sample was taken and ddH was added₂The amount of O was adjusted to 18. mu.L, and then 6. mu.L of 4 Xloading buffer was added, and the mixture was boiled at 100 ℃ for 5min, centrifuged at 12000rpm at 4 ℃ for 3min, and subjected to electrophoresis. Constant pressure 130V/gel electrophoresis, until bromophenol blue runs out of the bottom of the gel, laminated gel concentration is 4%, and separation gel is 10%.

2.9.2.4 electrophoretic transfer film

(1) NC membrane is prepared, and gloves are worn when membrane cutting is carried out.

(2) The clamp is opened to keep the black side horizontal. A sponge cushion is arranged on the upper surface of the bag body, and a glass rod is used for rolling for several times to roll away air bubbles inside. Two layers of filter paper are padded on the sponge pad, the filter paper is fixed by one hand, and air bubbles in the filter paper are rolled away by a glass rod by the other hand.

(3) The sample glue and the film are put into a film rotating clamping plate marked with a positive electrode and a negative electrode: from the cathode side, the sponge pad → 2 layers of filter paper → sample gel → NC membrane → 2 layers of filter paper (note: air bubble removal) → sponge pad were fastened to the transfer nip plate, and the transfer nip plate was placed in a transfer electrophoresis tank containing a transfer buffer.

(4) The membrane transfer time is 1 hour and 30 minutes, and the constant current is as follows: 300 mA.

2, 9.2.5 sealing

5% skimmed milk powder was dissolved in 1 XTSST and blocked for 1h at room temperature.

2.9.2.6 incubation antibodies

(1) The primary antibody (rabbit anti-EM-ATEV polyclonal antibody, No. KHD2020125, Shanghai Biotech) was diluted to appropriate concentration with 1 XTSST and incubated at 4 ℃ overnight.

(2) After incubating the primary antibody overnight, the membranes were washed three times with TBST on a shaker for 5min each.

(3) The secondary antibody (goat anti-rabbit, code A0277, from Biyunyan) was diluted to the appropriate concentration with 1 XTSST and incubated with the membrane for 2h at room temperature, and the membrane was washed three times with 1 XTSST 5min each time on a shaker.

2.9.2.7 chemiluminescence, development, fixation

(1) Firstly, the liquid on the membrane is sucked dry by filter paper

(2) The two luminescent reagents A and B were mixed in equal volumes in an EP tube, the luminescent reagents were applied to a glass plate, the membrane was facing down, leveled with a gun and timed for 2 min.

(3) And uniformly dispensing the prepared ECL chemiluminescence liquid on an NC film, and exposing by using a chemiluminescence gel imaging system after 10-30 s. The results are shown in FIG. 1.

Preparation of 3EM-ATEV protein

3.1 primer design

Designing primer sequences aiming at the upstream and the downstream of a target gene:

an upstream primer EM-ATEV-YF:

GAA AAGCTTGCAACGGAAGTGGTGGCATC (BamHI cleavage site underlined);

the downstream primer EM-ATEV-YR:

GAAGGATCCTCACTTTAAAGGGGCTTTCA

CTC (HindIII cleavage site underlined).

3.2 Gene amplification

(1) PCR reaction system and amplification conditions: a pMD18-T-EM-ATEV2 plasmid is used as a template, PrimeSTAR high fidelity enzyme is used for amplifying a gene target fragment, and a specific reaction system and conditions are as follows:

TABLE 7 PCR reaction System of EM-ATEV2 (unit: μ L)

PCR reaction procedure:

pre-denaturation at 94 ℃ for 5min → denaturation at 94 ℃ for 30sec → annealing at 55 ℃ for 30sec → extension at 72 ℃ for 2min → extension at 72 ℃ for 10min → 4 ℃; for a total of 30 cycles.

(2) Electrophoresis: and (3) carrying out 1% agarose gel electrophoresis on the PCR product, and observing the result under an ultraviolet detector. The product size was approximately 1600bp, consistent with the expected product size.

(3) And (3) recovering a PCR product: the target fragment was recovered with a DNA gel recovery kit and subjected to an enzymatic cleavage reaction (Table 8):

TABLE 8 EM-ATEV2 enzyme digestion reaction system (unit: μ L)

After incubation for 3h at 37 ℃, 1% agarose gel electrophoresis is carried out, and the target fragment after enzyme digestion is recovered by a DNA gel recovery kit.

3.3 treatment of the expression vector

mu.L (1. mu.g/. mu.L) of pET30a plasmid was digested simultaneously with BamHI and Hind III to create the following digestion reactions, which digested the plasmid:

TABLE 9 digestion reaction System of plasmid (unit: μ L)

After incubation at 37 ℃ for 3h, electrophoresis was performed on a 1% agarose gel. Recovering the plasmid after enzyme digestion by using a DNA gel recovery kit;

3.4 ligation of the digestion vector to the digestion fragment

The enzyme-digested EM-ATEV2 and pET30a form a connection reaction according to the composition in Table 10, and pET30a-EM-ATEV2 recombinant prokaryotic expression plasmids are constructed.

TABLE 10 ligation reaction System of digestion vector and fragment (Unit:. mu.L)

3.5 ligation product transformation E.coli DH 5. alpha

(1) Add 10 μ L of ligation product to 100 μ L e.coli DH5 α competent cells in an ice bath. Mix by gentle rotation and ice-bath for 30 min.

(2) Placing the centrifuge tube into a water bath preheated to 42 ℃, and standing for 90 s.

(3) The tube was quickly transferred to an ice bath to cool the cells for 1-2 min.

(4) Add 800. mu.L SOC medium to each tube, incubate 45min at 37 ℃ with slow shaking.

(5) The culture was spread on LB agar plates (containing 50. mu.g/mL kanamycin sulfate), the plates were left at room temperature until the liquid was absorbed, the plates were inverted, and cultured overnight at 37 ℃ (about 12-16 h).

3.6 colony PCR method for identifying transformed clones

Several colonies were picked and inoculated into 10mL of LB medium (containing 50. mu.g/mL kanamycin sulfate), and after overnight culture at 37 ℃ with shaking, the culture was used to screen for positive clones by the following PCR reaction:

TABLE 11 PCR reaction System (unit: μ L) for identifying transformed clones

PCR reaction procedure: as above.

Taking 10 mu L of PCR reaction product, carrying out 1% agarose gel electrophoresis, selecting positive bacterial colony, shaking bacteria, and sequencing.

3.7 plasmid petiole

The positive clone is verified by sequencing, and the plasmid is arranged to be extracted in small scale.

3.8 inducible expression of pET30a-EM-ATEV2 in expression bacteria

3.8.1 transformation and induction of expression by expression vector

The constructed pET30a-EM-ATEV2 plasmid was transformed into BL21(DE3) competent cells, and then spread evenly on LB plates (containing 50. mu.g/mL kanamycin sulfate), after which it was placed upside down in an incubator at 37 ℃ overnight.

Single colonies were picked from the transformed plates, inoculated into 4L of LB medium (containing 50. mu.g/mL kanamycin sulfate), and cultured to OD₆₀₀0.5 to 0.8, IPTG was added to the culture medium at a final concentration of 0.1mM, followed by induction at 15 ℃ and 37 ℃ respectively.

3.8.2 SDS-PAGE analysis to identify induced expression results

Centrifuging induced culture solution at 12000rpm for 5min, removing supernatant, adding PBS solution to resuspend and precipitate, adding SDS-PAGE sample buffer, heating the sample at 100 deg.C for 10min, centrifuging, and collecting supernatant for electrophoresis. And (3) performing 100V stabilized voltage electrophoresis 10min before electrophoresis, after the bromophenol blue indicator enters the separation gel, performing 200V stabilized voltage electrophoresis until the bromophenol blue band moves to 1cm away from the bottom of the gel, taking out the gel, dyeing the gel with Coomassie brilliant blue dyeing solution, and then transferring the gel into a decoloring solution, and decoloring until the background is clear. The results are shown in FIG. 2.

3.8.3 protein purification

After the inclusion bodies were washed with 20mM PBS (pH7.2), 150mM NaCl containing 1% Triton X-100, 2mM EDTA, and 2mM DTT, the inclusion bodies were solubilized with 20mM PB (pH7.2), 150mM NaCl, 8M Urea, and 20mM Imidazole buffer while equilibrating the Ni-IDA column, and finally the target protein was eluted with equilibration buffer containing different concentrations of Imidazole, and each eluted fraction was collected for SDS-PAGE analysis. The results are shown in FIG. 2.

Purifying and analyzing by Ni-IDA affinity chromatography, collecting Lane 5-11 with high purity, adding into treated dialysis bag, dialyzing at 4 deg.C into buffer solution 1 × PBS (pH7.4), 4mM GSH, 0.4mM GSSG, 2mM EDTA, 0.4M L-Arginine for renaturation, and finally dialyzing EM-ATEV protein into storage solution 1 × PBS (pH7.4) and 10% Glycerol solution for about 6-8 h. After the renaturation by dialysis, the supernatant was filtered through a 0.22 μm filter and dispensed, and was frozen to-80 ℃.

3.9 immunoblot (Western blot) analysis of recombinant proteins

And (3) carrying out immune activity identification on the recombinant EM-ATEV2 protein by using an immunoblotting (Western blot) method. The primary antibody was murine his monoclonal antibody (Sigma) and the secondary antibody was goat anti-murine IgG-HRP (Sigma). The results are shown in FIG. 3.

Immunoprotective assay for 4 EM-ATEV

4.1 materials

Coccidian oocysts: the Whitebackeria maxima strain sporulated oocysts were preserved by the zoological research institute of animal health institute of Guangdong academy of agricultural sciences, and rejuvenated in coccidiless chicks before use.

Chicks: the green south yellow chicks are provided by animal science research institute of agriculture academy of sciences of Guangdong province and are raised in a sterilized special animal house; the chicken coop and the utensils are strictly disinfected, and the chicken coop can freely eat and drink purified water; before the experiment, the chicks are observed to have clinical symptoms and whether coccidian oocysts exist in the excrement is continuously checked for 3 days for later use.

Feed: the chick breeding material is customized by the animal science research institute of the Guangdong province academy of agricultural sciences, and does not contain any anticoccidial drugs.

4.2 test methods

Grouping: weighing 180 test chicks of 1 day old one by one, removing lean or overweight chicks, selecting healthy chickens with individual weight difference within 10g, and randomly dividing into 6 groups of 30 chicks each.

And (3) treatment:

emulsification of EM-ATEV2 recombinant protein: taking the EM-ATEV2 recombinant protein obtained after 3.9 purification and Freund's adjuvant (FCA) according to the ratio of 1: 1, uniformly mixing; repeatedly sucking with No. 7 needle syringe until no diffusion occurs within 5 min.

Test chickens were immunized with pcdna3.1-EM-ATEV1 eukaryotic plasmid (intramuscular injection in leg) or pET30a-EM-ATEV2 recombinant protein (subcutaneous injection) at 1, 7, and 14 days old, respectively, and a non-immune infected group and a non-immune non-infected group were used as controls. 21 days old each orally infected 8X 10⁴Fresh E.maxima sporulated oocysts. Observing and recording the mental state, feed intake, excrement condition and the like of the chicken flocks every day; weighing dead chicks, performing a autopsy, and if the chicks die due to the Eimeria maxima infection, recording the lesion as +4 points; all chicks were weighed one by one on day 7 post infection, necropsied, and jejunal lesion scored. Specific test groupings are detailed in table 12:

table 12 experimental group design

Anticoccidial index evaluation criteria:

relative rate of weight gain: the weight of the chickens is weighed at the beginning and the end of the test respectively, and the average weight gain and the relative weight gain rate are calculated. Relative weight gain rate (weight gain rate in each group/weight gain rate in non-immune non-infected group) × 100%.

Survival rate: the number of dead chickens in each group is recorded, and the death cause is determined by autopsy and the survival rate is calculated. Survival rate (number of surviving chickens/number of chickens in test group at end of test) × 100%.

The lesion value is: slaughtering the chickens 7 days after infection, scoring intestinal lesions of each chicken according to a lesion scoring method designed by Johnson and Reid (1970), and converting the lesion scores into lesion values;

jejunum was dissected 7 days post infection.

0 no macroscopic lesions were visible;

1, small bleeding spots can be seen on the mucosa surface of the middle section of the small intestine, and a small amount of orange mucus is in the intestinal cavity;

2, mild flatulence appears in the middle section of the small intestine, a plurality of bleeding points can be seen on the serosal surface and extend to the duodenum, and a large amount of orange mucus can be seen in the intestinal cavity;

3, the intestinal canal is expanded, normal intestinal contents are not contained, blood clots and orange mucus are mixed in the intestinal contents, the intestinal wall is thinned, and the mucosal surface is rough;

4 the intestinal canal is swollen, the content of the intestine is sticky and reddish brown, and is mixed with a large amount of blood clots, and the intestinal mucosa is congested, hemorrhagic and exfoliated. Chickens killed by this coccidia were scored as + 4.

The lesion value (0-40) is the average lesion score (0-4). times.10 for each test group.

Oocyst value: fecal oocysts were counted by the Macmester counting method, and the number of fecal Oocysts (OPG) per group was determined, and the number of oocysts was calculated and converted from Table 13 to obtain an oocyst value.

TABLE 13 conversion of oocyst count to oocyst value

Anticoccidial index (ACI): ACI is calculated as (relative rate of weight gain + survival) × 100- (lesion value + oocyst value).

Judging the immune effect standard: ACI >180 is highly effective; 160< ACI <180 is intermediate; 120< ACI <160 is less potent; ACI <120 was not effective against coccidia.

4.3 test results

Observation of clinical symptoms:

the non-immune infected control group test chickens gradually showed reactions such as decreased feed intake, poor spirit and the like after being infected with sporulated oocysts. On the 4 th day after infection, a small amount of reddish brown thin excrement is discharged from the pCDNA3.1 group, the pET30a group and the non-immune infection control group, the water intake is reduced, the control groups are more serious on the 5 th day and the 6 th day, jejunal lesions are observed through autopsy, small bleeding points can be seen on the mucous membrane surface, a plurality of bleeding points can be seen on the serosal surface, a small amount of orange mucus is in the intestinal cavity, and no lesions are observed on other organs; the plasmid + recombinant protein immune group, the recombinant protein + plasmid immune group and the non-immune non-infection control group have no blood dung, and are fed with normal drinking water.

The test results show that the coccidian resistance indexes of the pCDNA3.1 group and the pET30a group are both lower than 120, and the coccidian resistance indexes all present ineffective coccidian resistance effects; the plasmid + recombinant protein immune anticoccidial index is 168.50, and the recombinant protein + plasmid immune group anticoccidial index is 177.25, and has a medium-efficacy anticoccidial effect. The results are detailed in Table 14.

TABLE 14 evaluation of immunoprotective Effect of EM-ATEV

The technical features of the embodiments described above may be arbitrarily combined, and for the sake of brevity, all possible combinations of the technical features in the embodiments described above are not described, but should be considered as being within the scope of the present specification as long as there is no contradiction between the combinations of the technical features.

The above-mentioned embodiments only express several embodiments of the present invention, and the description thereof is more specific and detailed, but not construed as limiting the scope of the invention. It should be noted that, for a person skilled in the art, several variations and modifications can be made without departing from the inventive concept, which falls within the scope of the present invention. Therefore, the protection scope of the present patent shall be subject to the appended claims.

Sequence listing

<110> institute of animal health of academy of agricultural sciences of Guangdong province

<120> recombinant polypeptide and vaccine for preventing and treating Eimeria maxima

<160> 3

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1638

<212> DNA

<213> artificial sequence

<400> 1

gcaacggaag tggtggcatc aatgtggcct gtgggagcct tcgggcaaga ccagccggac 60

tcaaaaggag tgggagtaaa ctacgctaac tggttttcag acggcacttg cgagctgtac 120

gacaccgtgc ctacatgtct cacccccgcc tcttaccagg tagcctttac ttcgctgggg 180

tcgatcgacc ccacagatgc cgaattgccc ccctgcaatg ccgcctctga aggatggaaa 240

atctacacct actgcgaatg cggagaaggg caaagcgaac cttgggagtg taaaaacggc 300

gcatgggtgg gaggcagtaa tgaatgcgaa tgcggaagct atctcccatt ggctttgggt 360

ctcagcgttg gtttgctggt gccggtcgca gcgattgccg gttatttctt ctacaggcgg 420

cggaggcaga gcaaccaagg cagacccaca gaaaaaaaga gactcctcag tgaagaccag 480

ggaacagacg aggagttctc taaagtggac cagagaagac agcacaagcg aagtgacttt 540

gcacaggagg cagagccctc cttctgggga gagacgcagc aggaccagac aaatgtcatg 600

attgacgata acacacacga ggcatactac gaagcggcgg ctaaagacca tcctgtaact 660

gaagacgaaa acttcggaac atatggatat tttttcccca gtaccgagcc caatcaaccc 720

aagtcgggcg gcgagggtgt gaattttgcg agcttttatc cgggttcaat ggagtgctgg 780

ttatccggcg aaattccaac ttgtttggtg cctcttgagg gggcggctgc attcactgct 840

ctgggttcat tagaggaaga gacggcaccc tgtacagaca gcttcccgca aacgaagacc 900

ccttgcgatc gaaacacctg cacacagatc gtcgctacat gcgtctcagg aactctcgtg 960

tcagaggaag taccctgctc accagaggac ggcacccggt gtgaaggcgg ctttcccaag 1020

ggggtcatga taggtttggc agcagcggga ggcattttgt tactgctgtt gggtggaggg 1080

ggcttcttgc tctatcgtag cagaatgagg cctgcagcga agggagacga agcaactcgt 1140

tcagattatg tgcaggagga ggcggcagcc aacagacgca agcaaagaca gtcggattta 1200

gtgcagcagg cagagccttc cttctgggag gaggcagagg ctgatgaagc agaaacgggg 1260

gagagcaccc acgtgttagt tgaccaagat tacgaagcgg cggctaaatt cctaactatt 1320

aactctgcga tcgccattgt cgttaaccag tcaaaaacac tgatgcgcct tcagatgtgc 1380

ttgggatcag ctatctctag acttttgcga aaaggtatga gttctttttc gcgagttcgt 1440

gagtacttca gtaaacgccg gtctgtcaag cgagttatgc tccagcgggc tgttgctggc 1500

atgaaggccg gctcaatcac agcagctatg agcaactcgg aaaccctaga agctgcagat 1560

catctccttg ataggctcgt tcgcacaggc cgcacgaatc tcctacattc ttctggagtg 1620

aaagcccctt taaagtga 1638

<210> 2

<211> 1638

<212> DNA

<213> artificial sequence

<400> 2

gcaactgaag ttgttgcctc tatgtggcca gttggtgcgt ttggccagga ccagccagat 60

tctaaaggcg ttggtgtaaa ctatgcgaat tggttctccg atggtacctg tgaactgtac 120

gatactgtgc cgacctgtct gaccccggcg tcttaccagg ttgcgtttac cagcctgggt 180

tctatcgatc cgactgacgc agaactgcca ccgtgcaacg ctgccagcga aggttggaag 240

atttacacct actgcgaatg tggcgaaggt cagagcgaac cgtgggaatg caaaaacggc 300

gcgtgggtag gcggttccaa tgaatgtgaa tgcggttctt acctgccact ggctctgggc 360

ctgtctgtag gtctgctggt tccggtcgcg gctattgctg gctacttctt ctaccgccgt 420

cgtcgtcaat ctaaccaggg tcgtccgact gagaaaaaac gtctgctgtc tgaagatcag 480

ggcactgacg aggaattttc caaagtggac cagcgccgtc agcacaaacg ttctgacttc 540

gcgcaggagg cagaaccgtc cttctggggt gaaacccagc aggatcagac caacgttatg 600

atcgacgata acacccacga agcctactat gaagcagcgg ctaaagatca cccggtcact 660

gaagacgaaa acttcggcac ctatggctac tttttcccgt ctaccgagcc gaaccaaccg 720

aaatccggtg gtgaaggtgt taacttcgca tctttttacc cgggttctat ggagtgttgg 780

ctgtccggcg aaattccgac ttgtctggta ccactggaag gtgcagcagc tttcactgcg 840

ctgggctctc tggaggaaga aaccgctccg tgcaccgatt ccttccctca gaccaaaacc 900

ccgtgcgacc gcaacacttg tacccaaatc gttgcgacct gtgtgtctgg caccctggtg 960

tctgaagaag ttccatgctc tccggaggat ggtacgcgtt gtgaaggcgg tttcccgaaa 1020

ggtgttatga tcggcctggc tgctgctggc ggtattctgc tgctgctgct gggtggtggc 1080

ggttttctgc tgtaccgtag ccgtatgcgc ccggcagcta aaggcgacga agcaacccgt 1140

tctgattacg tgcaggagga agcggctgcg aatcgtcgca aacagcgtca atccgacctg 1200

gttcagcagg cggaaccgtc tttttgggaa gaagccgagg cagacgaagc tgaaacgggt 1260

gaatctaccc atgttctggt ggaccaggat tacgaagcgg ctgctaaatt cctgaccatc 1320

aacagcgcaa tcgcaatcgt tgtcaaccaa tccaaaaccc tgatgcgtct gcagatgtgc 1380

ctgggttctg ctatttcccg tctgctgcgc aaaggcatgt cctcttttag ccgcgtacgt 1440

gaatatttct ccaaacgtcg ttctgtgaaa cgtgttatgc tgcagcgtgc ggttgccggc 1500

atgaaagcag gtagcatcac cgcagcaatg tctaactccg aaaccctgga ggcagctgac 1560

cacctgctgg accgtctggt acgcactggt cgtaccaacc tgctgcactc ttccggcgtt 1620

aaagcaccgc tgaagtga 1638

<210> 3

<211> 545

<212> PRT

<213> artificial sequence

<400> 3

Ala Thr Glu Val Val Ala Ser Met Trp Pro Val Gly Ala Phe Gly Gln

1 5 10 15

Asp Gln Pro Asp Ser Lys Gly Val Gly Val Asn Tyr Ala Asn Trp Phe

20 25 30

Ser Asp Gly Thr Cys Glu Leu Tyr Asp Thr Val Pro Thr Cys Leu Thr

35 40 45

Pro Ala Ser Tyr Gln Val Ala Phe Thr Ser Leu Gly Ser Ile Asp Pro

50 55 60

Thr Asp Ala Glu Leu Pro Pro Cys Asn Ala Ala Ser Glu Gly Trp Lys

65 70 75 80

Ile Tyr Thr Tyr Cys Glu Cys Gly Glu Gly Gln Ser Glu Pro Trp Glu

85 90 95

Cys Lys Asn Gly Ala Trp Val Gly Gly Ser Asn Glu Cys Glu Cys Gly

100 105 110

Ser Tyr Leu Pro Leu Ala Leu Gly Leu Ser Val Gly Leu Leu Val Pro

115 120 125

Val Ala Ala Ile Ala Gly Tyr Phe Phe Tyr Arg Arg Arg Arg Gln Ser

130 135 140

Asn Gln Gly Arg Pro Thr Glu Lys Lys Arg Leu Leu Ser Glu Asp Gln

145 150 155 160

Gly Thr Asp Glu Glu Phe Ser Lys Val Asp Gln Arg Arg Gln His Lys

165 170 175

Arg Ser Asp Phe Ala Gln Glu Ala Glu Pro Ser Phe Trp Gly Glu Thr

180 185 190

Gln Gln Asp Gln Thr Asn Val Met Ile Asp Asp Asn Thr His Glu Ala

195 200 205

Tyr Tyr Glu Ala Ala Ala Lys Asp His Pro Val Thr Glu Asp Glu Asn

210 215 220

Phe Gly Thr Tyr Gly Tyr Phe Phe Pro Ser Thr Glu Pro Asn Gln Pro

225 230 235 240

Lys Ser Gly Gly Glu Gly Val Asn Phe Ala Ser Phe Tyr Pro Gly Ser

245 250 255

Met Glu Cys Trp Leu Ser Gly Glu Ile Pro Thr Cys Leu Val Pro Leu

260 265 270

Glu Gly Ala Ala Ala Phe Thr Ala Leu Gly Ser Leu Glu Glu Glu Thr

275 280 285

Ala Pro Cys Thr Asp Ser Phe Pro Gln Thr Lys Thr Pro Cys Asp Arg

290 295 300

Asn Thr Cys Thr Gln Ile Val Ala Thr Cys Val Ser Gly Thr Leu Val

305 310 315 320

Ser Glu Glu Val Pro Cys Ser Pro Glu Asp Gly Thr Arg Cys Glu Gly

325 330 335

Gly Phe Pro Lys Gly Val Met Ile Gly Leu Ala Ala Ala Gly Gly Ile

340 345 350

Leu Leu Leu Leu Leu Gly Gly Gly Gly Phe Leu Leu Tyr Arg Ser Arg

355 360 365

Met Arg Pro Ala Ala Lys Gly Asp Glu Ala Thr Arg Ser Asp Tyr Val

370 375 380

Gln Glu Glu Ala Ala Ala Asn Arg Arg Lys Gln Arg Gln Ser Asp Leu

385 390 395 400

Val Gln Gln Ala Glu Pro Ser Phe Trp Glu Glu Ala Glu Ala Asp Glu

405 410 415

Ala Glu Thr Gly Glu Ser Thr His Val Leu Val Asp Gln Asp Tyr Glu

420 425 430

Ala Ala Ala Lys Phe Leu Thr Ile Asn Ser Ala Ile Ala Ile Val Val

435 440 445

Asn Gln Ser Lys Thr Leu Met Arg Leu Gln Met Cys Leu Gly Ser Ala

450 455 460

Ile Ser Arg Leu Leu Arg Lys Gly Met Ser Ser Phe Ser Arg Val Arg

465 470 475 480

Glu Tyr Phe Ser Lys Arg Arg Ser Val Lys Arg Val Met Leu Gln Arg

485 490 495

Ala Val Ala Gly Met Lys Ala Gly Ser Ile Thr Ala Ala Met Ser Asn

500 505 510

Ser Glu Thr Leu Glu Ala Ala Asp His Leu Leu Asp Arg Leu Val Arg

515 520 525

Thr Gly Arg Thr Asn Leu Leu His Ser Ser Gly Val Lys Ala Pro Leu

530 535 540

Lys

545

Claims (11)

1. The amino acid sequence of the recombinant polypeptide is shown as SEQ ID NO. 3.

2. An isolated nucleic acid encoding the recombinant polypeptide of claim 1.

3. The nucleic acid of claim 2, which is codon optimized for a host.

4. The nucleic acid of claim 3, having a nucleotide sequence as set forth in SEQ ID NO 1 or SEQ ID NO 2.

5. A vector comprising the nucleic acid of any one of claims 2 to 4.

6. A host cell comprising the nucleic acid of any one of claims 2 to 4, or the vector of claim 5.

7. A method of producing the recombinant polypeptide of claim 1, comprising:

culturing the host cell of claim 6 under suitable conditions, collecting the culture fluid and/or the lysate of the host cell, and isolating and purifying to obtain the recombinant polypeptide.

8. A vaccine comprising the recombinant polypeptide of claim 1, the nucleic acid of any one of claims 2 to 4, or the vector of claim 5.

9. The vaccine of claim 8, further comprising an adjuvant and/or a pharmaceutically acceptable carrier.

10. A kit of parts comprising the vaccine of claim 8 or 9, and a container for vaccination of the vaccine.

11. Use of the recombinant polypeptide of claim 1, the nucleic acid of any one of claims 2-4, or the vector of claim 5 in the preparation of a medicament for the control of eimeria maxima.

Images